Lactobacillus crispatus JV-V01 , whole genome shotgun [asmbl_id: NC_000000].2066562, GC%: 36.89%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1476329..476345 attL    ATCAAGTACATGAAGGA 0.0 Click
2480335..482236 PHAGE_Parame_bursaria_Chlorella_virus_AR158: hypothetical protein AR158_C785L; HMPREF0506_0479; phage(gi157953975) 3e-28 Click
3482262..482492 copper chaperone; HMPREF0506_0480 0.0 Click
4complement(482692..483840) PHAGE_Lactob_prophage_Lj965: putative integrase; HMPREF0506_0481; phage(gi41179218) 4e-63 Click
5complement(483927..484259) hypothetical protein; HMPREF0506_0482 0.0 Click
6complement(484273..484881) PHAGE_Lactob_prophage_Lj965: putative superinfection immunity protein; HMPREF0506_0483; phage(gi41179219) 3e-42 Click
7complement(484931..485338) PHAGE_Lactob_phiadh: hypothetical protein phiadhp04; HMPREF0506_0484; phage(gi9633004) 5e-23 Click
8complement(485339..485686) PHAGE_Lactob_LF1: xre family toxin-antitoxin system; HMPREF0506_0485; phage(gi418489419) 5e-20 Click
9485857..486066 PHAGE_Lactob_johnsonii_prophage_Lj771: hypothetical protein LJ771_005; HMPREF0506_0486; phage(gi163932157) 5e-12 Click
10486101..486844 PHAGE_Lactob_prophage_Lj965: putative antirepressor; HMPREF0506_0487; phage(gi41179226) 3e-96 Click
11486857..487075 PHAGE_Lactob_phiadh: hypothetical protein phiadhp08; HMPREF0506_0488; phage(gi9633008) 2e-07 Click
12487072..487239 hypothetical protein; HMPREF0506_0489 0.0 Click
13487223..487486 PHAGE_Lactob_JCL1032: hypothetical protein; HMPREF0506_0490; phage(gi418489147) 3e-07 Click
14487487..487654 hypothetical protein; HMPREF0506_0491 0.0 Click
15487666..487830 hypothetical protein; HMPREF0506_0492 0.0 Click
16complement(487789..488205) hypothetical protein; HMPREF0506_0493 0.0 Click
17488295..488594 hypothetical protein; HMPREF0506_0494 0.0 Click
18488599..488844 hypothetical protein; HMPREF0506_0495 0.0 Click
19489098..489463 hypothetical protein; HMPREF0506_0496 0.0 Click
20489466..490344 PHAGE_Lactob_prophage_Lj965: hypothetical protein Ljo_0298; HMPREF0506_0497; phage(gi41179230) 1e-35 Click
21490347..491132 PHAGE_Lactob_prophage_Lj965: putative replication protein; HMPREF0506_0498; phage(gi41179231) 2e-60 Click
22491161..491868 PHAGE_Staphy_vB_SepiS_phiIPLA5: DNA replication protein; HMPREF0506_0499; phage(gi399528938) 3e-31 Click
23503214..503230 attR    ATCAAGTACATGAAGGA 0.0 Click

Region 2, total : 40 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(498693..499085) PHAGE_Clostr_phi_CD119: hypothetical protein CDBPCV119_gp44; HMPREF0506_0515; phage(gi90592680) 8e-12 Click
2complement(499134..499313) conserved hypothetical protein; HMPREF0506_0516 0.0 Click
3499399..499956 PHAGE_Brocho_NF5: gp1; HMPREF0506_0517; phage(gi327197585) 8e-26 Click
4499949..501403 PHAGE_Lister_B054: TerL; HMPREF0506_0518; phage(gi157325286) 4e-114 Click
5501416..502801 PHAGE_Lister_B054: gp3; HMPREF0506_0519; phage(gi157325287) 2e-51 Click
6502788..503591 PHAGE_Lister_B054: gp4; HMPREF0506_0520; phage(gi157325288) 3e-31 Click
7503602..503958 hypothetical protein; HMPREF0506_0521 0.0 Click
8503958..505169 PHAGE_Lister_B054: gp6; HMPREF0506_0522; phage(gi157325290) 1e-47 Click
9505169..505705 PHAGE_Lister_B054: gp7; HMPREF0506_0523; phage(gi157325291) 3e-12 Click
10505720..506679 PHAGE_Lister_B054: gp8; HMPREF0506_0524; phage(gi157325292) 2e-20 Click
11506696..507082 PHAGE_Lister_B054: gp10; HMPREF0506_0525; phage(gi157325294) 1e-06 Click
12507079..507750 PHAGE_Lister_B054: gp11; HMPREF0506_0526; phage(gi157325295) 2e-17 Click
13507772..508179 hypothetical protein; HMPREF0506_0527 0.0 Click
14508157..508702 hypothetical protein; HMPREF0506_0528 0.0 Click
15508706..509710 PHAGE_Lister_B054: gp14; HMPREF0506_0529; phage(gi157325298) 6e-30 Click
16509717..510040 PHAGE_Lister_B054: gp14; HMPREF0506_0530; phage(gi157325298) 9e-14 Click
17510055..510486 PHAGE_Lister_B054: gp15; HMPREF0506_0531; phage(gi157325299) 1e-14 Click
18510545..510991 hypothetical protein; HMPREF0506_0532 0.0 Click
19510963..511208 hypothetical protein; HMPREF0506_0533 0.0 Click
20511254..516710 PHAGE_Lactoc_bIL286: tail protein; HMPREF0506_0534; phage(gi13095795) 2e-56 Click
21516722..517732 PHAGE_Lister_B054: gp19; HMPREF0506_0535; phage(gi157325303) 9e-12 Click
22517734..518147 PHAGE_Lister_B054: gp20; HMPREF0506_0536; phage(gi157325304) 8e-11 Click
23518144..519214 PHAGE_Lister_B054: gp21; HMPREF0506_0537; phage(gi157325305) 2e-14 Click
24519228..519764 hypothetical protein; HMPREF0506_0538 0.0 Click
25519757..520140 PHAGE_Lister_B054: gp23; HMPREF0506_0539; phage(gi157325307) 3e-08 Click
26520130..521317 PHAGE_Lister_B054: gp24; HMPREF0506_0540; phage(gi157325308) 1e-65 Click
27521307..522155 PHAGE_Lister_B054: gp25; HMPREF0506_0541; phage(gi157325309) 1e-08 Click
28522184..523251 hypothetical protein; HMPREF0506_0542 0.0 Click
29523267..525411 PHAGE_Lactob_LF1: tail fiber; HMPREF0506_0543; phage(gi418489400) 9e-16 Click
30525442..525858 hypothetical protein; HMPREF0506_0544 0.0 Click
31525852..526220 hypothetical protein; HMPREF0506_0545 0.0 Click
32526266..526667 hypothetical protein; HMPREF0506_0546 0.0 Click
33526664..527086 hypothetical protein; HMPREF0506_0547 0.0 Click
34527170..527733 PHAGE_Lactob_AQ113: phage related protein; HMPREF0506_0548; phage(gi446730255) 9e-22 Click
35527752..527934 hypothetical protein; HMPREF0506_0549 0.0 Click
36527945..528292 PHAGE_Lactob_Lv_1: holin; HMPREF0506_0550; phage(gi219563212) 1e-10 Click
37528303..528524 PHAGE_Lactob_AQ113: hypothetical protein; HMPREF0506_0551; phage(gi446730257) 1e-07 Click
38528508..528741 PHAGE_Lactob_AQ113: hypothetical protein; HMPREF0506_0552; phage(gi446730258) 2e-18 Click
39528741..529136 PHAGE_Lactob_AQ113: hypothetical protein; HMPREF0506_0553; phage(gi446730259) 7e-14 Click
40529223..530344 PHAGE_Lactob_AQ113: endolysin; HMPREF0506_0554; phage(gi446730260) 0.0 Click

Region 3, total : 61 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11529544..1529565 attL    CCTCCACATACGTGGAGAATAC 0.0 Click
21538488..1539111 PHAGE_Lactob_prophage_Lj928: hypothetical protein Ljo_1425; HMPREF0506_1620; phage(gi41179330) 1e-19 Click
3complement(1539182..1539811) peptide-methionine (S)-S-oxide reductase; HMPREF0506_1621 0.0 Click
4complement(1540014..1540898) PHAGE_Lactob_phiadh: lysin; HMPREF0506_1622; phage(gi9633062) 1e-62 Click
5complement(1540891..1541319) PHAGE_Lactob_phiadh: holin; HMPREF0506_1623; phage(gi9633061) 4e-23 Click
6complement(1541309..1541503) hypothetical protein; HMPREF0506_1624 0.0 Click
7complement(1541505..1541936) PHAGE_Lactob_phiadh: hypothetical protein phiadhp59; HMPREF0506_1625; phage(gi9633059) 7e-14 Click
8complement(1541917..1544304) PHAGE_Lactob_prophage_Lj928: hypothetical protein Ljo_1423; HMPREF0506_1626; phage(gi41179332) 3e-35 Click
9complement(1544358..1544741) PHAGE_Lactob_phiadh: hypothetical protein phiadhp56; HMPREF0506_1627; phage(gi9633056) 4e-10 Click
10complement(1544713..1544907) hypothetical protein; HMPREF0506_1628 0.0 Click
11complement(1544912..1548349) PHAGE_Lactob_phiadh: hypothetical protein phiadhp55; HMPREF0506_1629; phage(gi9633055) 4e-42 Click
12complement(1548319..1549080) PHAGE_Lactob_phiadh: hypothetical protein phiadhp53; HMPREF0506_1630; phage(gi9633053) 9e-16 Click
13complement(1549070..1556089) PHAGE_Lactoc_bIL286: tail protein; HMPREF0506_1631; phage(gi13095795) 8e-142 Click
14complement(1556123..1556272) hypothetical protein; HMPREF0506_1632 0.0 Click
15complement(1556323..1556736) hypothetical protein; HMPREF0506_1633 0.0 Click
16complement(1556817..1557593) PHAGE_Strept_DT1: major tail protein; HMPREF0506_1634; phage(gi9632429) 6e-19 Click
17complement(1557593..1557967) hypothetical protein; HMPREF0506_1635 0.0 Click
18complement(1557964..1558362) PHAGE_Strept_DT1: putative tail component protein; HMPREF0506_1636; phage(gi9632427) 1e-19 Click
19complement(1558355..1558684) PHAGE_Lactob_phiadh: hypothetical protein phiadhp45; HMPREF0506_1637; phage(gi9633045) 7e-11 Click
20complement(1558674..1559063) PHAGE_Lactob_phiadh: hypothetical protein phiadhp44; HMPREF0506_1638; phage(gi9633044) 6e-18 Click
21complement(1559080..1560438) PHAGE_Lactob_Sha1: HK97 family phage major capsid protein; HMPREF0506_1639; phage(gi418489806) 5e-55 Click
22complement(1560457..1561149) PHAGE_Lactob_phiadh: ClpP-like protease; HMPREF0506_1640; phage(gi9633042) 7e-68 Click
23complement(1561106..1562001) PHAGE_Lactob_phiadh: hypothetical protein phiadhp41; HMPREF0506_1641; phage(gi9633041) 2e-98 Click
24complement(1562002..1562282) PHAGE_Lactob_phiadh: hypothetical protein phiadhp41; HMPREF0506_1642; phage(gi9633041) 4e-18 Click
25complement(1562285..1562497) hypothetical protein; HMPREF0506_1643 0.0 Click
26complement(1562490..1564382) PHAGE_Lactob_phiadh: hypothetical protein phiadhp40; HMPREF0506_1644; phage(gi9633040) 0.0 Click
27complement(1564403..1564567) hypothetical protein; HMPREF0506_1645 0.0 Click
28complement(1564626..1564766) hypothetical protein; HMPREF0506_1646 0.0 Click
29complement(1564763..1565233) PHAGE_Lactob_phiadh: hypothetical protein phiadhp39; HMPREF0506_1647; phage(gi9633039) 1e-55 Click
30complement(1565345..1565824) PHAGE_Lactob_phiadh: hypothetical protein phiadhp38; HMPREF0506_1648; phage(gi9633038) 1e-56 Click
31complement(1566138..1566207) tRNA 0.0 Click
32complement(1566441..1566902) PHAGE_Lactob_phiadh: hypothetical protein phiadhp37; HMPREF0506_1649; phage(gi9633037) 3e-08 Click
33complement(1566956..1567198) hypothetical protein; HMPREF0506_1650 0.0 Click
34complement(1567204..1567512) hypothetical protein; HMPREF0506_1651 0.0 Click
35complement(1567505..1567780) hypothetical protein; HMPREF0506_1652 0.0 Click
36complement(1567770..1568084) PHAGE_Lactob_AQ113: hypothetical protein; HMPREF0506_1653; phage(gi446730280) 9e-27 Click
37complement(1568103..1568324) hypothetical protein; HMPREF0506_1654 0.0 Click
38complement(1568324..1569070) PHAGE_Staphy_phi13: anti-repressor; HMPREF0506_1655; phage(gi29028674) 8e-68 Click
39complement(1569080..1569295) hypothetical protein; HMPREF0506_1656 0.0 Click
40complement(1569285..1569539) hypothetical protein; HMPREF0506_1657 0.0 Click
41complement(1569517..1569807) hypothetical protein; HMPREF0506_1658 0.0 Click
42complement(1569794..1570048) hypothetical protein; HMPREF0506_1659 0.0 Click
43complement(1570041..1570478) PHAGE_Bacill_phBC6A51: hypothetical protein BC1875; HMPREF0506_1660; phage(gi31415769) 7e-22 Click
44complement(1570459..1570737) PHAGE_Bacill_phBC6A51: hypothetical protein BC1874; HMPREF0506_1661; phage(gi31415768) 4e-10 Click
45complement(1570734..1571060) hypothetical protein; HMPREF0506_1662 0.0 Click
46complement(1571061..1571357) hypothetical protein; HMPREF0506_1663 0.0 Click
47complement(1571344..1572201) PHAGE_Lactob_prophage_Lj965: putative replication protein; HMPREF0506_1664; phage(gi41179232) 2e-28 Click
48complement(1572268..1572396) hypothetical protein; HMPREF0506_1665 0.0 Click
49complement(1572528..1572779) PHAGE_Lactob_phiadh: hypothetical protein phiadhp13; HMPREF0506_1666; phage(gi9633013) 5e-07 Click
50complement(1572776..1572907) hypothetical protein; HMPREF0506_1667 0.0 Click
511573027..1573533 PHAGE_Lactob_phiadh: hypothetical protein phiadhp11; HMPREF0506_1668; phage(gi9633011) 3e-18 Click
52complement(1573540..1573662) hypothetical protein; HMPREF0506_1669 0.0 Click
53complement(1573839..1573988) hypothetical protein; HMPREF0506_1670 0.0 Click
54complement(1574106..1574318) hypothetical protein; HMPREF0506_1671 0.0 Click
55complement(1574352..1574576) PHAGE_Lactob_Lv_1: Cro-like repressor; HMPREF0506_1672; phage(gi219563223) 6e-05 Click
561574709..1575335 PHAGE_Lactob_Lv_1: Ci-like repressor; HMPREF0506_1673; phage(gi219563222) 1e-42 Click
571575348..1575728 PHAGE_Staphy_3A: ORF031; HMPREF0506_1674; phage(gi66395619) 9e-17 Click
58complement(1575697..1575912) hypothetical protein; HMPREF0506_1675 0.0 Click
591575969..1576673 hypothetical protein; HMPREF0506_1676 0.0 Click
601576846..1577850 PHAGE_Clostr_phiC2: putative abortive infection bacteriophage resistance protein ORF 37; HMPREF0506_1677; phage(gi134287370) 3e-16 Click
611578058..1579281 PHAGE_Lactob_phiadh: integrase; HMPREF0506_1678; phage(gi9633001) 4e-65 Click
62complement(1579385..1579513) hypothetical protein; HMPREF0506_1679 0.0 Click
63complement(1579612..1579779) PHAGE_Lactob_phiadh: hypothetical protein phiadhp63; HMPREF0506_1680; phage(gi9633063) 4e-14 Click
641580542..1580563 attR    CCTCCACATACGTGGAGAATAC 0.0 Click