Yersinia pestis Nepal516 Chromosome_Sequence01, whole genome [asmbl_id: NC_000000].4629080, GC%: 47.60%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 56 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11676759..1676789 attL    ATATTGAATAAGCCGAGTTGGGCTAAATAAC 0.0 Click
2complement(1676815..1678053) PHAGE_Salmon_1: putative bacteriophage integrase; YP516_1734; phage(gi169257156) 1e-125 Click
31678123..1679145 PROPHAGE_Escher_CFT073: transposase; YP516_1735; phage(gi26248360) 0.0 Click
41679142..1679924 PROPHAGE_Escher_CFT073: transposase/IS protein; YP516_1736; phage(gi26248359) 3e-143 Click
5complement(1680092..1680352) PHAGE_Gifsy_2: bacteriophage excisionase; YP516_1737; phage(gi169257269) 4e-19 Click
6complement(1680652..1681296) PHAGE_Pseudo_F116: DNA adenine methyltransferase; YP516_1738; phage(gi56692911) 4e-43 Click
71681395..1681823 PHAGE_Cronob_ENT47670: putative ninB protein; YP516_1739; phage(gi431810524) 2e-46 Click
81681897..1682502 PHAGE_Salmon_ST160: NinG; YP516_1740; phage(gi318065938) 4e-43 Click
91682503..1682892 PHAGE_Entero_2008: antitermination protein Q; YP516_1741; phage(gi209427762) 2e-44 Click
101683163..1683726 PHAGE_Salmon_SPN3UB: hypothetical protein; YP516_1742; phage(gi423262398) 1e-29 Click
11complement(1683811..1683993) hypothetical phage protein; YP516_1743 0.0 Click
121684150..1684359 hypothetical phage protein; YP516_1744 0.0 Click
13complement(1684356..1684631) hypothetical phage protein; YP516_1745 0.0 Click
14complement(1685035..1685157) hypothetical protein; YP516_1746 0.0 Click
151685105..1685617 PHAGE_Cronob_phiES15: putative endolysin; YP516_1747; phage(gi401817587) 2e-51 Click
161685602..1686060 PHAGE_Entero_cdtI: lysin; YP516_1748; phage(gi148609441) 2e-24 Click
171686048..1686140 hypothetical protein; YP516_1749 0.0 Click
181686522..1687319 PHAGE_Cronob_ENT47670: phage antirepressor protein; YP516_1750; phage(gi431810509) 8e-50 Click
191687776..1688411 PHAGE_Pectob_ZF40: putative transposase; YP516_1751; phage(gi422936679) 3e-87 Click
201688442..1688891 PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; YP516_1752; phage(gi399528759) 4e-51 Click
211689527..1690735 PROPHAGE_Escher_CFT073: transposase; YP516_1754; phage(gi26246249) 0.0 Click
221691714..1692442 PHAGE_Burkho_KL1: portal protein; YP516_1755; phage(gi399528722) 2e-35 Click
231692461..1693102 PHAGE_Burkho_KL1: portal protein; YP516_1756; phage(gi399528722) 1e-34 Click
241693103..1694215 PHAGE_Cronob_phiES15: hypothetical protein; YP516_1757; phage(gi401817594) 3e-123 Click
251694337..1695110 PHAGE_Xantho_Xp15: putative phage structural protein; YP516_1758; phage(gi66392059) 1e-19 Click
261695124..1696329 PHAGE_Acinet_Bphi_B1251: major capsid protein; YP516_1759; phage(gi423262007) 1e-113 Click
271696329..1696859 PHAGE_Cronob_phiES15: hypothetical protein; YP516_1760; phage(gi401817598) 3e-23 Click
281696856..1697110 PHAGE_Salmon_SSU5: hypothetical protein; YP516_1761; phage(gi410491538) 8e-20 Click
291697112..1697462 PHAGE_Cronob_phiES15: putative structural protein 2; YP516_1762; phage(gi401817599) 5e-33 Click
301697464..1698048 PHAGE_Shigel_EP23: putative tail protein; YP516_1763; phage(gi371496282) 2e-27 Click
311698045..1698452 PHAGE_Cronob_phiES15: hypothetical protein; YP516_1764; phage(gi401817601) 1e-16 Click
321698518..1699438 PHAGE_Cronob_phiES15: putative major tail protein; YP516_1765; phage(gi401817602) 3e-75 Click
331699451..1699762 PHAGE_Cronob_phiES15: hypothetical protein; YP516_1766; phage(gi401817603) 9e-32 Click
341699849..1700070 PHAGE_Cronob_phiES15: hypothetical protein; YP516_1767; phage(gi401817604) 6e-14 Click
351700071..1703574 PHAGE_Entero_mEp213: tail length tape measure protein; YP516_1768; phage(gi428782602) 5e-152 Click
361703577..1703918 PHAGE_Cronob_phiES15: putative minor tail protein; YP516_1769; phage(gi401817607) 1e-31 Click
371704173..1704682 PROPHAGE_Salmon_Ty2: transposase; YP516_1771; phage(gi29143766) 3e-85 Click
381704803..1705555 PHAGE_Entero_HK225: minor tail protein; YP516_1772; phage(gi428782393) 3e-101 Click
391705558..1706268 PHAGE_Entero_HK140: minor tail protein K; YP516_1773; phage(gi428781957) 8e-109 Click
401706529..1707161 hypothetical phage protein; YP516_1774 0.0 Click
41complement(1707240..1707779) PHAGE_Escher_TL_2011b: hypothetical protein; YP516_1775; phage(gi418487671) 3e-32 Click
421707949..1709043 PHAGE_Haemop_Aaphi23: putative antirepressor protein Ant; YP516_1776; phage(gi31544021) 4e-37 Click
431709142..1709693 PHAGE_Cronob_phiES15: hypothetical protein; YP516_1777; phage(gi401817606) 5e-08 Click
441709701..1710051 PHAGE_Entero_mEpX2: hypothetical protein; YP516_1778; phage(gi428765632) 8e-14 Click
451710107..1710727 PHAGE_Entero_mEpX2: tail assembly protein; YP516_1779; phage(gi428765633) 9e-66 Click
461710769..1710933 hypothetical protein; YP516_1780 0.0 Click
471711299..1714502 PHAGE_Cronob_phiES15: putative host specificity protein; YP516_1781; phage(gi401817611) 0.0 Click
481714502..1715500 PHAGE_Cronob_phiES15: hypothetical protein; YP516_1782; phage(gi401817612) 7e-25 Click
491715517..1716434 PHAGE_Salmon_SSU5: putative phage tail fiber protein; YP516_1783; phage(gi410491431) 2e-09 Click
501716445..1716864 PHAGE_Bacter_2: tail fiber; YP516_1784; phage(gi212499733) 2e-10 Click
511716861..1717016 hypothetical phage protein; YP516_1785 0.0 Click
52complement(1717085..1718293) PROPHAGE_Escher_CFT073: transposase; YP516_1786; phage(gi26246249) 0.0 Click
531718484..1718514 attR    ATATTGAATAAGCCGAGTTGGGCTAAATAAC 0.0 Click
54complement(1718598..1719770) hypothetical phage protein; YP516_1787 0.0 Click
55complement(1719774..1720973) PHAGE_Africa_virus: NifS-like protein; YP516_1788; phage(gi9628230) 4e-08 Click
56complement(1720990..1721730) hypothetical phage protein; YP516_1789 0.0 Click
571722822..1723178 hypothetical phage protein; YP516_1790 0.0 Click
58complement(1723595..1724125) PHAGE_Bacill_SPBc2: putative disulfide oxidoreductase; YP516_1791; phage(gi9630148) 3e-05 Click

Region 2, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12426353..2426364 attL    GGTTTATTCAGT 0.0 Click
2complement(2429031..2429162) PROPHAGE_Salmon_LT2: transposase; YP516_2509; phage(gi16766077) 1e-06 Click
3complement(2429189..2429395) PHAGE_Entero_Sf6: putative transposase OrfB; YP516_2510; phage(gi41057343) 1e-22 Click
42429813..2430247 hypothetical protein; YP516_2511 0.0 Click
52430259..2430828 putative exported protein; YP516_2512 0.0 Click
6complement(2431246..2431584) PROPHAGE_Escher_CFT073: transposase; YP516_2513; phage(gi26246249) 2e-56 Click
7complement(2431584..2432444) PROPHAGE_Escher_CFT073: transposase; YP516_2514; phage(gi26246249) 3e-139 Click
8complement(2432492..2433568) hypothetical protein; YP516_2515 0.0 Click
9complement(2433634..2433924) PHAGE_Burkho_phiE202: gp7, pANL12; YP516_2516; phage(gi134288781) 3e-07 Click
10complement(2433905..2434177) PHAGE_Burkho_phiE202: gp6, pANL56; YP516_2517; phage(gi134288760) 2e-12 Click
112434208..2434567 PHAGE_Entero_PsP3: gp15; YP516_2518; phage(gi41057367) 9e-19 Click
122434564..2434863 PHAGE_Entero_PsP3: gp16; YP516_2519; phage(gi41057368) 8e-25 Click
132434880..2435167 PHAGE_Aeromo_vB_AsaM_56: putative tail-fiber protein; YP516_2520; phage(gi422937565) 6e-06 Click
142435282..2435293 attR    GGTTTATTCAGT 0.0 Click
152435418..2435430 attL    AAAAAATAAAATA 0.0 Click
162435602..2435817 putative membrane protein; YP516_2521 0.0 Click
172435814..2436119 hypothetical protein; YP516_2522 0.0 Click
182436100..2436378 putative membrane protein; YP516_2523 0.0 Click
192436543..2436683 PHAGE_Entero_PsP3: gp21; YP516_2524; phage(gi41057373) 1e-13 Click
202436794..2437213 hypothetical protein; YP516_2525 0.0 Click
212437285..2438244 PHAGE_Lactob_phiAT3: putative transposase B; YP516_2526; phage(gi48697274) 6e-15 Click
222438464..2438808 hypothetical protein; YP516_2527 0.0 Click
232438837..2439013 hypothetical protein; YP516_2528 0.0 Click
24complement(2439835..2439981) hypothetical protein; YP516_2529 0.0 Click
25complement(2440350..2440577) PHAGE_Salmon_SPN9CC: replicative DNA helicase; YP516_2530; phage(gi389060513) 2e-14 Click
262440688..2441203 PHAGE_Pectob_ZF40: putative integrase; YP516_2531; phage(gi422936642) 6e-63 Click
272441091..2441360 PHAGE_Pectob_ZF40: putative integrase; YP516_2532; phage(gi422936642) 3e-20 Click
282447792..2447804 attR    AAAAAATAAAATA 0.0 Click

Region 3, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2973300..2974040) PHAGE_Acanth_moumouvirus: putative glucosamine-fructose-6-phosphate aminotransferase; YP516_3077; phage(gi441432573) 3e-05 Click
2complement(2974338..2975117) PHAGE_Entero_HK97: tail fiber; YP516_3078; phage(gi9634179) 8e-54 Click
3complement(2975214..2975561) PHAGE_Entero_SfV: tail protein; YP516_3079; phage(gi19548988) 7e-11 Click
4complement(2975558..2975818) PHAGE_Salmon_ST64B: putative tail protein; YP516_3080; phage(gi23505467) 5e-05 Click
5complement(2975815..2976951) PHAGE_Entero_SfV: tail protein; YP516_3081; phage(gi19549009) 8e-33 Click
6complement(2976955..2977410) PHAGE_Entero_SfV: tail protein; YP516_3082; phage(gi19549008) 5e-14 Click
7complement(2977407..2978003) PHAGE_Entero_SfV: tail protein; YP516_3083; phage(gi19549007) 2e-17 Click
8complement(2978019..2979074) PHAGE_Entero_SfV: tail protein; YP516_3084; phage(gi19549006) 3e-32 Click
9complement(2979071..2980477) PHAGE_Entero_SfV: tail/DNA circulation protein; YP516_3085; phage(gi19549005) 3e-20 Click
10complement(2980502..2980708) hypothetical protein; YP516_3086 0.0 Click
11complement(2980744..2982237) putative bacteriophage coat protein; YP516_3087 0.0 Click
12complement(2982358..2982657) hypothetical protein; YP516_3088 0.0 Click
13complement(2982659..2983027) PHAGE_Entero_SfV: hypothetical protein SfVp12; YP516_3089; phage(gi19549002) 2e-10 Click
14complement(2983049..2984557) PHAGE_Entero_SfV: tail sheath protein; YP516_3090; phage(gi19549001) 4e-107 Click
15complement(2984554..2984748) PHAGE_Entero_SfV: hypothetical protein SfVp10; YP516_3091; phage(gi19549000) 1e-06 Click
16complement(2984753..2985370) putative ATP-binding protein; YP516_3092 0.0 Click
17complement(2985416..2985706) PHAGE_Salmon_SPN3UB: hypothetical protein; YP516_3093; phage(gi423262443) 7e-16 Click

Region 4, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3058739..3059674) PHAGE_Stx2_c_1717: penicillin-binding protein 6b; YP516_3164; phage(gi209447203) 3e-15 Click
23059598..3059744 hypothetical protein; YP516_3165 0.0 Click
33060013..3060192 hypothetical protein; YP516_3166 0.0 Click
4complement(3060266..3061204) tRNA-dihydrouridine synthase C; YP516_3167 0.0 Click
5complement(3061504..3062433) PHAGE_Ostreo_OsV5: hypothetical protein OsV5_077f; YP516_3168; phage(gi163955050) 7e-08 Click
6complement(3062848..3063357) PHAGE_Hypert_2: IS element Dka2 orfA; YP516_3169; phage(gi300116744) 5e-15 Click
7complement(3063517..3064521) PHAGE_Cafete_BV_PW1: putative superfamily II helicase/eIF-4AIII; YP516_3171; phage(gi310831360) 2e-28 Click
8complement(3064436..3065026) PROPHAGE_Shewan_MR-1: IS110 family transposase; YP516_3172; phage(gi24375433) 3e-20 Click
9complement(3065118..3066326) PROPHAGE_Escher_CFT073: transposase; YP516_3173; phage(gi26246249) 0.0 Click
103066400..3066504 hypothetical protein; YP516_3174 0.0 Click
11complement(3066501..3066782) hypothetical protein; YP516_3175 0.0 Click
12complement(3066899..3067135) hypothetical protein; YP516_3176 0.0 Click
13complement(3067276..3067527) PHAGE_Shrimp_virus: wsv238; YP516_3177; phage(gi17158342) 4e-11 Click
14complement(3067502..3067639) hypothetical protein; YP516_3178 0.0 Click
15complement(3067636..3067830) hypothetical protein; YP516_3179 0.0 Click
16complement(3068359..3068592) PROPHAGE_Escher_EDL933: putative transposase; YP516_3180; phage(gi15803522) 3e-12 Click
17complement(3068648..3068914) PROPHAGE_Escher_CFT073: putative transposase; YP516_3181; phage(gi26246170) 2e-08 Click
18complement(3069044..3070399) PHAGE_Cafete_BV_PW1: putative superfamily II helicase/eIF-4AIII; YP516_3182; phage(gi310831360) 1e-47 Click
193070790..3071500 Hypothetical transcriptional regulator ybiH; YP516_3183 0.0 Click
203071552..3072538 Hypothetical UPF0194 membrane protein ybhG; YP516_3184 0.0 Click
213072552..3074294 PHAGE_Plankt_PaV_LD: ABC transporter; YP516_3185; phage(gi371496158) 2e-17 Click

Region 5, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13151493..3151506 attL    CACACAAACTGATT 0.0 Click
23159262..3159771 PROPHAGE_Salmon_Ty2: transposase; YP516_3280; phage(gi29143766) 6e-84 Click
33159960..3159979 attL    CAATGGACGTATACCAATTA 0.0 Click
43159995..3161194 PROPHAGE_Escher_MG1655: CP4-57 prophage; integrase; YP516_3281; phage(gi16130540) 7e-131 Click
53161273..3162361 putative phage protein; YP516_3282 0.0 Click
63162412..3164082 PHAGE_Staphy_phiNM3: hypothetical protein; YP516_3283; phage(gi118725072) 8e-06 Click
7complement(3164244..3164471) hypothetical protein; YP516_3284 0.0 Click
83164967..3165257 hypothetical protein; YP516_3285 0.0 Click
93165270..3166166 PROPHAGE_Salmon_LT2: integrase; YP516_3286; phage(gi16766072) 4e-91 Click
103166159..3166359 PHAGE_Entero_P4: transcriptional regulator; YP516_3287; phage(gi9627517) 5e-08 Click
113166359..3166901 PHAGE_Entero_phiP27: hypothetical protein P27p16; YP516_3288; phage(gi18249880) 7e-07 Click
123166894..3167853 PHAGE_Entero_P4: DNA primase; YP516_3289; phage(gi9627512) 8e-47 Click
133167850..3168938 PHAGE_Burkho_BcepGomr: BcepGomrgp62; YP516_3290; phage(gi146329974) 6e-28 Click
14complement(3169189..3169290) hypothetical protein; YP516_3291 0.0 Click
15complement(3169287..3169607) PHAGE_Burkho_2: gp6, putative addiction module antidote protein; YP516_3292; phage(gi134288715) 5e-08 Click
16complement(3169607..3169924) PHAGE_Burkho_2: gp7, putative addiction module killer protein; YP516_3293; phage(gi134288691) 2e-11 Click
173170303..3170322 attR    CAATGGACGTATACCAATTA 0.0 Click
183170339..3170515 PROPHAGE_Escher_MG1655: CP4-57 prophage; integrase; YP516_3294; phage(gi16130540) 2e-06 Click
193170529..3171551 PROPHAGE_Escher_CFT073: transposase; YP516_3295; phage(gi26248360) 0.0 Click
203171548..3172330 PROPHAGE_Escher_CFT073: transposase/IS protein; YP516_3296; phage(gi26248359) 3e-143 Click
21complement(3172381..3172614) hypothetical protein; YP516_3297 0.0 Click
22complement(3172607..3172759) hypothetical protein; YP516_3298 0.0 Click
233172953..3174437 putative permease; YP516_3299 0.0 Click
24complement(3174494..3174570) tRNA 0.0 Click
25complement(3174683..3175447) PHAGE_Vibrio_VP882: putative exonuclease; YP516_3301; phage(gi126010887) 4e-10 Click
263184904..3184917 attR    CACACAAACTGATT 0.0 Click

Region 6, total : 15 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3914428..3915090) PHAGE_Strept_phiC31: gp26; YP516_4000; phage(gi40807292) 3e-05 Click
2complement(3915180..3916544) PHAGE_Burkho_phi1026b: gp59; YP516_4001; phage(gi38707949) 1e-21 Click
3complement(3916698..3917093) putative gamma carboxymuconolactone decarboxylase; YP516_4002 0.0 Click
4complement(3917271..3918161) PHAGE_Synech_S_SM1: 6-phosphogluconate dehydrogenase; YP516_4003; phage(gi326782617) 5e-11 Click
5complement(3918226..3919038) hypothetical protein; YP516_4004 0.0 Click
63919514..3919981 PHAGE_Escher_TL_2011b: putative outer membrane lipoprotein; YP516_4005; phage(gi418487638) 2e-08 Click
7complement(3920072..3920269) hypothetical protein; YP516_4006 0.0 Click
83920514..3920726 PHAGE_Lactoc_bIL312: Csp; YP516_4007; phage(gi13095918) 3e-17 Click
93920986..3921198 PHAGE_Lactoc_bIL312: Csp; YP516_4008; phage(gi13095918) 4e-17 Click
10complement(3921381..3921890) PHAGE_Hypert_2: IS element Dka2 orfA; YP516_4009; phage(gi300116744) 5e-15 Click
11complement(3922070..3922183) hypothetical protein; YP516_4011 0.0 Click
123922244..3923419 PHAGE_Clostr_phiCD38_2: tail tape measure; YP516_4012; phage(gi333798123) 7e-05 Click
13complement(3923526..3924872) putative exported protein; YP516_4013 0.0 Click
143925126..3925977 predicted glutathionylspermidine-utilizing glutathione transferase; YP516_4014 0.0 Click
15complement(3926167..3926772) PHAGE_Acinet_Ac42: hypothetical protein; YP516_4015; phage(gi311992578) 7e-19 Click

Region 7, total : 10 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4527193..4528134) PHAGE_Sodali_phiSG1: transposase; YP516_4614; phage(gi89886005) 3e-82 Click
2complement(4528200..4528820) PHAGE_Sodali_phiSG1: resolvase; YP516_4615; phage(gi89886020) 1e-05 Click
3complement(4529020..4529346) Inner membrane protein; YP516_4616 0.0 Click
4complement(4529346..4529573) Prevent-host-death family protein; YP516_4617 0.0 Click
54529875..4531080 PHAGE_Entero_P1: ParA; YP516_4618; phage(gi46401682) 4e-132 Click
64531077..4532048 PHAGE_Entero_P1: ParB; YP516_4619; phage(gi46401681) 1e-60 Click
7complement(4532185..4532331) Error-prone repair protein UmuC; YP516_4620 0.0 Click
84532427..4533824 putative DNA-binding protein; YP516_4621 0.0 Click
9complement(4533986..4534294) hypothetical protein; YP516_4622 0.0 Click
104534687..4535364 PHAGE_Bordet_1: adenine DNA methyltransferase; YP516_4623; phage(gi41179391) 9e-22 Click

Region 8, total : 78 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14540902..4541924 PROPHAGE_Escher_CFT073: transposase; YP516_4631; phage(gi26248360) 0.0 Click
24541816..4541828 attL    GAAAAAAGAGTAT 0.0 Click
34541921..4542703 PROPHAGE_Escher_CFT073: transposase/IS protein; YP516_4632; phage(gi26248359) 3e-143 Click
4complement(4542837..4543445) PHAGE_Entero_HK630: tail fiber assembly protein; YP516_4633; phage(gi428782810) 3e-66 Click
5complement(4543538..4543750) PHAGE_Gifsy_1: conserved hypothetical protein; contains pfam01661, Macro, Macro domain; YP516_4634; phage(gi169257213) 6e-06 Click
6complement(4543747..4546635) PHAGE_Salmon_SSU5: putative phage tail fiber protein; YP516_4635; phage(gi410491431) 3e-118 Click
7complement(4546716..4547333) PHAGE_Entero_phiP27: hypothetical protein P27p57; YP516_4636; phage(gi18249921) 3e-22 Click
8complement(4547351..4551988) PHAGE_Salmon_SSU5: putative phage tail protein; YP516_4637; phage(gi410491430) 0.0 Click
9complement(4552004..4552591) PHAGE_Salmon_SSU5: putative phage tail protein; YP516_4638; phage(gi410491429) 1e-105 Click
10complement(4552579..4553376) PHAGE_Salmon_SSU5: putative phage tail protein; YP516_4639; phage(gi410491428) 3e-156 Click
11complement(4553369..4554100) PHAGE_Salmon_SSU5: putative minor tail protein L; YP516_4640; phage(gi410491427) 4e-137 Click
12complement(4554157..4554492) PHAGE_Salmon_SSU5: putative minor tail protein M; YP516_4641; phage(gi410491426) 3e-60 Click
13complement(4554534..4559111) PHAGE_Salmon_SSU5: putative tail tape measure protein; YP516_4642; phage(gi410491425) 0.0 Click
14complement(4559119..4559388) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4643; phage(gi410491424) 8e-39 Click
15complement(4559469..4559786) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4644; phage(gi410491423) 2e-52 Click
16complement(4559846..4560592) PHAGE_Salmon_SSU5: putative Ig-like domain-containing protein; YP516_4645; phage(gi410491422) 9e-135 Click
17complement(4560667..4561050) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4646; phage(gi410491421) 6e-68 Click
18complement(4561052..4561525) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4647; phage(gi410491420) 4e-84 Click
19complement(4561516..4561974) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4648; phage(gi410491419) 1e-59 Click
20complement(4561958..4562791) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4649; phage(gi410491418) 9e-155 Click
21complement(4562791..4563225) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4650; phage(gi410491417) 1e-75 Click
22complement(4563269..4563469) PHAGE_Salmon_SSU5: putative Ig-like domain-containing protein; YP516_4651; phage(gi410491416) 8e-28 Click
23complement(4563370..4563861) PHAGE_Salmon_SSU5: putative Ig-like domain-containing protein; YP516_4652; phage(gi410491416) 1e-62 Click
24complement(4563936..4564811) PHAGE_Salmon_SSU5: putative major capsid protein; YP516_4653; phage(gi410491415) 4e-164 Click
25complement(4564838..4565209) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4654; phage(gi410491414) 8e-65 Click
26complement(4565283..4565738) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4655; phage(gi410491414) 1e-78 Click
27complement(4565761..4567350) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4656; phage(gi410491413) 0.0 Click
28complement(4567369..4568625) PHAGE_Salmon_SSU5: putative terminase large subunit; YP516_4657; phage(gi410491412) 0.0 Click
29complement(4568628..4569269) PHAGE_Salmon_SSU5: putative DNA-binding protein; YP516_4658; phage(gi410491411) 9e-116 Click
30complement(4569465..4569731) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4659; phage(gi410491540) 9e-45 Click
31complement(4569741..4570640) PHAGE_Salmon_SSU5: putative ABC transporter ATP-binding protein; YP516_4660; phage(gi410491539) 1e-170 Click
32complement(4570637..4570891) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4661; phage(gi410491538) 4e-42 Click
33complement(4570884..4571582) PHAGE_Salmon_SSU5: putative ABC transporter ATP-binding protein; YP516_4662; phage(gi410491537) 7e-113 Click
34complement(4571519..4572187) PHAGE_Salmon_SSU5: putative ParB-like nuclease domain-containing protein; YP516_4663; phage(gi410491536) 8e-118 Click
35complement(4572187..4572885) PHAGE_Salmon_SSU5: putative ParB-like nuclease domain-containing protein; YP516_4664; phage(gi410491535) 9e-128 Click
364572950..4574509 PHAGE_Salmon_SSU5: putative helicase; YP516_4665; phage(gi410491534) 0.0 Click
374574512..4574790 PHAGE_Salmon_SSU5: hypothetical protein; YP516_4666; phage(gi410491533) 1e-44 Click
384574850..4575272 PHAGE_Salmon_SSU5: putative lipoprotein; YP516_4667; phage(gi410491532) 4e-65 Click
394575277..4575804 PHAGE_Salmon_SSU5: putative repressor of phase 1 flagellin; YP516_4668; phage(gi410491531) 6e-82 Click
404576128..4576778 PHAGE_Salmon_SSU5: hypothetical protein; YP516_4669; phage(gi410491530) 5e-118 Click
414576863..4577090 hypothetical protein; YP516_4670 0.0 Click
42complement(4577068..4577211) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4671; phage(gi410491528) 4e-17 Click
43complement(4577729..4578211) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4672; phage(gi410491527) 3e-86 Click
44complement(4578224..4578457) hypothetical protein; YP516_4673 0.0 Click
45complement(4578417..4578704) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4674; phage(gi410491525) 5e-48 Click
46complement(4578898..4579356) PROPHAGE_Salmon_Ty2: transposase; YP516_4675; phage(gi29143766) 5e-84 Click
47complement(4579565..4580134) PHAGE_Salmon_SSU5: putative ribonuclease H-like domain-containing protein; YP516_4677; phage(gi410491487) 2e-105 Click
48complement(4580147..4580893) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4678; phage(gi410491486) 4e-138 Click
494580819..4580911 hypothetical protein; YP516_4679 0.0 Click
50complement(4580883..4582799) PHAGE_Salmon_SSU5: putative exonuclease subunit 2; YP516_4680; phage(gi410491485) 0.0 Click
51complement(4582808..4583032) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4681; phage(gi410491484) 1e-28 Click
52complement(4583029..4584114) PHAGE_Salmon_SSU5: putative exonuclease subunit 1; YP516_4682; phage(gi410491483) 0.0 Click
534584361..4584633 hypothetical protein; YP516_4683 0.0 Click
544584530..4585552 putative periplasmic protein; YP516_4684 0.0 Click
55complement(4585690..4585836) hypothetical protein; YP516_4685 0.0 Click
56complement(4585912..4586556) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4686; phage(gi410491480) 1e-121 Click
574587301..4588365 PHAGE_Salmon_SSU5: putative replication protein RepA; YP516_4687; phage(gi410491479) 0.0 Click
58complement(4588934..4589149) PHAGE_Salmon_SSU5: putative Cre-associated protein; YP516_4688; phage(gi410491478) 7e-35 Click
59complement(4589146..4589481) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4689; phage(gi410491477) 5e-54 Click
60complement(4589478..4589657) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4690; phage(gi410491476) 3e-22 Click
61complement(4589698..4589973) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4691; phage(gi410491475) 3e-47 Click
62complement(4590041..4590451) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4692; phage(gi410491474) 2e-76 Click
63complement(4590435..4590806) PHAGE_Salmon_SSU5: putative NinX-like protein; YP516_4693; phage(gi410491473) 5e-62 Click
64complement(4590960..4591790) PHAGE_Salmon_SSU5: putative SPFH domain / band 7 protein; YP516_4694; phage(gi410491472) 1e-153 Click
65complement(4591906..4591995) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4695; phage(gi410491471) 3e-06 Click
66complement(4592086..4593162) PHAGE_Salmon_SSU5: putative RecA-like recombinase; YP516_4696; phage(gi410491470) 0.0 Click
67complement(4593165..4593431) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4697; phage(gi410491469) 2e-43 Click
68complement(4593431..4594375) PHAGE_Salmon_SSU5: DNA polymerase I; YP516_4698; phage(gi410491468) 0.0 Click
69complement(4594436..4595464) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4699; phage(gi410491467) 0.0 Click
70complement(4595584..4596057) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4700; phage(gi410491466) 3e-74 Click
714596560..4597123 PHAGE_Salmon_SSU5: putative phage transcriptional regulator AlpA-like protein; YP516_4701; phage(gi410491464) 1e-67 Click
72complement(4597153..4597596) PHAGE_Salmon_SSU5: hypothetical protein; YP516_4702; phage(gi410491463) 7e-75 Click
73complement(4597593..4601117) PHAGE_Salmon_SSU5: DNA polymerase III alpha subunit; YP516_4703; phage(gi410491462) 0.0 Click
74complement(4601298..4602533) PHAGE_Salmon_SSU5: putative porphyrin biosynthetic protein; YP516_4704; phage(gi410491460) 0.0 Click
75complement(4602630..4604996) PHAGE_Salmon_SSU5: putative porphyrin biosynthetic protein; YP516_4705; phage(gi410491459) 0.0 Click
76complement(4605106..4605318) hypothetical protein; YP516_4706 0.0 Click
774605157..4605426 hypothetical protein; YP516_4707 0.0 Click
784605581..4605967 hypothetical protein; YP516_4708 0.0 Click
794605878..4605890 attR    GAAAAAAGAGTAT 0.0 Click
80complement(4605962..4607140) PHAGE_Salmon_vB_SosS_Oslo: integrase; YP516_4709; phage(gi399528791) 2e-21 Click