Bacillus cereus AH621 , whole genome shotgun sequence. [asmbl_id: NC_000000].5655808, GC%: 35.19%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 53 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1283800..283811 attL    TTGAAAAATAAA 0.0 Click
2284110..285489 PHAGE_Acanth_mimivirus: putative RNA methyltransferase; bcere0007_2870; phage(gi311977789) 4e-32 Click
3complement(285548..286672) PHAGE_Bacill_phBC6A52: DNA integration/recombination/invertion protein; bcere0007_2880; phage(gi31415821) 8e-75 Click
4287796..288971 PHAGE_Bacill_phBC6A52: helix-turn-helix protein; bcere0007_2890; phage(gi31415822) 3e-30 Click
5289003..289158 hypothetical protein; bcere0007_2900 0.0 Click
6289332..289448 hypothetical protein; bcere0007_2910 0.0 Click
7complement(289491..289841) PHAGE_Lactob_phig1e: repressor; bcere0007_2920; phage(gi23455773) 2e-16 Click
8290018..290031 attL    TAGGTGATGAAATG 0.0 Click
9290029..290271 PHAGE_Lister_A500: gp34; bcere0007_2930; phage(gi157324993) 3e-10 Click
10290331..291026 PHAGE_Staphy_SpaA1: antirepressor; bcere0007_2940; phage(gi399498899) 2e-45 Click
11291067..291417 Prophage LambdaBa04, DNA binding protein; bcere0007_2950 0.0 Click
12291417..291581 PHAGE_Bacill_phBC6A52: hypothetical protein BC2561; bcere0007_2960; phage(gi31415826) 4e-18 Click
13291611..291787 PHAGE_Bacill_phBC6A52: hypothetical protein BC2562; bcere0007_2970; phage(gi31415827) 8e-23 Click
14291829..292479 PHAGE_Staphy_PH15: hypothetical protein ph49; bcere0007_2980; phage(gi119967881) 2e-45 Click
15292594..293469 PHAGE_Lactob_phig1e: zinc finger protein; bcere0007_2990; phage(gi23455786) 2e-20 Click
16293504..293698 PHAGE_Bacill_phBC6A52: hypothetical protein BC2565; bcere0007_3000; phage(gi31415830) 7e-24 Click
17293734..293898 PHAGE_Bacill_phBC6A52: hypothetical protein BC2566; bcere0007_3010; phage(gi31415831) 1e-21 Click
18293913..294167 PHAGE_Bacill_phBC6A52: hypothetical protein BC2567; bcere0007_3020; phage(gi31415832) 2e-36 Click
19294180..294629 PHAGE_Bacill_IEBH: hypothetical protein IEBH_gp13; bcere0007_3030; phage(gi197261523) 3e-25 Click
20294791..295015 PHAGE_Bacill_IEBH: hypothetical protein IEBH_gp16; bcere0007_3040; phage(gi197261526) 1e-17 Click
21295019..295474 PHAGE_Myxoco_Mx8: hypothetical protein Mx8p26; bcere0007_3050; phage(gi15320596) 2e-21 Click
22295507..295788 hypothetical protein; bcere0007_3060 0.0 Click
23295835..296437 hypothetical protein; bcere0007_3070 0.0 Click
24297111..297371 hypothetical protein; bcere0007_3080 0.0 Click
25297403..297639 hypothetical protein; bcere0007_3090 0.0 Click
26297658..297780 hypothetical protein; bcere0007_3100 0.0 Click
27297885..298064 PHAGE_Bacill_phBC6A52: hypothetical protein BC2573; bcere0007_3110; phage(gi31415838) 4e-22 Click
28298091..298573 PHAGE_Bacill_phBC6A52: hypothetical protein BC2574; bcere0007_3120; phage(gi31415839) 4e-73 Click
29298573..299115 PHAGE_Bacill_phBC6A52: DNA integration/recombination/invertion protein; bcere0007_3130; phage(gi31415840) 1e-96 Click
30299686..299877 hypothetical protein; bcere0007_3140 0.0 Click
31300037..300309 hypothetical protein; bcere0007_3150 0.0 Click
32300333..300458 hypothetical protein; bcere0007_3160 0.0 Click
33300999..301166 hypothetical protein; bcere0007_3170 0.0 Click
34301269..301643 PHAGE_Staphy_phi5967PVL: hypothetical protein; bcere0007_3180; phage(gi431810268) 5e-19 Click
35302015..303328 PHAGE_Clostr_phiMMP04: terminase; bcere0007_3190; phage(gi414090443) 9e-108 Click
36303344..304558 PHAGE_Clostr_phiMMP04: phage portal protein; bcere0007_3200; phage(gi414090444) 2e-138 Click
37304614..305108 PHAGE_Bacill_WBeta: putative Caudovirales phage prohead protease; bcere0007_3210; phage(gi85701383) 3e-36 Click
38305124..306284 Phage major capsid protein; bcere0007_3220 0.0 Click
39306297..306557 PHAGE_Bacill_1: hypothetical protein BV1_gp22; bcere0007_3230; phage(gi155042937) 2e-07 Click
40306560..306832 hypothetical protein; bcere0007_3240 0.0 Click
41307121..307477 PHAGE_Lactoc_bIL285: Orf48; bcere0007_3250; phage(gi13095728) 9e-24 Click
42307522..307806 PHAGE_Geobac_GBSV1: aminopeptidase; bcere0007_3260; phage(gi115334635) 5e-16 Click
43307807..308379 PHAGE_Geobac_GBSV1: major tail protein; bcere0007_3270; phage(gi115334636) 5e-46 Click
44308384..308740 PHAGE_Geobac_GBSV1: hypothetical protein GPGV1_gp27; bcere0007_3280; phage(gi115334637) 6e-28 Click
45308842..308955 Prophage pi2 protein 41; bcere0007_3290 0.0 Click
46308973..310220 PHAGE_Lactoc_bIL285: tail protein; bcere0007_3300; phage(gi13095732) 4e-39 Click
47310433..312121 PHAGE_Clostr_phiCP34O: phage-related minor tail protein; bcere0007_3310; phage(gi422935445) 1e-34 Click
48312127..312933 PHAGE_Geobac_GBSV1: hypothetical protein GPGV1_gp30; bcere0007_3320; phage(gi115334640) 5e-09 Click
49312949..314733 Carboxyl esterase family II protein; bcere0007_3330 0.0 Click
50315042..316724 PHAGE_Entero_vB_EcoM_VR7: gp37 long tail fiber distal subunit; bcere0007_3340; phage(gi314121827) 5e-11 Click
51316726..316893 hypothetical protein; bcere0007_3350 0.0 Click
52316895..317296 hypothetical protein; bcere0007_3360 0.0 Click
53317326..317571 PHAGE_Bacill_phBC6A51: XpaF1 protein; bcere0007_3370; phage(gi31415801) 3e-33 Click
54317571..317810 PHAGE_Bacill_phBC6A51: holin; bcere0007_3380; phage(gi31415802) 2e-33 Click
55317819..318865 PHAGE_Bacill_phBC6A51: N-acetylmuramoyl-L-alanine amidase; bcere0007_3390; phage(gi31415803) 0.0 Click
56324347..324360 attR    TAGGTGATGAAATG 0.0 Click
57329917..329928 attR    TTGAAAAATAAA 0.0 Click

Region 2, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1109670..1110515) PHAGE_Megavi_lba: macrocin o-methyltransferase; bcere0007_11270; phage(gi448826129) 2e-32 Click
2complement(1110639..1111544) PHAGE_Bacill_phBC6A52: Collagen triple helix repeat protein; bcere0007_11280; phage(gi31415834) 3e-67 Click
31111710..1112807 PHAGE_Bacill_SPBc2: hypothetical protein SPBc2p022; bcere0007_11290; phage(gi9630147) 2e-15 Click
41112954..1113652 PHAGE_Microm_12T: hypothetical protein; bcere0007_11300; phage(gi472342811) 3e-06 Click
51113769..1114335 hypothetical protein; bcere0007_11310 0.0 Click
61114347..1115027 hypothetical protein; bcere0007_11320 0.0 Click
71115042..1115779 PHAGE_Escher_phAPEC8: putative glucose-1-phosphate thymidylyltransferase; bcere0007_11330; phage(gi448260372) 7e-49 Click
81115788..1116333 PHAGE_Escher_phAPEC8: putative dTDP-4-dehydrorhamnose 3,5-epimerase; bcere0007_11340; phage(gi448260371) 1e-31 Click
91116349..1117320 PHAGE_Acanth_1: hypothetical protein ATCV1_Z544R; bcere0007_11350; phage(gi155371491) 1e-70 Click
101117332..1118186 PHAGE_Escher_phAPEC8: putative dTDP-4-dehydrorhamnose reductase; bcere0007_11360; phage(gi448260370) 2e-37 Click
111118295..1119065 PHAGE_Mycoba_Troll4: gp65; bcere0007_11370; phage(gi206599859) 9e-05 Click
121119213..1119731 hypothetical protein; bcere0007_11380 0.0 Click
13complement(1119780..1120253) Spore coat protein; bcere0007_11390 0.0 Click
141120369..1120728 PHAGE_Actino_phiAsp2: Pas3; bcere0007_11400; phage(gi48697404) 3e-06 Click
151120877..1121077 cytochrome c oxidase subunit III; bcere0007_11410 0.0 Click
16complement(1121154..1121657) Membrane spanning protein; bcere0007_11420 0.0 Click
17complement(1121825..1122295) Spore coat protein; bcere0007_11430 0.0 Click
18complement(1122440..1124506) PHAGE_Bacill_36: PcrA helicase; bcere0007_11440; phage(gi156564011) 1e-80 Click

Region 3, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(5025175..5025324) PHAGE_Bacill_SPBc2: hypothetical protein SPBc2p148; bcere0007_51570; phage(gi9630273) 7e-05 Click
25025531..5025665 hypothetical protein; bcere0007_51580 0.0 Click
3complement(5025883..5026347) PHAGE_Staphy_37: ORF039; bcere0007_51590; phage(gi66395766) 1e-17 Click
4complement(5026491..5027009) PHAGE_Human__8: LANA; bcere0007_51600; phage(gi139472804) 2e-17 Click
55027328..5027462 PHAGE_Bacill_IEBH: hypothetical protein IEBH_gp05; bcere0007_51610; phage(gi197261515) 7e-11 Click
65027890..5028006 PHAGE_Bacill_IEBH: hypothetical protein IEBH_gp06; bcere0007_51620; phage(gi197261516) 5e-08 Click
75028021..5028191 hypothetical protein; bcere0007_51630 0.0 Click
85028656..5029045 Ribbon-helix-helix protein, CopG; bcere0007_51640 0.0 Click
9complement(5029198..5029413) spore germination protein gerPF; bcere0007_51650 0.0 Click
105029628..5029789 hypothetical protein; bcere0007_51660 0.0 Click
115029946..5030116 PHAGE_Bacill_phBC6A52: hypothetical protein BC2573; bcere0007_51670; phage(gi31415838) 2e-11 Click
125030215..5030493 PHAGE_Bacill_phBC6A52: hypothetical protein BC2574; bcere0007_51680; phage(gi31415839) 4e-22 Click
135030623..5031993 PHAGE_Bacill_36: virion structural protein; bcere0007_51690; phage(gi156564148) 1e-13 Click
145032441..5032968 hypothetical protein; bcere0007_51700 0.0 Click
15complement(5033079..5033225) hypothetical protein; bcere0007_51710 0.0 Click
16complement(5033257..5033496) PHAGE_Bacill_phi105: hypothetical protein phi105_33; bcere0007_51720; phage(gi22855026) 2e-13 Click
17complement(5033708..5034208) PHAGE_Bacill_phi105: immunity repressor; bcere0007_51730; phage(gi22855027) 8e-33 Click
185034273..5034509 PHAGE_Staphy_SpaA1: XRE family transcriptional regulator; bcere0007_51740; phage(gi399498896) 4e-14 Click
195034596..5035492 PHAGE_Bacill_phBC6A52: replication protein; bcere0007_51750; phage(gi31415828) 2e-54 Click
205035596..5035982 PHAGE_Bacill_Gamma: conserved phage protein; bcere0007_51760; phage(gi77020164) 8e-49 Click

Region 4, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(5083184..5084284) Spore coat polysaccharide biosynthesis protein spsG; bcere0007_52320 0.0 Click
2complement(5084324..5085319) Spore coat polysaccharide biosynthesis protein spsF; bcere0007_52330 0.0 Click
3complement(5085320..5086525) PHAGE_Bathyc_BpV1: hypothetical protein; bcere0007_52340; phage(gi313768026) 1e-31 Click
4complement(5086525..5087427) PHAGE_Prochl_P_SSM2: nucleotide sugar epimerase; bcere0007_52350; phage(gi61806141) 2e-25 Click
5complement(5087484..5088509) PHAGE_Megavi_lba: putative dTDP-d-glucose 4 6-dehydratase; bcere0007_52360; phage(gi448825504) 2e-39 Click
6complement(5088543..5089949) Spore coat polysaccharide biosynthesis protein spsB; bcere0007_52370 0.0 Click
7complement(5089951..5090610) Spore coat polysaccharide biosynthesis protein spsA; bcere0007_52380 0.0 Click
85091019..5092317 PHAGE_Megavi_lba: putative glycosyltransferase; bcere0007_52390; phage(gi448825509) 4e-08 Click
9complement(5092523..5093128) PROPHAGE_Brucel_1330: transposase, putative; bcere0007_52400; phage(gi23502708) 3e-39 Click

Region 5, total : 8 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15292161..5292172 attL    GATTTACAACTC 0.0 Click
25292191..5292796 PHAGE_Parame_FR483: hypothetical protein FR483_N103R; bcere0007_54090; phage(gi155370201) 9e-17 Click
3complement(5292938..5293996) PHAGE_Thermu_45: XerD-like integrase; bcere0007_54100; phage(gi157265299) 5e-21 Click
45294198..5294218 attL    CGACCTCCACCCTGTCAAGGT 0.0 Click
5complement(5294439..5294930) PHAGE_Bacill_BtCS33: transcription regulator, putative Cro/CI family; bcere0007_54110; phage(gi392972738) 4e-11 Click
65295121..5298111 PHAGE_Acanth_moumouvirus: capsid protein; bcere0007_54120; phage(gi441432305) 2e-05 Click
75298490..5299548 hypothetical protein; bcere0007_54130 0.0 Click
85299563..5299703 hypothetical protein; bcere0007_54140 0.0 Click
95299704..5300060 PHAGE_Clostr_phiC2: putative integrase; bcere0007_54150; phage(gi134287379) 2e-14 Click
105300164..5300805 PHAGE_Bacill_BtCS33: DNA integration/recombination/inversion protein; bcere0007_54160; phage(gi392972735) 1e-26 Click
115304154..5304174 attR    CGACCTCCACCCTGTCAAGGT 0.0 Click
125315313..5315324 attR    GATTTACAACTC 0.0 Click