Leuconostoc mesenteroides subsp. cremoris ATCC 19254 , [asmbl_id: NC_000000].1638511, GC%: 37.90%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 22 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(323867..326242) PHAGE_Acanth_moumouvirus: UvrD/REP helicase family protein; HMPREF0555_0388; phage(gi441432531) 7e-06 Click
2326428..326499 attL    AAAAGGCGCTACATTAAGGTTTTGATACCTTATGCAACGCCTTGAAATGTATTAGTGGAGAAGAAGGGATTC 0.0 Click
3complement(326554..327681) PHAGE_Lactoc_ul36: putative integrase; HMPREF0555_0389; phage(gi21716073) 1e-48 Click
4complement(327791..327979) hypothetical protein; HMPREF0555_0390 0.0 Click
5complement(327990..328337) PHAGE_Lactoc_bIL309: Orf45; HMPREF0555_0391; phage(gi13095850) 2e-19 Click
6complement(328441..329215) PHAGE_Lactoc_bIL285: capsid protein; HMPREF0555_0392; phage(gi13095724) 3e-26 Click
7complement(329208..329768) PHAGE_Lactoc_bIL309: protease; HMPREF0555_0393; phage(gi13095847) 1e-50 Click
8complement(329765..330838) PHAGE_Lactoc_bIL309: portal protein; HMPREF0555_0394; phage(gi13095846) 2e-111 Click
9complement(330835..331008) hypothetical protein; HMPREF0555_0395 0.0 Click
10complement(331024..332859) PHAGE_Lactoc_bIL309: terminase; HMPREF0555_0396; phage(gi13095844) 0.0 Click
11complement(332856..333332) PHAGE_Lactob_1: terminase small subunit; HMPREF0555_0397; phage(gi219563198) 3e-20 Click
12333438..333578 hypothetical protein; HMPREF0555_0398 0.0 Click
13complement(333673..334173) PHAGE_Lactoc_bIL309: Orf37; HMPREF0555_0399; phage(gi13095842) 2e-54 Click
14complement(334250..334657) PHAGE_Lactoc_lato: hypothetical protein P335p28; HMPREF0555_0400; phage(gi30089889) 2e-07 Click
15complement(334647..335015) hypothetical protein; HMPREF0555_0401 0.0 Click
16complement(335012..335218) hypothetical protein; HMPREF0555_0402 0.0 Click
17complement(335215..335397) hypothetical protein; HMPREF0555_0403 0.0 Click
18complement(335667..336923) PHAGE_Lactoc_bIL312: helicase; HMPREF0555_0404; phage(gi13095906) 3e-72 Click
19complement(336923..337801) PHAGE_Lactoc_bIL310: hypothetical protein bIL310p24; HMPREF0555_0405; phage(gi13095885) 6e-16 Click
20complement(337909..338115) hypothetical protein; HMPREF0555_0406 0.0 Click
21338236..338808 PHAGE_Lactoc_bIL309: Orf32; HMPREF0555_0407; phage(gi13095837) 1e-06 Click
22complement(338836..339366) hypothetical protein; HMPREF0555_0408 0.0 Click
23339665..339736 attR    AAAAGGCGCTACATTAAGGTTTTGATACCTTATGCAACGCCTTGAAATGTATTAGTGGAGAAGAAGGGATTC 0.0 Click
24complement(339717..339807) tRNA 0.0 Click
25complement(340111..341667) PHAGE_Parame_1: hypothetical protein; HMPREF0555_0409; phage(gi9632181) 1e-22 Click

Region 2, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(587712..588137) PHAGE_Lactob_Lrm1: holin; HMPREF0555_0694; phage(gi195661218) 1e-28 Click
2complement(588147..589238) PHAGE_Lactob_JCL1032: putative endolysin; HMPREF0555_0695; phage(gi418489185) 4e-59 Click
3complement(589242..589466) conserved hypothetical protein; HMPREF0555_0696 0.0 Click
4complement(589468..589704) hypothetical protein; HMPREF0555_0697 0.0 Click
5complement(589707..589850) hypothetical protein; HMPREF0555_0698 0.0 Click
6complement(589831..591106) PHAGE_Temper_1: hypothetical protein phiNIH1.1_45; HMPREF0555_0699; phage(gi16271821) 7e-14 Click
7complement(591107..591616) PHAGE_Strept_SMP: minor structural protein; HMPREF0555_0700; phage(gi119953748) 7e-11 Click
8complement(591617..593777) PHAGE_Bacill_B4: putative tail fiber; HMPREF0555_0701; phage(gi410493410) 2e-12 Click
9complement(593777..594478) PHAGE_Lactoc_bIL285: Orf53; HMPREF0555_0702; phage(gi13095733) 3e-08 Click
10complement(594481..598986) PHAGE_Lactob_LF1: phage tail tape measure protein; HMPREF0555_0703; phage(gi418489397) 3e-77 Click
11complement(598986..599129) hypothetical protein; HMPREF0555_0704 0.0 Click
12complement(599210..599542) hypothetical protein; HMPREF0555_0705 0.0 Click
13complement(599657..600265) PHAGE_Entero_1: major tail protein; HMPREF0555_0706; phage(gi225626387) 3e-11 Click
14complement(600269..600646) PHAGE_Lactob_Nu: putative tail component; HMPREF0555_0707; phage(gi77999994) 3e-05 Click
15complement(600643..601143) hypothetical protein; HMPREF0555_0708 0.0 Click
16complement(601148..601525) hypothetical protein; HMPREF0555_0709 0.0 Click
17complement(601509..601826) hypothetical protein; HMPREF0555_0710 0.0 Click
18complement(601888..602166) PHAGE_Lactob_KC5a: putative phage major capsid protein; HMPREF0555_0711; phage(gi90592614) 1e-05 Click
19complement(602179..603366) PHAGE_Staphy_phi7401PVL: phage major capsid protein; HMPREF0555_0712; phage(gi448244667) 6e-60 Click
20complement(603371..604078) PHAGE_Staphy_phi7401PVL: protease; HMPREF0555_0713; phage(gi448244666) 7e-52 Click
21complement(604044..605366) PHAGE_Staphy_phi7401PVL: portal protein; HMPREF0555_0714; phage(gi448244665) 2e-58 Click
22605808..605936 hypothetical protein; HMPREF0555_0715 0.0 Click
23complement(606001..607797) PHAGE_Staphy_phi7401PVL: terminase large subunit; HMPREF0555_0716; phage(gi448244664) 7e-141 Click
24complement(607772..608254) PHAGE_Bacill_phIS3501: terminase small subunit; HMPREF0555_0717; phage(gi422934327) 3e-16 Click

Region 3, total : 57 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(612270..613433) PHAGE_Marseillevirus: putative nuclease; HMPREF0555_0724; phage(gi284504209) 2e-07 Click
2complement(613430..614605) site-specific DNA-methyltransferase (adenine-specific); HMPREF0555_0725 0.0 Click
3complement(614669..615094) PHAGE_Staphy_StB20: HNH endonuclease; HMPREF0555_0726; phage(gi431809762) 5e-10 Click
4complement(615208..615456) hypothetical protein; HMPREF0555_0727 0.0 Click
5complement(615466..615624) hypothetical protein; HMPREF0555_0728 0.0 Click
6complement(615649..616827) PHAGE_Lactob_1: hypothetical protein phiJL1_ORF388; HMPREF0555_0729; phage(gi62327094) 1e-64 Click
7615840..615852 attL    GATATTTTGAATG 0.0 Click
8complement(616828..616992) hypothetical protein; HMPREF0555_0730 0.0 Click
9complement(617625..617744) hypothetical protein; HMPREF0555_0731 0.0 Click
10complement(617741..618283) PHAGE_Lactob_JCL1032: hypothetical protein; HMPREF0555_0732; phage(gi418489171) 5e-05 Click
11complement(618384..618728) PHAGE_Lactob_JCL1032: hypothetical protein; HMPREF0555_0733; phage(gi418489156) 2e-26 Click
12complement(618728..621103) PHAGE_Lactob_JCL1032: putative DNA primase; HMPREF0555_0734; phage(gi418489153) 7e-163 Click
13complement(621113..621808) PHAGE_Staphy_SA11: hypothetical protein; HMPREF0555_0735; phage(gi422935681) 4e-62 Click
14complement(621857..622459) hypothetical protein; HMPREF0555_0736 0.0 Click
15complement(622475..623125) PHAGE_Lactob_JCL1032: hypothetical protein; HMPREF0555_0737; phage(gi418489152) 1e-07 Click
16complement(623147..624694) PHAGE_Lactob_JCL1032: putative DNA helicase; HMPREF0555_0738; phage(gi418489151) 1e-93 Click
17complement(624701..625378) PHAGE_Strept_Sfi21: nucleoside triphosphate binding motifs; HMPREF0555_0739; phage(gi9632970) 2e-27 Click
18complement(625379..625864) PHAGE_Lactob_phiAT3: hypothetical protein phiAT3gORF27; HMPREF0555_0740; phage(gi48697287) 3e-12 Click
19626114..626545 hypothetical protein; HMPREF0555_0741 0.0 Click
20626542..626850 hypothetical protein; HMPREF0555_0742 0.0 Click
21complement(627038..627343) PHAGE_Entero_phiEf11: asch domain protein; HMPREF0555_0743; phage(gi282598726) 7e-16 Click
22complement(627340..627663) hypothetical protein; HMPREF0555_0744 0.0 Click
23complement(627761..628198) PHAGE_Staphy_P954: DNA methyltransferase; HMPREF0555_0745; phage(gi257136381) 2e-35 Click
24complement(628240..629586) PHAGE_Strept_MM1: putative DNA methylase; HMPREF0555_0746; phage(gi15088756) 4e-97 Click
25complement(629599..629742) hypothetical protein; HMPREF0555_0747 0.0 Click
26complement(629739..630020) hypothetical protein; HMPREF0555_0748 0.0 Click
27complement(629986..630162) hypothetical protein; HMPREF0555_0749 0.0 Click
28630251..630589 PHAGE_Entero_phiFL3A: CI phage repressor protein; HMPREF0555_0750; phage(gi281416216) 7e-11 Click
29complement(630576..630968) hypothetical protein; HMPREF0555_0751 0.0 Click
30complement(631039..631332) PHAGE_Lactob_LP65: hypothetical protein LP65_gp071; HMPREF0555_0752; phage(gi56693119) 3e-10 Click
31complement(631345..631740) PHAGE_Lactob_1: hypothetical protein lb338_phage_58; HMPREF0555_0753; phage(gi226377688) 1e-13 Click
32complement(631733..631927) PHAGE_Lactob_KC5a: putative transcriptional regulator; HMPREF0555_0754; phage(gi90592588) 3e-12 Click
33complement(631924..632124) PHAGE_Lactob_JCL1032: putative CI-like repressor; HMPREF0555_0755; phage(gi418489143) 2e-07 Click
34complement(632121..632318) PHAGE_Clostr_phiC2: putative repressor; HMPREF0555_0756; phage(gi134287382) 1e-12 Click
35complement(632302..632520) hypothetical protein; HMPREF0555_0757 0.0 Click
36complement(632510..632677) hypothetical protein; HMPREF0555_0758 0.0 Click
37complement(632664..632897) hypothetical protein; HMPREF0555_0759 0.0 Click
38complement(632901..633059) hypothetical protein; HMPREF0555_0760 0.0 Click
39complement(633166..633408) hypothetical protein; HMPREF0555_0761 0.0 Click
40complement(633386..633529) hypothetical protein; HMPREF0555_0762 0.0 Click
41complement(633529..634242) PHAGE_Staphy_X2: ORF016; HMPREF0555_0763; phage(gi66394686) 4e-44 Click
42complement(634248..634442) hypothetical protein; HMPREF0555_0764 0.0 Click
43634537..634785 conserved hypothetical protein; HMPREF0555_0765 0.0 Click
44complement(634739..635014) hypothetical protein; HMPREF0555_0766 0.0 Click
45635013..635489 hypothetical protein; HMPREF0555_0767 0.0 Click
46complement(635455..635619) hypothetical protein; HMPREF0555_0768 0.0 Click
47complement(635650..636456) PHAGE_Lactob_H: hypothetical protein; HMPREF0555_0769; phage(gi148750866) 1e-68 Click
48636528..637112 hypothetical protein; HMPREF0555_0770 0.0 Click
49complement(637197..637421) hypothetical protein; HMPREF0555_0771 0.0 Click
50637670..638026 PHAGE_Entero_phiFL3A: CI phage repressor protein; HMPREF0555_0772; phage(gi281416216) 5e-19 Click
51638031..638444 PHAGE_Lactob_Lj928: hypothetical protein Ljo_1458; HMPREF0555_0773; phage(gi41179295) 8e-05 Click
52638501..639235 PHAGE_Entero_T5: L-shaped tail fiber protein; HMPREF0555_0774; phage(gi46401894) 5e-05 Click
53639065..639077 attR    GATATTTTGAATG 0.0 Click
54639377..640444 PHAGE_Lactob_LF1: phage integrase; HMPREF0555_0775; phage(gi418489411) 4e-51 Click
55complement(640596..640669) tRNA 0.0 Click
56640770..641288 conserved hypothetical protein; HMPREF0555_0776 0.0 Click
57641467..642000 possible Phosphinothricin acetyltransferase; HMPREF0555_0777 0.0 Click
58642095..642466 DMT superfamily drug/metabolite transporter; HMPREF0555_0778 0.0 Click
59642542..642676 conserved hypothetical protein; HMPREF0555_0779 0.0 Click
60complement(642774..643094) PHAGE_Acinet_ZZ1: putative quaternary ammonium compound-resistance protein qacE; HMPREF0555_0780; phage(gi392973036) 1e-05 Click

Region 4, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1639257..639268 attL    ACATAAAAAAGC 0.0 Click
2646194..647372 PHAGE_Bacill_BCJA1c: integrase; HMPREF0555_0783; phage(gi56694872) 1e-16 Click
3647507..647524 attL    CGAAAGGAGCTAGCGGGA 0.0 Click
4complement(647580..648701) PHAGE_Lactoc_ul36: putative integrase; HMPREF0555_0784; phage(gi21716073) 1e-40 Click
5complement(648819..649007) hypothetical protein; HMPREF0555_0785 0.0 Click
6complement(649014..649367) PHAGE_Lactoc_bIL309: Orf45; HMPREF0555_0786; phage(gi13095850) 2e-12 Click
7complement(649474..650230) PHAGE_Lactoc_bIL285: capsid protein; HMPREF0555_0787; phage(gi13095724) 2e-25 Click
8complement(650242..650811) PHAGE_Lactoc_bIL309: protease; HMPREF0555_0788; phage(gi13095847) 1e-49 Click
9complement(650808..651881) PHAGE_Lactoc_bIL309: portal protein; HMPREF0555_0789; phage(gi13095846) 4e-111 Click
10complement(651878..652042) PHAGE_Lactoc_bIL309: Orf40; HMPREF0555_0790; phage(gi13095845) 2e-06 Click
11complement(652055..653890) PHAGE_Lactoc_bIL309: terminase; HMPREF0555_0791; phage(gi13095844) 0.0 Click
12complement(653887..654363) PHAGE_Lactob_1: terminase small subunit; HMPREF0555_0792; phage(gi219563198) 3e-22 Click
13complement(654695..655096) PHAGE_Lactoc_bIL309: Orf37; HMPREF0555_0793; phage(gi13095842) 1e-33 Click
14complement(655365..655736) hypothetical protein; HMPREF0555_0794 0.0 Click
15complement(655739..655912) hypothetical protein; HMPREF0555_0795 0.0 Click
16complement(655916..656143) hypothetical protein; HMPREF0555_0796 0.0 Click
17complement(656401..657654) PHAGE_Lactoc_bIL312: helicase; HMPREF0555_0797; phage(gi13095906) 2e-76 Click
18complement(657651..658538) PHAGE_Lactoc_bIL310: hypothetical protein bIL310p24; HMPREF0555_0798; phage(gi13095885) 3e-19 Click
19complement(658639..658839) hypothetical protein; HMPREF0555_0799 0.0 Click
20658962..659579 PHAGE_Lactoc_bIL309: Orf32; HMPREF0555_0800; phage(gi13095837) 5e-08 Click
21659868..659885 attR    CGAAAGGAGCTAGCGGGA 0.0 Click
22complement(659872..659960) tRNA 0.0 Click
23complement(660005..661846) PHAGE_Lausan: putative translation elongation factor 1-alpha; HMPREF0555_0801; phage(gi327409596) 2e-08 Click
24complement(661908..662696) possible inositol-phosphate phosphatase; HMPREF0555_0802 0.0 Click
25complement(662693..662965) conserved hypothetical protein; HMPREF0555_0803 0.0 Click
26663021..663599 PHAGE_Synech_S_SSM7: RIIA-RIIB membrane-associated protein; HMPREF0555_0804; phage(gi326783953) 2e-11 Click
27complement(663649..664530) PHAGE_Cafete_BV_PW1: putative DnaJ/Hsp40; HMPREF0555_0805; phage(gi310831116) 3e-22 Click
28complement(664594..666441) PHAGE_Bathyc_BpV1: hypothetical protein; HMPREF0555_0806; phage(gi313768007) 1e-147 Click
29677310..677321 attR    ACATAAAAAAGC 0.0 Click