Yersinia pestis biovar Orientalis str. India 195 [asmbl_id: NC_000000].4719608, GC%: 47.56%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 22 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11489865..1489878 attL    AATCAGTTTGTGTG 0.0 Click
21500176..1500940 PHAGE_Vibrio_VP882: putative exonuclease; YPF_1481; phage(gi126010887) 4e-10 Click
31501053..1501129 tRNA 0.0 Click
4complement(1501186..1502670) putative permease; YPF_1483 0.0 Click
51502864..1503016 hypothetical protein; YPF_1484 0.0 Click
61503009..1503242 hypothetical protein; YPF_1485 0.0 Click
7complement(1503293..1504075) PROPHAGE_Escher_CFT073: transposase/IS protein; YPF_1486; phage(gi26248359) 3e-143 Click
8complement(1504072..1505094) PROPHAGE_Escher_CFT073: transposase; YPF_1487; phage(gi26248360) 0.0 Click
9complement(1505108..1505284) PROPHAGE_Escher_MG1655: CP4-57 prophage; integrase; YPF_1488; phage(gi16130540) 2e-06 Click
101505369..1505390 attL    CTTGGACTACTACAGACACAAA 0.0 Click
111505696..1506016 PHAGE_Burkho_2: gp7, putative addiction module killer protein; YPF_1489; phage(gi134288691) 2e-11 Click
121506016..1506336 PHAGE_Burkho_2: gp6, putative addiction module antidote protein; YPF_1490; phage(gi134288715) 5e-08 Click
131506333..1506434 hypothetical protein; YPF_1491 0.0 Click
141506444..1506638 hypothetical protein; YPF_1492 0.0 Click
15complement(1506685..1507773) PHAGE_Burkho_BcepGomr: BcepGomrgp62; YPF_1493; phage(gi146329974) 6e-28 Click
16complement(1507770..1508729) PHAGE_Entero_P4: DNA primase; YPF_1494; phage(gi9627512) 8e-47 Click
17complement(1508722..1509264) PHAGE_Entero_phiP27: hypothetical protein P27p16; YPF_1495; phage(gi18249880) 7e-07 Click
18complement(1509264..1509464) PHAGE_Entero_P4: transcriptional regulator; YPF_1496; phage(gi9627517) 5e-08 Click
19complement(1509457..1510353) PROPHAGE_Salmon_LT2: integrase; YPF_1497; phage(gi16766072) 4e-91 Click
20complement(1510366..1510656) hypothetical protein; YPF_1498 0.0 Click
211511152..1511379 hypothetical protein; YPF_1499 0.0 Click
22complement(1511541..1513211) PHAGE_Staphy_phiNM3: hypothetical protein; YPF_1500; phage(gi118725072) 8e-06 Click
23complement(1513262..1514350) putative phage protein; YPF_1501 0.0 Click
24complement(1514429..1515628) PROPHAGE_Escher_MG1655: CP4-57 prophage; integrase; YPF_1502; phage(gi16130540) 7e-131 Click
251515724..1515745 attR    CTTGGACTACTACAGACACAAA 0.0 Click
26complement(1515852..1516361) PROPHAGE_Salmon_Ty2: transposase; YPF_1503; phage(gi29143766) 6e-84 Click
271524117..1524130 attR    AATCAGTTTGTGTG 0.0 Click

Region 2, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11670591..1670881 PHAGE_Salmon_SPN3UB: hypothetical protein; YPF_1670; phage(gi423262443) 7e-16 Click
21670927..1671544 putative ATP-binding protein; YPF_1671 0.0 Click
31671549..1671743 PHAGE_Entero_SfV: hypothetical protein SfVp10; YPF_1672; phage(gi19549000) 1e-06 Click
41671740..1673248 PHAGE_Entero_SfV: tail sheath protein; YPF_1673; phage(gi19549001) 4e-107 Click
51673270..1673638 PHAGE_Entero_SfV: hypothetical protein SfVp12; YPF_1674; phage(gi19549002) 2e-10 Click
61673640..1673939 hypothetical protein; YPF_1675 0.0 Click
71674060..1675553 putative bacteriophage coat protein; YPF_1676 0.0 Click
81675589..1675795 hypothetical protein; YPF_1677 0.0 Click
91675820..1677226 PHAGE_Entero_SfV: tail/DNA circulation protein; YPF_1678; phage(gi19549005) 3e-20 Click
101677223..1678278 PHAGE_Entero_SfV: tail protein; YPF_1679; phage(gi19549006) 3e-32 Click
111678294..1678890 PHAGE_Entero_SfV: tail protein; YPF_1680; phage(gi19549007) 2e-17 Click
121678887..1679342 PHAGE_Entero_SfV: tail protein; YPF_1681; phage(gi19549008) 5e-14 Click
131679346..1680482 PHAGE_Entero_SfV: tail protein; YPF_1682; phage(gi19549009) 8e-33 Click
141680479..1680739 PHAGE_Salmon_ST64B: putative tail protein; YPF_1683; phage(gi23505467) 5e-05 Click
151680736..1681083 PHAGE_Entero_SfV: tail protein; YPF_1684; phage(gi19548988) 7e-11 Click
161681180..1681959 PHAGE_Entero_HK97: tail fiber; YPF_1685; phage(gi9634179) 8e-54 Click
171682257..1682997 PHAGE_Acanth_moumouvirus: putative glucosamine-fructose-6-phosphate aminotransferase; YPF_1686; phage(gi441432573) 3e-05 Click

Region 3, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12379810..2379822 attL    TATTTTATTTTTT 0.0 Click
2complement(2386254..2386523) PHAGE_Pectob_ZF40: putative integrase; YPF_2403; phage(gi422936642) 3e-20 Click
3complement(2386411..2386926) PHAGE_Pectob_ZF40: putative integrase; YPF_2404; phage(gi422936642) 6e-63 Click
42387037..2387264 PHAGE_Salmon_SPN9CC: replicative DNA helicase; YPF_2405; phage(gi389060513) 2e-14 Click
52387633..2387779 hypothetical protein; YPF_2406 0.0 Click
6complement(2387746..2387841) hypothetical protein; YPF_2407 0.0 Click
7complement(2388601..2388789) hypothetical protein; YPF_2408 0.0 Click
8complement(2388815..2389159) hypothetical protein; YPF_2409 0.0 Click
9complement(2389379..2390338) PHAGE_Lactob_phiAT3: putative transposase B; YPF_2410; phage(gi48697274) 6e-15 Click
10complement(2390410..2390829) hypothetical protein; YPF_2411 0.0 Click
11complement(2390940..2391080) PHAGE_Entero_PsP3: gp21; YPF_2412; phage(gi41057373) 1e-13 Click
12complement(2391245..2391523) putative membrane protein; YPF_2413 0.0 Click
13complement(2391504..2391809) hypothetical protein; YPF_2414 0.0 Click
14complement(2391806..2392021) putative membrane protein; YPF_2415 0.0 Click
152392193..2392205 attR    TATTTTATTTTTT 0.0 Click
162392330..2392341 attL    ACTGAATAAACC 0.0 Click
17complement(2392456..2392743) PHAGE_Aeromo_vB_AsaM_56: putative tail-fiber protein; YPF_2416; phage(gi422937565) 6e-06 Click
18complement(2392760..2393059) PHAGE_Entero_PsP3: gp16; YPF_2417; phage(gi41057368) 8e-25 Click
19complement(2393056..2393415) PHAGE_Entero_PsP3: gp15; YPF_2418; phage(gi41057367) 9e-19 Click
202393446..2393718 PHAGE_Burkho_phiE202: gp6, pANL56; YPF_2419; phage(gi134288760) 2e-12 Click
212393699..2393989 PHAGE_Burkho_phiE202: gp7, pANL12; YPF_2420; phage(gi134288781) 3e-07 Click
222394055..2395131 hypothetical protein; YPF_2421 0.0 Click
232395179..2396039 PROPHAGE_Escher_CFT073: transposase; YPF_2422; phage(gi26246249) 3e-139 Click
242396039..2396377 PROPHAGE_Escher_CFT073: transposase; YPF_2423; phage(gi26246249) 2e-56 Click
25complement(2396795..2397364) putative exported protein; YPF_2424 0.0 Click
26complement(2397376..2397810) hypothetical protein; YPF_2425 0.0 Click
272398228..2398434 PHAGE_Entero_Sf6: putative transposase OrfB; YPF_2426; phage(gi41057343) 1e-22 Click
282398461..2398592 PROPHAGE_Salmon_LT2: transposase; YPF_2427; phage(gi16766077) 1e-06 Click
292401265..2401276 attR    ACTGAATAAACC 0.0 Click

Region 4, total : 57 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12534510..2534540 attL    ATATTGAATAAGCCGAGTTGGGCTAAATAAC 0.0 Click
2complement(2534566..2535804) PHAGE_Salmon_1: putative bacteriophage integrase; YPF_2577; phage(gi169257156) 1e-125 Click
32536345..2536788 PROPHAGE_Escher_CFT073: transposase/IS protein; YPF_2578; phage(gi26248359) 2e-77 Click
4complement(2536956..2537216) PHAGE_Gifsy_2: bacteriophage excisionase; YPF_2579; phage(gi169257269) 4e-19 Click
5complement(2537516..2538160) PHAGE_Pseudo_F116: DNA adenine methyltransferase; YPF_2580; phage(gi56692911) 4e-43 Click
62538259..2538687 PHAGE_Cronob_ENT47670: putative ninB protein; YPF_2581; phage(gi431810524) 2e-46 Click
72538587..2538691 hypothetical protein; YPF_2582 0.0 Click
82538761..2539366 PHAGE_Salmon_ST160: NinG; YPF_2583; phage(gi318065938) 4e-43 Click
92539367..2539756 PHAGE_Entero_2008: antitermination protein Q; YPF_2584; phage(gi209427762) 2e-44 Click
102540027..2540590 PHAGE_Salmon_SPN3UB: hypothetical protein; YPF_2585; phage(gi423262398) 1e-29 Click
11complement(2540675..2540857) hypothetical phage protein; YPF_2586 0.0 Click
122541014..2541223 hypothetical phage protein; YPF_2587 0.0 Click
13complement(2541220..2541495) hypothetical phage protein; YPF_2588 0.0 Click
142541969..2542481 PHAGE_Cronob_phiES15: putative endolysin; YPF_2589; phage(gi401817587) 2e-51 Click
152542466..2542924 PHAGE_Entero_cdtI: lysin; YPF_2590; phage(gi148609441) 2e-24 Click
162542912..2543004 hypothetical protein; YPF_2591 0.0 Click
172543386..2544183 PHAGE_Cronob_ENT47670: phage antirepressor protein; YPF_2592; phage(gi431810509) 8e-50 Click
182544640..2545275 PHAGE_Pectob_ZF40: putative transposase; YPF_2593; phage(gi422936679) 3e-87 Click
192545306..2545755 PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; YPF_2594; phage(gi399528759) 4e-51 Click
202546391..2547599 PROPHAGE_Escher_CFT073: transposase; YPF_2595; phage(gi26246249) 0.0 Click
212547604..2548578 PHAGE_Cronob_phiES15: terminase large subunit; YPF_2596; phage(gi401817592) 5e-144 Click
222548578..2549306 PHAGE_Burkho_KL1: portal protein; YPF_2597; phage(gi399528722) 2e-35 Click
232549325..2549966 PHAGE_Burkho_KL1: portal protein; YPF_2598; phage(gi399528722) 1e-34 Click
242549967..2551079 PHAGE_Cronob_phiES15: hypothetical protein; YPF_2599; phage(gi401817594) 3e-123 Click
252551201..2551974 PHAGE_Xantho_Xp15: putative phage structural protein; YPF_2600; phage(gi66392059) 1e-19 Click
262551988..2553193 PHAGE_Acinet_Bphi_B1251: major capsid protein; YPF_2601; phage(gi423262007) 1e-113 Click
27complement(2553642..2553773) hypothetical protein; YPF_2602 0.0 Click
282553720..2553974 PHAGE_Salmon_SSU5: hypothetical protein; YPF_2603; phage(gi410491538) 8e-20 Click
292553976..2554326 PHAGE_Cronob_phiES15: putative structural protein 2; YPF_2604; phage(gi401817599) 5e-33 Click
302554328..2554912 PHAGE_Shigel_EP23: putative tail protein; YPF_2605; phage(gi371496282) 2e-27 Click
312554909..2555316 PHAGE_Cronob_phiES15: hypothetical protein; YPF_2606; phage(gi401817601) 1e-16 Click
322555382..2556302 PHAGE_Cronob_phiES15: putative major tail protein; YPF_2607; phage(gi401817602) 3e-75 Click
332556315..2556626 PHAGE_Cronob_phiES15: hypothetical protein; YPF_2608; phage(gi401817603) 9e-32 Click
342556713..2556934 PHAGE_Cronob_phiES15: hypothetical protein; YPF_2609; phage(gi401817604) 6e-14 Click
352556935..2560438 PHAGE_Entero_mEp213: tail length tape measure protein; YPF_2610; phage(gi428782602) 5e-152 Click
362560441..2560782 PHAGE_Cronob_phiES15: putative minor tail protein; YPF_2611; phage(gi401817607) 1e-31 Click
372561036..2561545 PROPHAGE_Salmon_Ty2: transposase; YPF_2614; phage(gi29143766) 6e-84 Click
382561666..2562418 PHAGE_Entero_HK225: minor tail protein; YPF_2615; phage(gi428782393) 3e-101 Click
392562421..2563131 PHAGE_Entero_HK140: minor tail protein K; YPF_2616; phage(gi428781957) 8e-109 Click
402563392..2564024 hypothetical phage protein; YPF_2617 0.0 Click
41complement(2564103..2564642) PHAGE_Escher_TL_2011b: hypothetical protein; YPF_2618; phage(gi418487671) 3e-32 Click
422564634..2564825 PHAGE_Escher_TL_2011b: hypothetical protein; YPF_2619; phage(gi418487672) 6e-15 Click
432564812..2565906 PHAGE_Haemop_Aaphi23: putative antirepressor protein Ant; YPF_2620; phage(gi31544021) 4e-37 Click
442566005..2566556 PHAGE_Cronob_phiES15: hypothetical protein; YPF_2621; phage(gi401817606) 5e-08 Click
452566826..2566945 hypothetical protein; YPF_2622 0.0 Click
462566970..2567590 PHAGE_Entero_mEpX2: tail assembly protein; YPF_2623; phage(gi428765633) 9e-66 Click
472567632..2567796 hypothetical protein; YPF_2624 0.0 Click
482568162..2571365 PHAGE_Cronob_phiES15: putative host specificity protein; YPF_2625; phage(gi401817611) 0.0 Click
492571365..2572363 PHAGE_Cronob_phiES15: hypothetical protein; YPF_2626; phage(gi401817612) 7e-25 Click
502572380..2573297 PHAGE_Salmon_SSU5: putative phage tail fiber protein; YPF_2627; phage(gi410491431) 2e-09 Click
512573308..2573727 PHAGE_Bacter_2: tail fiber; YPF_2628; phage(gi212499733) 2e-10 Click
522573724..2573879 hypothetical phage protein; YPF_2629 0.0 Click
53complement(2573948..2575156) PROPHAGE_Escher_CFT073: transposase; YPF_2630; phage(gi26246249) 0.0 Click
542575347..2575377 attR    ATATTGAATAAGCCGAGTTGGGCTAAATAAC 0.0 Click
55complement(2575461..2576633) hypothetical phage protein; YPF_2631 0.0 Click
56complement(2576637..2577836) PHAGE_Africa_virus: NifS-like protein; YPF_2632; phage(gi9628230) 4e-08 Click
57complement(2577853..2578593) hypothetical phage protein; YPF_2633 0.0 Click
582579685..2580041 hypothetical phage protein; YPF_2634 0.0 Click
59complement(2580458..2580988) PHAGE_Bacill_SPBc2: putative disulfide oxidoreductase; YPF_2635; phage(gi9630148) 3e-05 Click

Region 5, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4231982..4232644) PHAGE_Strept_phiC31: gp26; YPF_4369; phage(gi40807292) 3e-05 Click
2complement(4232734..4234098) PHAGE_Burkho_phi1026b: gp59; YPF_4370; phage(gi38707949) 1e-21 Click
3complement(4234252..4234647) putative gamma carboxymuconolactone decarboxylase; YPF_4371 0.0 Click
4complement(4234825..4235715) PHAGE_Synech_S_SM1: 6-phosphogluconate dehydrogenase; YPF_4372; phage(gi326782617) 5e-11 Click
5complement(4235780..4236592) hypothetical protein; YPF_4373 0.0 Click
64237068..4237535 PHAGE_Escher_TL_2011b: putative outer membrane lipoprotein; YPF_4374; phage(gi418487638) 2e-08 Click
7complement(4237626..4237823) hypothetical protein; YPF_4375 0.0 Click
84238068..4238280 PHAGE_Lactoc_bIL312: Csp; YPF_4376; phage(gi13095918) 3e-17 Click
94238540..4238752 PHAGE_Lactoc_bIL312: Csp; YPF_4377; phage(gi13095918) 4e-17 Click
10complement(4238935..4239444) PHAGE_Hypert_2: IS element Dka2 orfA; YPF_4378; phage(gi300116744) 5e-15 Click
114239798..4240973 PHAGE_Clostr_phiCD38_2: tail tape measure; YPF_4380; phage(gi333798123) 7e-05 Click
12complement(4241080..4242426) putative exported protein; YPF_4381 0.0 Click
134242680..4243531 predicted glutathionylspermidine-utilizing glutathione transferase; YPF_4382 0.0 Click
14complement(4243721..4244326) PHAGE_Acinet_Ac42: hypothetical protein; YPF_4383; phage(gi311992578) 7e-19 Click

Region 6, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14546211..4546993 PROPHAGE_Escher_CFT073: transposase/IS protein; YPF_4691; phage(gi26248359) 3e-143 Click
2complement(4547003..4547308) Transposase; YPF_4692 0.0 Click
34547441..4548055 PROPHAGE_Xantho_33913: IS1477 transposase; YPF_4693; phage(gi77747809) 9e-60 Click
4complement(4548118..4548510) putative yopE chaperone; YPF_4694 0.0 Click
54548704..4549363 Translocated host-GTPase-activating protein; YPF_4695 0.0 Click
64549365..4549661 hypothetical protein; YPF_4696 0.0 Click
7complement(4549503..4549802) putative plasmid stabilization element ParE; YPF_4697 0.0 Click
8complement(4549795..4550070) hypothetical protein; YPF_4698 0.0 Click
9complement(4550181..4550384) Transposase; YPF_4699 0.0 Click
104550581..4550754 PHAGE_Cronob_ENT39118: DNA polymerase; YPF_4700; phage(gi431811050) 2e-07 Click
11complement(4551299..4551802) PHAGE_Entero_N15: ParB; YPF_4701; phage(gi9630491) 1e-29 Click
12complement(4551796..4552263) PHAGE_Entero_N15: ParB; YPF_4702; phage(gi9630491) 1e-39 Click
13complement(4552263..4553429) PHAGE_Entero_N15: plasmid partition protein SopA; YPF_4703; phage(gi9630492) 4e-151 Click
144553978..4554091 hypothetical protein; YPF_4705 0.0 Click
15complement(4554229..4554423) PHAGE_Entero_Sf6: putative transposase OrfB; YPF_4706; phage(gi41057343) 6e-12 Click
16complement(4554535..4554993) PHAGE_Entero_Sf6: putative transposase OrfB; YPF_4707; phage(gi41057343) 6e-27 Click
17complement(4555017..4555334) PROPHAGE_Xantho_33913: ISxac3 transposase; YPF_4708; phage(gi21231087) 1e-06 Click
18complement(4555441..4556070) IncF plasmid conjugative transfer surfaceexclusion protein TraT; YPF_4709 0.0 Click
19complement(4556078..4556191) TraT complement resistance protein precursor; YPF_4710 0.0 Click
20complement(4556285..4556530) PROPHAGE_Xantho_33913: ISxcc1 transposase; YPF_4711; phage(gi21232565) 5e-09 Click

Region 7, total : 10 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14590687..4590953 PROPHAGE_Salmon_LT2: transposase; YPF_4760; phage(gi16766077) 2e-30 Click
24590989..4591411 PROPHAGE_Xantho_33913: ISxcC1 transposase; YPF_4761; phage(gi21231060) 3e-29 Click
34591408..4591716 PROPHAGE_Xantho_33913: ISxcC1 transposase; YPF_4762; phage(gi21230085) 6e-22 Click
44591828..4592007 PROPHAGE_Escher_CFT073: transposase; YPF_4763; phage(gi26246249) 6e-25 Click
5complement(4592228..4593634) translocated protein-tyrosine kinase, inhibitor of phagocytosis; YPF_4764 0.0 Click
6complement(4593917..4594123) PHAGE_Stx2_c_1717: transposase; YPF_4765; phage(gi209447153) 1e-08 Click
74594084..4594731 PROPHAGE_Ralsto_GMI1000: ISRSO12-transposase ORFB protein; YPF_4766; phage(gi17546158) 5e-66 Click
8complement(4595317..4596183) cysteine protease, inhibitor of host MAP kinases and IKK; YPF_4767 0.0 Click
94596089..4596220 hypothetical protein; YPF_4768 0.0 Click
10complement(4596579..4598777) PHAGE_Maruca_MNPV: protein kinase 1; YPF_4769; phage(gi119964537) 2e-05 Click

Region 8, total : 85 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4603624..4604031) PHAGE_Entero_Sf6: putative transposase OrfB; YPF_4779; phage(gi41057343) 7e-22 Click
2complement(4604055..4604372) PROPHAGE_Xantho_33913: ISxac3 transposase; YPF_4780; phage(gi21231087) 4e-07 Click
3complement(4604544..4605002) hypothetical protein; YPF_4781 0.0 Click
44605152..4605340 PHAGE_Entero_Sf6: gene 56 protein; YPF_4782; phage(gi41057344) 2e-09 Click
5complement(4605666..4606586) PHAGE_Cronob_vB_CsaM_GAP32: adhesin; YPF_4783; phage(gi414087345) 1e-13 Click
64607575..4607955 PROPHAGE_Xantho_33913: ISxcc1 transposase; YPF_4784; phage(gi21232565) 3e-32 Click
7complement(4607952..4610267) PROPHAGE_Xantho_33913: Tn5041 transposase; YPF_4785; phage(gi21231545) 3e-30 Click
84610431..4610982 PHAGE_Salisa_1: hypothetical protein; YPF_4786; phage(gi388570712) 3e-28 Click
94611001..4611465 hypothetical protein; YPF_4787 0.0 Click
104611604..4611933 hypothetical protein; YPF_4788 0.0 Click
114612033..4612299 PROPHAGE_Ralsto_GMI1000: isrso12-transposase orfa protein; YPF_4789; phage(gi17546157) 7e-35 Click
124612377..4613132 PROPHAGE_Ralsto_GMI1000: ISRSO12-transposase ORFB protein; YPF_4790; phage(gi17546158) 8e-81 Click
13complement(4613280..4613705) putative yopH targeting protein; YPF_4791 0.0 Click
14complement(4614048..4614479) PROPHAGE_Escher_CFT073: transposase/IS protein; YPF_4792; phage(gi26248359) 3e-24 Click
15complement(4614479..4615441) PROPHAGE_Escher_CFT073: transposase; YPF_4793; phage(gi26248360) 3e-24 Click
164616353..4617489 PHAGE_Salmon_SSU5: putative porphyrin biosynthetic protein; YPF_4794; phage(gi410491460) 0.0 Click
174617670..4620783 PHAGE_Salmon_SSU5: DNA polymerase III alpha subunit; YPF_4795; phage(gi410491462) 0.0 Click
184620797..4621819 PROPHAGE_Escher_CFT073: transposase; YPF_4796; phage(gi26248360) 0.0 Click
194621816..4622598 PROPHAGE_Escher_CFT073: transposase/IS protein; YPF_4797; phage(gi26248359) 3e-143 Click
20complement(4622732..4623340) PHAGE_Entero_HK630: tail fiber assembly protein; YPF_4798; phage(gi428782810) 3e-66 Click
21complement(4623642..4626530) PHAGE_Salmon_SSU5: putative phage tail fiber protein; YPF_4799; phage(gi410491431) 3e-118 Click
22complement(4626611..4627228) PHAGE_Entero_phiP27: hypothetical protein P27p57; YPF_4800; phage(gi18249921) 3e-22 Click
23complement(4627246..4631883) PHAGE_Salmon_SSU5: putative phage tail protein; YPF_4801; phage(gi410491430) 0.0 Click
24complement(4631899..4632486) PHAGE_Salmon_SSU5: putative phage tail protein; YPF_4802; phage(gi410491429) 1e-105 Click
25complement(4632474..4633271) PHAGE_Salmon_SSU5: putative phage tail protein; YPF_4803; phage(gi410491428) 3e-156 Click
26complement(4633264..4633995) PHAGE_Salmon_SSU5: putative minor tail protein L; YPF_4804; phage(gi410491427) 4e-137 Click
27complement(4634052..4634387) PHAGE_Salmon_SSU5: putative minor tail protein M; YPF_4805; phage(gi410491426) 3e-60 Click
28complement(4634429..4639006) PHAGE_Salmon_SSU5: putative tail tape measure protein; YPF_4806; phage(gi410491425) 0.0 Click
29complement(4639014..4639283) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4807; phage(gi410491424) 8e-39 Click
30complement(4639364..4639681) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4808; phage(gi410491423) 2e-52 Click
31complement(4639741..4640487) PHAGE_Salmon_SSU5: putative Ig-like domain-containing protein; YPF_4809; phage(gi410491422) 9e-135 Click
32complement(4640562..4640945) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4810; phage(gi410491421) 6e-68 Click
33complement(4640947..4641420) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4811; phage(gi410491420) 4e-84 Click
34complement(4641411..4641869) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4812; phage(gi410491419) 1e-59 Click
35complement(4641853..4642686) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4813; phage(gi410491418) 9e-155 Click
36complement(4642686..4643120) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4814; phage(gi410491417) 1e-75 Click
37complement(4643164..4643826) PHAGE_Salmon_SSU5: putative Ig-like domain-containing protein; YPF_4815; phage(gi410491416) 5e-114 Click
38complement(4643901..4644776) PHAGE_Salmon_SSU5: putative major capsid protein; YPF_4816; phage(gi410491415) 4e-164 Click
39complement(4644803..4645636) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4817; phage(gi410491414) 3e-149 Click
40complement(4645659..4647248) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4818; phage(gi410491413) 0.0 Click
41complement(4647267..4648523) PHAGE_Salmon_SSU5: putative terminase large subunit; YPF_4819; phage(gi410491412) 0.0 Click
42complement(4648526..4649167) PHAGE_Salmon_SSU5: putative DNA-binding protein; YPF_4820; phage(gi410491411) 9e-116 Click
43complement(4649363..4649629) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4821; phage(gi410491540) 9e-45 Click
44complement(4649639..4650538) PHAGE_Salmon_SSU5: putative ABC transporter ATP-binding protein; YPF_4822; phage(gi410491539) 1e-170 Click
45complement(4650535..4650789) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4823; phage(gi410491538) 4e-42 Click
46complement(4650782..4651480) PHAGE_Salmon_SSU5: putative ABC transporter ATP-binding protein; YPF_4824; phage(gi410491537) 7e-113 Click
47complement(4651417..4652085) PHAGE_Salmon_SSU5: putative ParB-like nuclease domain-containing protein; YPF_4825; phage(gi410491536) 8e-118 Click
48complement(4652085..4652783) PHAGE_Salmon_SSU5: putative ParB-like nuclease domain-containing protein; YPF_4826; phage(gi410491535) 9e-128 Click
494652848..4654407 PHAGE_Salmon_SSU5: putative helicase; YPF_4827; phage(gi410491534) 0.0 Click
504654410..4654688 PHAGE_Salmon_SSU5: hypothetical protein; YPF_4828; phage(gi410491533) 1e-44 Click
514654748..4655170 PHAGE_Salmon_SSU5: putative lipoprotein; YPF_4829; phage(gi410491532) 4e-65 Click
524655175..4655702 PHAGE_Salmon_SSU5: putative repressor of phase 1 flagellin; YPF_4830; phage(gi410491531) 6e-82 Click
53complement(4655830..4655967) hypothetical protein; YPF_4831 0.0 Click
544656024..4656674 PHAGE_Salmon_SSU5: hypothetical protein; YPF_4832; phage(gi410491530) 5e-118 Click
554656759..4656986 hypothetical protein; YPF_4833 0.0 Click
56complement(4656964..4657107) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4834; phage(gi410491528) 4e-17 Click
57complement(4657625..4658107) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4835; phage(gi410491527) 3e-86 Click
58complement(4658120..4658353) hypothetical protein; YPF_4836 0.0 Click
59complement(4658313..4658600) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4837; phage(gi410491525) 5e-48 Click
60complement(4658794..4659303) PROPHAGE_Salmon_Ty2: transposase; YPF_4838; phage(gi29143766) 6e-84 Click
61complement(4659461..4660030) PHAGE_Salmon_SSU5: putative ribonuclease H-like domain-containing protein; YPF_4840; phage(gi410491487) 2e-105 Click
62complement(4660043..4660789) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4841; phage(gi410491486) 4e-138 Click
634660715..4660807 hypothetical protein; YPF_4842 0.0 Click
64complement(4660779..4662695) PHAGE_Salmon_SSU5: putative exonuclease subunit 2; YPF_4843; phage(gi410491485) 0.0 Click
65complement(4662704..4662928) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4844; phage(gi410491484) 1e-28 Click
66complement(4662925..4664010) PHAGE_Salmon_SSU5: putative exonuclease subunit 1; YPF_4845; phage(gi410491483) 0.0 Click
674664257..4664529 hypothetical protein; YPF_4846 0.0 Click
684664426..4665448 putative periplasmic protein; YPF_4847 0.0 Click
69complement(4665586..4665732) hypothetical protein; YPF_4848 0.0 Click
70complement(4665808..4666452) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4849; phage(gi410491480) 1e-121 Click
714667197..4668261 PHAGE_Salmon_SSU5: putative replication protein RepA; YPF_4850; phage(gi410491479) 0.0 Click
72complement(4668830..4669045) PHAGE_Salmon_SSU5: putative Cre-associated protein; YPF_4851; phage(gi410491478) 4e-35 Click
73complement(4669042..4669302) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4852; phage(gi410491477) 2e-41 Click
74complement(4669312..4669418) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4853; phage(gi410491471) 1e-12 Click
75complement(4669509..4670585) PHAGE_Salmon_SSU5: putative RecA-like recombinase; YPF_4854; phage(gi410491470) 0.0 Click
76complement(4670588..4670854) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4855; phage(gi410491469) 2e-43 Click
77complement(4670854..4671798) PHAGE_Salmon_SSU5: DNA polymerase I; YPF_4856; phage(gi410491468) 0.0 Click
78complement(4671859..4672887) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4857; phage(gi410491467) 0.0 Click
79complement(4673007..4673480) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4858; phage(gi410491466) 3e-75 Click
80complement(4673624..4673797) hypothetical protein; YPF_4859 0.0 Click
814673983..4674546 PHAGE_Salmon_SSU5: putative phage transcriptional regulator AlpA-like protein; YPF_4860; phage(gi410491464) 1e-67 Click
82complement(4674576..4675019) PHAGE_Salmon_SSU5: hypothetical protein; YPF_4861; phage(gi410491463) 7e-75 Click
83complement(4675016..4675555) PHAGE_Salmon_SSU5: DNA polymerase III alpha subunit; YPF_4862; phage(gi410491462) 1e-90 Click
84complement(4675571..4676353) PROPHAGE_Escher_CFT073: transposase/IS protein; YPF_4863; phage(gi26248359) 3e-143 Click
85complement(4676350..4677372) PROPHAGE_Escher_CFT073: transposase; YPF_4864; phage(gi26248360) 0.0 Click

Region 9, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4682910..4683587) PHAGE_Bordet_1: adenine DNA methyltransferase; YPF_4871; phage(gi41179391) 9e-22 Click
24683980..4684288 hypothetical protein; YPF_4872 0.0 Click
3complement(4684450..4685847) putative DNA-binding protein; YPF_4873 0.0 Click
44685943..4686089 Error-prone repair protein UmuC; YPF_4874 0.0 Click
54686086..4686319 hypothetical protein; YPF_4875 0.0 Click
6complement(4686226..4687197) PHAGE_Entero_P1: ParB; YPF_4876; phage(gi46401681) 1e-60 Click
7complement(4687194..4688399) PHAGE_Entero_P1: ParA; YPF_4877; phage(gi46401682) 4e-132 Click
84688701..4688928 Prevent-host-death family protein; YPF_4878 0.0 Click
94688928..4689254 Inner membrane protein; YPF_4879 0.0 Click
104689454..4690074 PHAGE_Sodali_phiSG1: resolvase; YPF_4880; phage(gi89886020) 1e-05 Click
114690140..4691081 PHAGE_Sodali_phiSG1: transposase; YPF_4881; phage(gi89886005) 3e-82 Click