Yersinia pestis biovar Orientalis str. PEXU2 Chromosome_Sequence1, [asmbl_id: NC_000000].4770886, GC%: 47.68%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1515804..1516466) PHAGE_Strept_phiC31: gp26; YPH_1587; phage(gi40807292) 3e-05 Click
2complement(1516556..1517920) PHAGE_Burkho_phi1026b: gp59; YPH_1588; phage(gi38707949) 1e-21 Click
3complement(1518074..1518469) putative gamma carboxymuconolactone decarboxylase; YPH_1589 0.0 Click
4complement(1518647..1519537) PHAGE_Synech_S_SM1: 6-phosphogluconate dehydrogenase; YPH_1590; phage(gi326782617) 5e-11 Click
5complement(1519602..1520414) hypothetical protein; YPH_1591 0.0 Click
61520890..1521357 PHAGE_Escher_TL_2011b: putative outer membrane lipoprotein; YPH_1592; phage(gi418487638) 2e-08 Click
7complement(1521448..1521645) hypothetical protein; YPH_1593 0.0 Click
81521890..1522102 PHAGE_Lactoc_bIL312: Csp; YPH_1594; phage(gi13095918) 3e-17 Click
91522362..1522574 PHAGE_Lactoc_bIL312: Csp; YPH_1595; phage(gi13095918) 4e-17 Click
10complement(1522757..1523266) PHAGE_Hypert_2: IS element Dka2 orfA; YPH_1596; phage(gi300116744) 5e-15 Click
111523620..1524795 PHAGE_Clostr_phiCD38_2: tail tape measure; YPH_1598; phage(gi333798123) 7e-05 Click
12complement(1524902..1526248) putative exported protein; YPH_1599 0.0 Click
131526502..1527353 predicted glutathionylspermidine-utilizing glutathione transferase; YPH_1600 0.0 Click
14complement(1527543..1528148) PHAGE_Acinet_Ac42: hypothetical protein; YPH_1601; phage(gi311992578) 7e-19 Click

Region 2, total : 8 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2110314..2111096) PHAGE_Pseudo_F10: DNA replication protein DnaC; YPH_2168; phage(gi148912818) 2e-11 Click
2complement(2111093..2112115) PROPHAGE_Escher_CFT073: transposase; YPH_2169; phage(gi26248360) 0.0 Click
32112185..2112358 Aspartate--ammonia ligase; YPH_2170 0.0 Click
4complement(2112457..2113923) PHAGE_Bacill_36: putative metalloprotein chaperonin subunit; YPH_2171; phage(gi156564046) 1e-06 Click
5complement(2113927..2115480) PHAGE_Acidia_virus: hypothetical protein ATV_gp66; YPH_2172; phage(gi75750456) 1e-14 Click
62115754..2117622 PHAGE_Parame_FR483: hypothetical protein FR483_N110R; YPH_2173; phage(gi155370208) 3e-76 Click
72117827..2118246 predicted cytoplasmic sugar-binding protein; YPH_2174 0.0 Click
82118297..2119223 PHAGE_Synech_S_SSM7: putative carbohydrate kinase; YPH_2175; phage(gi326783786) 5e-06 Click

Region 3, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13330630..3330643 attL    AATCAGTTTGTGTG 0.0 Click
23340100..3340864 PHAGE_Vibrio_VP882: putative exonuclease; YPH_3375; phage(gi126010887) 4e-10 Click
33340977..3341053 tRNA 0.0 Click
4complement(3341110..3342594) putative permease; YPH_3377 0.0 Click
53342788..3342940 hypothetical protein; YPH_3378 0.0 Click
63342933..3343166 hypothetical protein; YPH_3379 0.0 Click
7complement(3343217..3343999) PROPHAGE_Escher_CFT073: transposase/IS protein; YPH_3380; phage(gi26248359) 3e-143 Click
8complement(3343996..3345018) PROPHAGE_Escher_CFT073: transposase; YPH_3381; phage(gi26248360) 0.0 Click
9complement(3345032..3345208) PROPHAGE_Escher_MG1655: CP4-57 prophage; integrase; YPH_3382; phage(gi16130540) 2e-06 Click
103345293..3345314 attL    CTTGGACTACTACAGACACAAA 0.0 Click
113345620..3345940 PHAGE_Burkho_2: gp7, putative addiction module killer protein; YPH_3383; phage(gi134288691) 2e-11 Click
123345940..3346260 PHAGE_Burkho_2: gp6, putative addiction module antidote protein; YPH_3384; phage(gi134288715) 5e-08 Click
133346257..3346358 hypothetical protein; YPH_3385 0.0 Click
143346368..3346562 hypothetical protein; YPH_3386 0.0 Click
15complement(3346609..3347697) PHAGE_Burkho_BcepGomr: BcepGomrgp62; YPH_3387; phage(gi146329974) 6e-28 Click
16complement(3347694..3348653) PHAGE_Entero_P4: DNA primase; YPH_3388; phage(gi9627512) 8e-47 Click
17complement(3348646..3348774) putative prophage protein; YPH_3389 0.0 Click
18complement(3348690..3349232) PHAGE_Entero_phiP27: hypothetical protein P27p16; YPH_3390; phage(gi18249880) 7e-07 Click
19complement(3349187..3349387) PHAGE_Entero_P4: transcriptional regulator; YPH_3391; phage(gi9627517) 5e-08 Click
20complement(3349380..3350276) PROPHAGE_Salmon_LT2: integrase; YPH_3392; phage(gi16766072) 4e-91 Click
21complement(3350289..3350579) hypothetical protein; YPH_3393 0.0 Click
223351075..3351302 hypothetical protein; YPH_3394 0.0 Click
23complement(3351464..3353134) PHAGE_Staphy_phiNM3: hypothetical protein; YPH_3395; phage(gi118725072) 8e-06 Click
24complement(3353185..3354273) putative phage protein; YPH_3396 0.0 Click
25complement(3354352..3355551) PROPHAGE_Escher_MG1655: CP4-57 prophage; integrase; YPH_3397; phage(gi16130540) 7e-131 Click
263355647..3355668 attR    CTTGGACTACTACAGACACAAA 0.0 Click
27complement(3355775..3356284) PROPHAGE_Salmon_Ty2: transposase; YPH_3398; phage(gi29143766) 6e-84 Click
283364040..3364053 attR    AATCAGTTTGTGTG 0.0 Click

Region 4, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13510470..3510760 PHAGE_Salmon_SPN3UB: hypothetical protein; YPH_3564; phage(gi423262443) 7e-16 Click
23510806..3511423 putative ATP-binding protein; YPH_3565 0.0 Click
33511428..3511622 PHAGE_Entero_SfV: hypothetical protein SfVp10; YPH_3566; phage(gi19549000) 1e-06 Click
43511619..3513127 PHAGE_Entero_SfV: tail sheath protein; YPH_3567; phage(gi19549001) 4e-107 Click
53513149..3513517 PHAGE_Entero_SfV: hypothetical protein SfVp12; YPH_3568; phage(gi19549002) 2e-10 Click
63513519..3513818 hypothetical protein; YPH_3569 0.0 Click
73513939..3515432 putative bacteriophage coat protein; YPH_3570 0.0 Click
83515468..3515674 hypothetical protein; YPH_3571 0.0 Click
93515699..3517105 PHAGE_Entero_SfV: tail/DNA circulation protein; YPH_3572; phage(gi19549005) 3e-20 Click
103517102..3518157 PHAGE_Entero_SfV: tail protein; YPH_3573; phage(gi19549006) 3e-32 Click
113518173..3518769 PHAGE_Entero_SfV: tail protein; YPH_3574; phage(gi19549007) 2e-17 Click
123518766..3519221 PHAGE_Entero_SfV: tail protein; YPH_3575; phage(gi19549008) 5e-14 Click
133519225..3520361 PHAGE_Entero_SfV: tail protein; YPH_3576; phage(gi19549009) 8e-33 Click
143520358..3520618 PHAGE_Salmon_ST64B: putative tail protein; YPH_3577; phage(gi23505467) 5e-05 Click
153520615..3520962 PHAGE_Entero_SfV: tail protein; YPH_3578; phage(gi19548988) 7e-11 Click
163521059..3521838 PHAGE_Entero_HK97: tail fiber; YPH_3579; phage(gi9634179) 8e-54 Click
173522136..3522876 PHAGE_Acanth_moumouvirus: putative glucosamine-fructose-6-phosphate aminotransferase; YPH_3580; phage(gi441432573) 3e-05 Click

Region 5, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14218468..4218480 attL    TGTTTTTTTTAGG 0.0 Click
2complement(4222579..4222848) PHAGE_Pectob_ZF40: putative integrase; YPH_4279; phage(gi422936642) 3e-20 Click
3complement(4222736..4223251) PHAGE_Pectob_ZF40: putative integrase; YPH_4280; phage(gi422936642) 6e-63 Click
44223362..4223589 PHAGE_Salmon_SPN9CC: replicative DNA helicase; YPH_4281; phage(gi389060513) 2e-14 Click
54223958..4224104 hypothetical protein; YPH_4282 0.0 Click
6complement(4224071..4224166) hypothetical protein; YPH_4283 0.0 Click
74224694..4224705 attL    TTTATGACAGAG 0.0 Click
8complement(4224926..4225141) hypothetical protein; YPH_4284 0.0 Click
9complement(4225167..4225511) hypothetical protein; YPH_4285 0.0 Click
10complement(4225731..4226690) PHAGE_Lactob_phiAT3: putative transposase B; YPH_4286; phage(gi48697274) 6e-15 Click
11complement(4226762..4227181) hypothetical protein; YPH_4287 0.0 Click
12complement(4227292..4227432) PHAGE_Erwini_ENT90: tail sheath protein; YPH_4288; phage(gi431810939) 3e-14 Click
13complement(4227597..4227875) putative membrane protein; YPH_4289 0.0 Click
14complement(4227856..4228161) hypothetical protein; YPH_4290 0.0 Click
15complement(4228158..4228373) putative membrane protein; YPH_4291 0.0 Click
16complement(4228764..4228859) PHAGE_Erwini_ENT90: conserved hypothetical tail fiber protein; YPH_4292; phage(gi431810959) 7e-08 Click
17complement(4228808..4229095) PHAGE_Aeromo_vB_AsaM_56: putative tail-fiber protein; YPH_4293; phage(gi422937565) 6e-06 Click
18complement(4229112..4229411) PHAGE_Erwini_ENT90: baseplate assembly protein; YPH_4294; phage(gi431810974) 1e-24 Click
19complement(4229408..4229767) PHAGE_Erwini_ENT90: baseplate assembly protein; YPH_4295; phage(gi431810950) 6e-20 Click
204229798..4230070 PHAGE_Burkho_phiE202: gp6, pANL56; YPH_4296; phage(gi134288760) 2e-12 Click
214230051..4230341 PHAGE_Burkho_phiE202: gp7, pANL12; YPH_4297; phage(gi134288781) 3e-07 Click
224230407..4231483 hypothetical protein; YPH_4298 0.0 Click
234231531..4232391 PROPHAGE_Escher_CFT073: transposase; YPH_4299; phage(gi26246249) 3e-139 Click
244232391..4232729 PROPHAGE_Escher_CFT073: transposase; YPH_4300; phage(gi26246249) 2e-56 Click
25complement(4233147..4233716) putative exported protein; YPH_4301 0.0 Click
26complement(4233728..4234162) hypothetical protein; YPH_4302 0.0 Click
274234580..4234786 PHAGE_Entero_Sf6: putative transposase OrfB; YPH_4303; phage(gi41057343) 1e-22 Click
284234813..4234944 PROPHAGE_Salmon_LT2: transposase; YPH_4304; phage(gi16766077) 1e-06 Click
294247217..4247228 attR    TTTATGACAGAG 0.0 Click
304247711..4247723 attR    TGTTTTTTTTAGG 0.0 Click

Region 6, total : 57 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14472775..4472805 attL    ATATTGAATAAGCCGAGTTGGGCTAAATAAC 0.0 Click
2complement(4472831..4474069) PHAGE_Salmon_1: putative bacteriophage integrase; YPH_4537; phage(gi169257156) 1e-125 Click
34474139..4475161 PROPHAGE_Escher_CFT073: transposase; YPH_4538; phage(gi26248360) 0.0 Click
44475158..4475940 PROPHAGE_Escher_CFT073: transposase/IS protein; YPH_4539; phage(gi26248359) 3e-143 Click
5complement(4476108..4476368) PHAGE_Gifsy_2: bacteriophage excisionase; YPH_4540; phage(gi169257269) 4e-19 Click
6complement(4476668..4477312) PHAGE_Pseudo_F116: DNA adenine methyltransferase; YPH_4541; phage(gi56692911) 4e-43 Click
74477411..4477839 PHAGE_Cronob_ENT47670: putative ninB protein; YPH_4542; phage(gi431810524) 2e-46 Click
84477913..4478518 PHAGE_Salmon_ST160: NinG; YPH_4543; phage(gi318065938) 4e-43 Click
94478519..4478908 PHAGE_Entero_2008: antitermination protein Q; YPH_4544; phage(gi209427762) 2e-44 Click
104479179..4479742 PHAGE_Salmon_SPN3UB: hypothetical protein; YPH_4545; phage(gi423262398) 1e-29 Click
11complement(4479827..4480009) hypothetical phage protein; YPH_4546 0.0 Click
124480166..4480375 hypothetical phage protein; YPH_4547 0.0 Click
13complement(4480372..4480647) hypothetical phage protein; YPH_4548 0.0 Click
144481121..4481633 PHAGE_Cronob_phiES15: putative endolysin; YPH_4549; phage(gi401817587) 2e-51 Click
154481618..4482076 PHAGE_Entero_cdtI: lysin; YPH_4550; phage(gi148609441) 2e-24 Click
164482064..4482156 hypothetical protein; YPH_4551 0.0 Click
174482538..4483335 PHAGE_Cronob_ENT47670: phage antirepressor protein; YPH_4552; phage(gi431810509) 8e-50 Click
184483792..4484427 PHAGE_Pectob_ZF40: putative transposase; YPH_4553; phage(gi422936679) 3e-87 Click
194484458..4484907 PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; YPH_4554; phage(gi399528759) 4e-51 Click
204485543..4486751 PROPHAGE_Escher_CFT073: transposase; YPH_4555; phage(gi26246249) 0.0 Click
214486756..4487730 PHAGE_Cronob_phiES15: terminase large subunit; YPH_4556; phage(gi401817592) 5e-144 Click
224487730..4488458 PHAGE_Burkho_KL1: portal protein; YPH_4557; phage(gi399528722) 2e-35 Click
234488477..4489118 PHAGE_Burkho_KL1: portal protein; YPH_4558; phage(gi399528722) 1e-34 Click
244489119..4490231 PHAGE_Cronob_phiES15: hypothetical protein; YPH_4559; phage(gi401817594) 3e-123 Click
254490353..4491126 PHAGE_Xantho_Xp15: putative phage structural protein; YPH_4560; phage(gi66392059) 1e-19 Click
264491140..4492345 PHAGE_Acinet_Bphi_B1251: major capsid protein; YPH_4561; phage(gi423262007) 1e-113 Click
27complement(4492794..4492925) hypothetical protein; YPH_4562 0.0 Click
284492872..4493126 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4563; phage(gi410491538) 8e-20 Click
294493128..4493478 PHAGE_Cronob_phiES15: putative structural protein 2; YPH_4564; phage(gi401817599) 5e-33 Click
304493480..4494064 PHAGE_Shigel_EP23: putative tail protein; YPH_4565; phage(gi371496282) 2e-27 Click
314494061..4494468 PHAGE_Cronob_phiES15: hypothetical protein; YPH_4566; phage(gi401817601) 1e-16 Click
324494534..4495454 PHAGE_Cronob_phiES15: putative major tail protein; YPH_4567; phage(gi401817602) 3e-75 Click
334495467..4495778 PHAGE_Cronob_phiES15: hypothetical protein; YPH_4568; phage(gi401817603) 9e-32 Click
344495865..4496086 PHAGE_Cronob_phiES15: hypothetical protein; YPH_4569; phage(gi401817604) 6e-14 Click
354496087..4499590 PHAGE_Entero_mEp213: tail length tape measure protein; YPH_4570; phage(gi428782602) 5e-152 Click
364499593..4499934 PHAGE_Cronob_phiES15: putative minor tail protein; YPH_4571; phage(gi401817607) 1e-31 Click
374500188..4500697 PROPHAGE_Salmon_Ty2: transposase; YPH_4573; phage(gi29143766) 6e-84 Click
384500818..4501570 PHAGE_Entero_HK225: minor tail protein; YPH_4574; phage(gi428782393) 3e-101 Click
394501573..4502283 PHAGE_Entero_HK140: minor tail protein K; YPH_4575; phage(gi428781957) 8e-109 Click
404502544..4503176 hypothetical phage protein; YPH_4576 0.0 Click
41complement(4503255..4503794) PHAGE_Escher_TL_2011b: hypothetical protein; YPH_4577; phage(gi418487671) 3e-32 Click
424503786..4503977 PHAGE_Escher_TL_2011b: hypothetical protein; YPH_4578; phage(gi418487672) 6e-15 Click
434503964..4505058 PHAGE_Haemop_Aaphi23: putative antirepressor protein Ant; YPH_4579; phage(gi31544021) 4e-37 Click
444505157..4505708 PHAGE_Cronob_phiES15: hypothetical protein; YPH_4580; phage(gi401817606) 5e-08 Click
454505978..4506097 hypothetical protein; YPH_4581 0.0 Click
464506122..4506742 PHAGE_Entero_mEpX2: tail assembly protein; YPH_4582; phage(gi428765633) 9e-66 Click
474506784..4506948 hypothetical protein; YPH_4583 0.0 Click
484507314..4510517 PHAGE_Cronob_phiES15: putative host specificity protein; YPH_4584; phage(gi401817611) 0.0 Click
494510517..4511515 PHAGE_Cronob_phiES15: hypothetical protein; YPH_4585; phage(gi401817612) 7e-25 Click
504511532..4512449 PHAGE_Salmon_SSU5: putative phage tail fiber protein; YPH_4586; phage(gi410491431) 2e-09 Click
514512460..4512879 PHAGE_Bacter_2: tail fiber; YPH_4587; phage(gi212499733) 2e-10 Click
524512876..4513031 hypothetical phage protein; YPH_4588 0.0 Click
53complement(4513100..4514308) PROPHAGE_Escher_CFT073: transposase; YPH_4589; phage(gi26246249) 0.0 Click
544514499..4514529 attR    ATATTGAATAAGCCGAGTTGGGCTAAATAAC 0.0 Click
55complement(4514613..4515785) hypothetical phage protein; YPH_4590 0.0 Click
56complement(4515789..4516988) PHAGE_Africa_virus: NifS-like protein; YPH_4591; phage(gi9628230) 4e-08 Click
57complement(4517005..4517745) hypothetical phage protein; YPH_4592 0.0 Click
584518837..4519193 hypothetical phage protein; YPH_4593 0.0 Click
59complement(4519610..4520140) PHAGE_Bacill_SPBc2: putative disulfide oxidoreductase; YPH_4594; phage(gi9630148) 3e-05 Click

Region 7, total : 73 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4666136..4666399) phage hypothetical protein; YPH_4740 0.0 Click
2complement(4666421..4666627) phage hypothetical protein; YPH_4741 0.0 Click
34666692..4667354 PROPHAGE_Escher_CFT073: transposase/IS protein; YPH_4742; phage(gi26248359) 1e-120 Click
44667370..4667909 PHAGE_Salmon_SSU5: DNA polymerase III alpha subunit; YPH_4743; phage(gi410491462) 1e-90 Click
54667906..4668349 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4744; phage(gi410491463) 7e-75 Click
6complement(4668379..4668942) PHAGE_Salmon_SSU5: putative phage transcriptional regulator AlpA-like protein; YPH_4745; phage(gi410491464) 1e-67 Click
74669445..4669918 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4746; phage(gi410491466) 3e-75 Click
84670038..4671066 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4747; phage(gi410491467) 0.0 Click
94671127..4672071 PHAGE_Salmon_SSU5: DNA polymerase I; YPH_4748; phage(gi410491468) 0.0 Click
104672071..4672337 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4749; phage(gi410491469) 2e-43 Click
114672340..4673416 PHAGE_Salmon_SSU5: putative RecA-like recombinase; YPH_4750; phage(gi410491470) 0.0 Click
124673507..4673707 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4751; phage(gi410491471) 1e-29 Click
134673711..4674541 PHAGE_Salmon_SSU5: putative SPFH domain / band 7 protein; YPH_4752; phage(gi410491472) 1e-153 Click
144674695..4675066 PHAGE_Salmon_SSU5: putative NinX-like protein; YPH_4753; phage(gi410491473) 5e-62 Click
154675050..4675460 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4754; phage(gi410491474) 2e-76 Click
164675528..4675803 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4755; phage(gi410491475) 3e-47 Click
174675844..4676023 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4756; phage(gi410491476) 3e-22 Click
184676020..4676355 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4757; phage(gi410491477) 5e-54 Click
194676352..4676567 PHAGE_Salmon_SSU5: putative Cre-associated protein; YPH_4758; phage(gi410491478) 4e-35 Click
20complement(4677135..4678199) PHAGE_Salmon_SSU5: putative replication protein RepA; YPH_4759; phage(gi410491479) 0.0 Click
214678141..4678260 hypothetical protein; YPH_4760 0.0 Click
224678944..4679588 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4761; phage(gi410491480) 1e-121 Click
234679664..4679810 hypothetical protein; YPH_4762 0.0 Click
24complement(4679948..4680970) putative periplasmic protein; YPH_4763 0.0 Click
25complement(4680867..4681139) hypothetical protein; YPH_4764 0.0 Click
264681386..4682471 PHAGE_Salmon_SSU5: putative exonuclease subunit 1; YPH_4765; phage(gi410491483) 0.0 Click
274682468..4682692 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4766; phage(gi410491484) 1e-28 Click
284682701..4684617 PHAGE_Salmon_SSU5: putative exonuclease subunit 2; YPH_4767; phage(gi410491485) 0.0 Click
29complement(4684589..4684684) hypothetical protein; YPH_4768 0.0 Click
304684607..4685353 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4769; phage(gi410491486) 4e-138 Click
314685366..4685935 PHAGE_Salmon_SSU5: putative ribonuclease H-like domain-containing protein; YPH_4770; phage(gi410491487) 2e-105 Click
324686093..4686602 PROPHAGE_Salmon_Ty2: transposase; YPH_4772; phage(gi29143766) 6e-84 Click
334686796..4687083 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4773; phage(gi410491525) 5e-48 Click
344687043..4687276 hypothetical protein; YPH_4774 0.0 Click
354687289..4687771 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4775; phage(gi410491527) 3e-86 Click
364688289..4688432 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4776; phage(gi410491528) 4e-17 Click
37complement(4688410..4688637) hypothetical protein; YPH_4777 0.0 Click
38complement(4688722..4689372) PHAGE_Salmon_SSU5: hypothetical protein; YPH_4778; phage(gi410491530) 5e-118 Click
39complement(4689694..4690221) PHAGE_Salmon_SSU5: putative repressor of phase 1 flagellin; YPH_4779; phage(gi410491531) 6e-82 Click
40complement(4690226..4690648) PHAGE_Salmon_SSU5: putative lipoprotein; YPH_4780; phage(gi410491532) 4e-65 Click
41complement(4690708..4690986) PHAGE_Salmon_SSU5: hypothetical protein; YPH_4781; phage(gi410491533) 1e-44 Click
42complement(4690989..4692548) PHAGE_Salmon_SSU5: putative helicase; YPH_4782; phage(gi410491534) 0.0 Click
434692613..4693311 PHAGE_Salmon_SSU5: putative ParB-like nuclease domain-containing protein; YPH_4783; phage(gi410491535) 9e-128 Click
444693311..4693979 PHAGE_Salmon_SSU5: putative ParB-like nuclease domain-containing protein; YPH_4784; phage(gi410491536) 8e-118 Click
454693916..4694614 PHAGE_Salmon_SSU5: putative ABC transporter ATP-binding protein; YPH_4785; phage(gi410491537) 7e-113 Click
464694607..4694861 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4786; phage(gi410491538) 4e-42 Click
474694858..4695757 PHAGE_Salmon_SSU5: putative ABC transporter ATP-binding protein; YPH_4787; phage(gi410491539) 1e-170 Click
484695767..4696033 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4788; phage(gi410491540) 9e-45 Click
494696229..4696870 PHAGE_Salmon_SSU5: putative DNA-binding protein; YPH_4789; phage(gi410491411) 9e-116 Click
504696873..4698129 PHAGE_Salmon_SSU5: putative terminase large subunit; YPH_4790; phage(gi410491412) 0.0 Click
514698148..4699737 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4791; phage(gi410491413) 0.0 Click
524699760..4700593 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4792; phage(gi410491414) 3e-149 Click
534700620..4701495 PHAGE_Salmon_SSU5: putative major capsid protein; YPH_4793; phage(gi410491415) 4e-164 Click
544701570..4702232 PHAGE_Salmon_SSU5: putative Ig-like domain-containing protein; YPH_4794; phage(gi410491416) 5e-114 Click
554702276..4702710 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4795; phage(gi410491417) 1e-75 Click
564702710..4703543 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4796; phage(gi410491418) 9e-155 Click
574703527..4703985 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4797; phage(gi410491419) 1e-59 Click
584703976..4704449 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4798; phage(gi410491420) 4e-84 Click
594704451..4704834 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4799; phage(gi410491421) 6e-68 Click
604704909..4705655 PHAGE_Salmon_SSU5: putative Ig-like domain-containing protein; YPH_4800; phage(gi410491422) 9e-135 Click
614705715..4706032 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4801; phage(gi410491423) 2e-52 Click
624706113..4706382 PHAGE_Salmon_SSU5: hypothetical protein; YPH_4802; phage(gi410491424) 8e-39 Click
634706390..4710967 PHAGE_Salmon_SSU5: putative tail tape measure protein; YPH_4803; phage(gi410491425) 0.0 Click
644711009..4711344 PHAGE_Salmon_SSU5: putative minor tail protein M; YPH_4804; phage(gi410491426) 3e-60 Click
654711401..4712132 PHAGE_Salmon_SSU5: putative minor tail protein L; YPH_4805; phage(gi410491427) 4e-137 Click
664712125..4712922 PHAGE_Salmon_SSU5: putative phage tail protein; YPH_4806; phage(gi410491428) 3e-156 Click
674712910..4713497 PHAGE_Salmon_SSU5: putative phage tail protein; YPH_4807; phage(gi410491429) 1e-105 Click
684713513..4718150 PHAGE_Salmon_SSU5: putative phage tail protein; YPH_4808; phage(gi410491430) 0.0 Click
694718168..4718785 PHAGE_Entero_phiP27: hypothetical protein P27p57; YPH_4809; phage(gi18249921) 3e-22 Click
704718866..4721754 PHAGE_Salmon_SSU5: putative phage tail fiber protein; YPH_4810; phage(gi410491431) 3e-118 Click
714722056..4722664 PHAGE_Entero_HK630: tail fiber assembly protein; YPH_4811; phage(gi428782810) 3e-66 Click
72complement(4722798..4723580) PROPHAGE_Escher_CFT073: transposase/IS protein; YPH_4812; phage(gi26248359) 3e-143 Click
73complement(4723577..4724599) PROPHAGE_Escher_CFT073: transposase; YPH_4813; phage(gi26248360) 0.0 Click

Region 8, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4730137..4730814) PHAGE_Bordet_1: adenine DNA methyltransferase; YPH_4820; phage(gi41179391) 9e-22 Click
24731207..4731515 hypothetical protein; YPH_4821 0.0 Click
3complement(4731677..4733074) putative DNA-binding protein; YPH_4822 0.0 Click
44733170..4733316 Error-prone repair protein UmuC; YPH_4823 0.0 Click
54733313..4733546 hypothetical protein; YPH_4824 0.0 Click
6complement(4733453..4734424) PHAGE_Entero_P1: ParB; YPH_4825; phage(gi46401681) 1e-60 Click
7complement(4734421..4735626) PHAGE_Entero_P1: ParA; YPH_4826; phage(gi46401682) 4e-132 Click
84735928..4736155 Prevent-host-death family protein; YPH_4827 0.0 Click
94736155..4736481 Inner membrane protein; YPH_4828 0.0 Click
104736681..4737301 PHAGE_Sodali_phiSG1: resolvase; YPH_4829; phage(gi89886020) 1e-05 Click
114737367..4738308 PHAGE_Sodali_phiSG1: transposase; YPH_4830; phage(gi89886005) 3e-82 Click