Enterococcus faecium C68 .1, whole genome shotgun sequence. [asmbl_id: NC_000000].2940891, GC%: 37.86%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 46 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1660905..660917 attL    AAGTAAAAAACAA 0.0 Click
2complement(661087..662226) PHAGE_Lactoc_bIL309: integrase; PP_00655; phage(gi13095806) 6e-100 Click
3complement(662525..663160) hypothetical protein EFAU004_01464 [Enterococcus faecium Aus0004] gi|383328782|ref|YP_005354666.1|; PP_00656 2e-115 Click
4complement(663273..663908) PHAGE_Brocho_NF5: gp27; PP_00657; phage(gi327197612) 1e-05 Click
5complement(663942..664403) PHAGE_Strept_PH10: hypothetical protein PH10_gp02; PP_00658; phage(gi238821319) 3e-14 Click
6complement(664533..664964) PHAGE_Lactoc_bIL285: Orf3; PP_00659; phage(gi13095683) 1e-07 Click
7complement(664982..665302) PHAGE_Lactoc_bIL312: repressor; PP_00660; phage(gi13095896) 1e-16 Click
8665601..666377 PHAGE_Staphy_phiMR25: putative anti-repressor protein; PP_00661; phage(gi189427129) 8e-75 Click
9666392..666595 XRE family transcriptional regulator [Enterococcus faecium DO] gi|389868011|ref|YP_006375434.1|; PP_00662 4e-29 Click
10666611..666949 PHAGE_Staphy_EW: ORF040; PP_00663; phage(gi66395845) 1e-10 Click
11666936..667115 succinate dehydrogenase cytochrome b558 subunit [Enterococcus faecium DO] gi|389868013|ref|YP_006375436.1|; PP_00664 8e-27 Click
12complement(667158..667607) hypothetical protein HMPREF0351_10831 [Enterococcus faecium DO] gi|389868014|ref|YP_006375437.1|; PP_00665 5e-79 Click
13667715..668413 PHAGE_Entero_phiFL3A: anti-repressor protein; PP_00666; phage(gi281416221) 5e-29 Click
14668406..668534 hypothetical protein HMPREF0351_10833 [Enterococcus faecium DO] gi|389868016|ref|YP_006375439.1|; PP_00667 3e-18 Click
15668591..669268 PHAGE_Entero_phiEf11: conserved hypothetical protein; PP_00668; phage(gi282598737) 3e-61 Click
16669271..670020 PHAGE_Lactob_c5: putative DNA replication protein; PP_00669; phage(gi418488187) 8e-38 Click
17670306..670470 hypothetical protein HMPREF0351_10839 [Enterococcus faecium DO] gi|389868022|ref|YP_006375445.1|; PP_00670 4e-24 Click
18670463..670765 hypothetical protein HMPREF0351_10840 [Enterococcus faecium DO] gi|389868023|ref|YP_006375446.1|; PP_00671 2e-51 Click
19670762..670923 accessory regulator R [Enterococcus faecium DO] gi|389868024|ref|YP_006375447.1|; PP_00672 2e-21 Click
20670926..671225 hypothetical protein HMPREF0351_10842 [Enterococcus faecium DO] gi|389868025|ref|YP_006375448.1|; PP_00673 8e-51 Click
21671225..671581 PHAGE_Lactoc_T: hypothetical protein BK5-Tp56; PP_00674; phage(gi14251179) 9e-18 Click
22671541..671786 hypothetical protein EFAU004_01442 [Enterococcus faecium Aus0004] gi|383328760|ref|YP_005354644.1|; PP_00675 2e-38 Click
23671783..672232 PHAGE_Entero_phiFL2A: YopX superfamily protein; PP_00676; phage(gi281416516) 1e-29 Click
24672225..672638 hypothetical protein EFS1_1538 [Enterococcus faecalis str. Symbioflor 1] gi|428767219|ref|YP_007153330.1|; PP_00677 1e-09 Click
25complement(672631..672810) prophage P2a protein 14 [Lactobacillus plantarum WCFS1] gi|380033144|ref|YP_004890135.1|; PP_00678 3e-17 Click
26673309..673533 hypothetical protein EF62_1378 [Enterococcus faecalis 62] gi|384518050|ref|YP_005705355.1|; PP_00679 3e-23 Click
27673559..674014 PHAGE_Brocho_NF5: gp1; PP_00680; phage(gi327197585) 2e-23 Click
28674169..675305 PHAGE_Brocho_NF5: gp2; PP_00681; phage(gi327197586) 0.0 Click
29675316..676950 PHAGE_Entero_phiEf11: phage portal protein; PP_00682; phage(gi282598717) 0.0 Click
30676904..677134 hypothetical; PP_00683 0.0 Click
31677147..677410 PHAGE_Brocho_NF5: gp56; PP_00684; phage(gi327197641) 2e-13 Click
32677415..678368 PHAGE_Brocho_NF5: gp4; PP_00685; phage(gi327197588) 9e-59 Click
33678452..678667 hypothetical; PP_00686 0.0 Click
34678715..678888 hypothetical; PP_00687 0.0 Click
35679003..679644 PHAGE_Entero_phiEf11: putative phage scaffold protein; PP_00688; phage(gi282598711) 2e-52 Click
36679656..680009 PHAGE_Entero_phiEf11: conserved hypothetical protein; PP_00689; phage(gi282598728) 9e-45 Click
37680034..681041 PHAGE_Entero_phiEf11: putative head protein; PP_00690; phage(gi282598750) 3e-163 Click
38681052..681258 PHAGE_Lister_B025: gp6; PP_00691; phage(gi157325223) 3e-05 Click
39681633..681959 PHAGE_Brocho_NF5: gp8; PP_00692; phage(gi327197593) 1e-14 Click
40681956..682327 PHAGE_Brocho_NF5: gp9; PP_00693; phage(gi327197594) 1e-15 Click
41682324..682716 PHAGE_Brocho_NF5: gp10; PP_00694; phage(gi327197595) 2e-45 Click
42682727..683239 PHAGE_Brocho_NF5: gp11; PP_00695; phage(gi327197596) 3e-61 Click
43683285..683653 PHAGE_Brocho_NF5: gp12; PP_00696; phage(gi327197597) 1e-19 Click
44683707..683994 PHAGE_Brocho_NF5: gp13; PP_00697; phage(gi327197598) 2e-16 Click
45684011..687130 PHAGE_Lactoc_Tuc2009: hypothetical protein Tuc2009_46; PP_00698; phage(gi13487847) 0.0 Click
46687142..687930 PHAGE_Brocho_NF5: gp15; PP_00699; phage(gi327197600) 3e-63 Click
47687927..690758 PHAGE_Brocho_NF5: gp16; PP_00700; phage(gi327197601) 0.0 Click
48698470..698482 attR    AAGTAAAAAACAA 0.0 Click

Region 2, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11541111..1541137 attL    TCTATTCTTCTTCTTCCGCCATGAATG 0.0 Click
2complement(1542206..1542541) PHAGE_Entero_EFRM31: head-tail adaptor protein; PP_01555; phage(gi327198118) 2e-14 Click
3complement(1542528..1542812) PHAGE_Entero_EFRM31: head-tail joining protein; PP_01556; phage(gi327198117) 8e-09 Click
4complement(1542868..1544391) PHAGE_Entero_EFRM31: major capsid protein; PP_01557; phage(gi327198115) 8e-50 Click
5complement(1544384..1545559) PHAGE_Entero_EFRM31: portal protein; PP_01558; phage(gi327198113) 9e-56 Click
6complement(1545714..1547408) PHAGE_Lactob_LF1: bacteriophage terminase large subunit; PP_01559; phage(gi418489385) 9e-124 Click
7complement(1547405..1547878) PHAGE_Burkho_phiE125: putative terminase (small subunit); PP_01560; phage(gi17975162) 4e-13 Click
8complement(1547947..1548102) hypothetical protein HMPREF0351_12132 [Enterococcus faecium DO] gi|389869315|ref|YP_006376738.1|; PP_01561 1e-21 Click
9complement(1548427..1548549) hypothetical; PP_01562 0.0 Click
10complement(1548620..1548835) group 1 glycosyl transferase [Enterococcus faecium DO] gi|389869317|ref|YP_006376740.1|; PP_01563 2e-35 Click
11complement(1548838..1549245) hypothetical protein HMPREF0351_12135 [Enterococcus faecium DO] gi|389869318|ref|YP_006376741.1|; PP_01564 1e-72 Click
12complement(1549511..1550986) PHAGE_Staphy_2638A: ORF003; PP_01565; phage(gi66395453) 5e-68 Click
13complement(1550976..1551824) PHAGE_Lactoc_bIL310: hypothetical protein bIL310p24; PP_01566; phage(gi13095885) 1e-22 Click
14complement(1551861..1552223) hypothetical protein HMPREF0351_12138 [Enterococcus faecium DO] gi|389869321|ref|YP_006376744.1|; PP_01567 7e-63 Click
15complement(1552224..1552382) hypothetical protein HMPREF0351_12139 [Enterococcus faecium DO] gi|389869322|ref|YP_006376745.1|; PP_01568 6e-22 Click
16complement(1552523..1552927) bacteriophage antirepressor protein [Enterococcus faecium DO] gi|389869323|ref|YP_006376746.1|; PP_01569 6e-70 Click
17complement(1552908..1553147) PHAGE_Haemop_Aaphi23: putative antirepressor protein Ant; PP_01570; phage(gi31544021) 2e-06 Click
18complement(1553144..1553455) hypothetical protein HMPREF0351_12142 [Enterococcus faecium DO] gi|389869325|ref|YP_006376748.1|; PP_01571 9e-50 Click
19complement(1553499..1553792) hypothetical protein HMPREF0351_12143 [Enterococcus faecium DO] gi|389869326|ref|YP_006376749.1|; PP_01572 7e-49 Click
201553986..1554633 PHAGE_Lactoc_bIL311: repressor; PP_01573; phage(gi13095660) 8e-12 Click
211554694..1555428 PROPHAGE_Oceano_HTE831: integrase; PP_01574; phage(gi23097608) 2e-40 Click
221555920..1555946 attR    TCTATTCTTCTTCTTCCGCCATGAATG 0.0 Click

Region 3, total : 40 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12253887..2253898 attL    CTTCTTCATCTG 0.0 Click
2complement(2259204..2261963) PHAGE_Bacill_phBC6A52: endopeptidase; PP_02286; phage(gi31415861) 7e-48 Click
3complement(2261960..2262679) PHAGE_Clostr_phiCP26F: putative phage tail component; PP_02287; phage(gi422933966) 9e-07 Click
4complement(2262676..2265057) PHAGE_Bacill_phBC6A52: hypothetical protein BC2594; PP_02288; phage(gi31415859) 4e-61 Click
5complement(2265249..2265713) PHAGE_Bacill_phBC6A52: hypothetical protein BC2593; PP_02289; phage(gi31415858) 3e-17 Click
6complement(2265713..2266339) PHAGE_Bacill_phBC6A52: hypothetical protein BC2592; PP_02290; phage(gi31415857) 8e-19 Click
7complement(2266345..2266710) PHAGE_Bacill_phBC6A52: hypothetical protein BC2591; PP_02291; phage(gi31415856) 4e-20 Click
8complement(2266700..2267038) PHAGE_Bacill_phBC6A52: hypothetical protein BC2590; PP_02292; phage(gi31415855) 1e-24 Click
9complement(2267028..2267354) PHAGE_Bacill_phBC6A52: hypothetical protein BC2589; PP_02293; phage(gi31415854) 5e-13 Click
10complement(2267335..2267613) PHAGE_Bacill_phBC6A52: hypothetical protein BC2588; PP_02294; phage(gi31415853) 4e-22 Click
11complement(2267615..2268979) PHAGE_Bacill_phBC6A52: prohead protease; PP_02295; phage(gi31415852) 2e-124 Click
12complement(2268992..2269561) PHAGE_Clostr_phi3626: putative prohead protease; PP_02296; phage(gi20065968) 1e-37 Click
13complement(2269577..2270761) PHAGE_Bacill_phBC6A52: Portal protein; PP_02297; phage(gi31415850) 2e-105 Click
14complement(2270783..2272510) PHAGE_Bacill_phBC6A52: Terminase large subunit; PP_02298; phage(gi31415848) 0.0 Click
15complement(2272507..2272959) PHAGE_Bacill_phBC6A52: Terminase small subunit; PP_02299; phage(gi31415847) 9e-30 Click
16complement(2273070..2273450) PHAGE_Bacill_phBC6A52: endonuclease; PP_02300; phage(gi31415846) 5e-48 Click
17complement(2273447..2273833) PHAGE_Bacill_phBC6A52: hypothetical protein BC2580; PP_02301; phage(gi31415845) 6e-10 Click
18complement(2273814..2274161) hypothetical protein EF2013 [Enterococcus faecalis V583] gi|29376528|ref|NP_815682.1|; PP_02302 2e-19 Click
19complement(2274222..2274518) PHAGE_Lactob_Lj928: putative major head protein; PP_02303; phage(gi41179318) 7e-05 Click
20complement(2274836..2275312) PHAGE_Bacill_WBeta: conserved phage protein; PP_02304; phage(gi85701424) 9e-31 Click
212275658..2276086 hypothetical protein GY4MC1_0592 [Geobacillus sp. Y4.1MC1] gi|312109715|ref|YP_003988031.1|; PP_02305 4e-20 Click
22complement(2276193..2276381) hypothetical; PP_02306 0.0 Click
23complement(2276392..2276580) hypothetical; PP_02307 0.0 Click
24complement(2276577..2277152) PHAGE_Lister_B054: gp58; PP_02308; phage(gi157325342) 2e-16 Click
25complement(2277154..2277609) PHAGE_Lactoc_bIL286: Orf19; PP_02309; phage(gi13095762) 3e-18 Click
26complement(2277752..2277994) PHAGE_Entero_phiEf11: conserved hypothetical protein; PP_02310; phage(gi282598762) 4e-05 Click
27complement(2277991..2278839) PHAGE_Bacill_WBeta: putative DnaC protein; PP_02311; phage(gi85701414) 8e-24 Click
28complement(2278839..2279615) PHAGE_Lister_A118: gp49; PP_02312; phage(gi16798836) 9e-35 Click
29complement(2279631..2280446) PHAGE_Strept_3: hypothetical protein SpyM3_1132; PP_02313; phage(gi28876302) 9e-65 Click
30complement(2280409..2281431) PHAGE_Strept_1: hypothetical protein EJ-1p21; PP_02314; phage(gi39653695) 4e-62 Click
31complement(2281434..2281628) hypothetical; PP_02315 0.0 Click
32complement(2281638..2281862) PHAGE_Entero_phiFL2A: hypothetical protein; PP_02316; phage(gi281416504) 2e-16 Click
33complement(2281862..2282191) hypothetical protein EF2034 [Enterococcus faecalis V583] gi|29376546|ref|NP_815700.1|; PP_02317 3e-13 Click
34complement(2282233..2282409) hypothetical protein M7W_2072 [Enterococcus faecium NRRL B-2354] gi|447913327|ref|YP_007394739.1|; PP_02318 2e-14 Click
35complement(2282458..2282718) hypothetical protein EF2846 [Enterococcus faecalis V583] gi|29377314|ref|NP_816468.1|; PP_02319 1e-27 Click
36complement(2282732..2282926) PHAGE_Strept_4: hypothetical protein SpyM3_1262; PP_02320; phage(gi28876376) 7e-10 Click
372283223..2283642 PHAGE_Bacill_BCJA1c: repressor; PP_02321; phage(gi56694874) 2e-40 Click
382283659..2284081 PHAGE_Geobac_GBSV1: hypothetical protein GPGV1_gp47; PP_02322; phage(gi115334657) 8e-24 Click
392284116..2284316 PHAGE_Entero_phiEf11: conserved hypothetical protein; PP_02323; phage(gi282598725) 2e-29 Click
402284402..2285289 PHAGE_Staphy_StB27: hypothetical protein; PP_02324; phage(gi431809679) 2e-06 Click
412285129..2285140 attR    CTTCTTCATCTG 0.0 Click
422285313..2286512 PROPHAGE_Oceano_HTE831: integrase; PP_02325; phage(gi23097608) 4e-78 Click

Region 4, total : 49 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12457313..2457324 attL    TCTTTTTTTGTT 0.0 Click
2complement(2471390..2473681) PHAGE_Lister_2389: Gp14 protein; PP_02513; phage(gi17488517) 5e-68 Click
3complement(2473691..2474428) PHAGE_Lister_2389: Gp13 protein; PP_02514; phage(gi17488516) 3e-18 Click
4complement(2474479..2477910) PHAGE_Lister_2389: tail tape measure protein; PP_02515; phage(gi17488515) 2e-88 Click
5complement(2477927..2478067) hypothetical protein HMPREF0351_10867 [Enterococcus faecium DO] gi|389868050|ref|YP_006375473.1|; PP_02516 2e-19 Click
6complement(2478112..2478474) PHAGE_Lister_2389: Gp11 protein; PP_02517; phage(gi17488514) 2e-06 Click
7complement(2478494..2479102) PHAGE_Lister_2389: major tail protein a; PP_02518; phage(gi17488513) 5e-37 Click
8complement(2479114..2479518) PHAGE_Lister_2389: Gp9 protein; PP_02519; phage(gi17488512) 1e-08 Click
9complement(2479511..2479912) PHAGE_Lister_2389: Gp8 protein; PP_02520; phage(gi17488511) 3e-10 Click
10complement(2479902..2480255) PHAGE_Lister_2389: Gp7 protein; PP_02521; phage(gi17488510) 1e-09 Click
11complement(2480245..2480556) PHAGE_Lister_2389: Gp6 protein; PP_02522; phage(gi17488509) 3e-08 Click
12complement(2480553..2481428) PHAGE_Entero_phiFL1A: hypothetical protein; PP_02523; phage(gi281416374) 2e-131 Click
13complement(2481438..2482598) PHAGE_Lister_2389: major capsid protein a; PP_02524; phage(gi17488508) 1e-95 Click
14complement(2482598..2483284) PHAGE_Staphy_SMSAP5: protease; PP_02525; phage(gi422935811) 2e-34 Click
15complement(2483247..2484425) PHAGE_Lister_2389: hypothetical protein 2389gp03; PP_02526; phage(gi17488506) 8e-60 Click
16complement(2484445..2486139) PHAGE_Lister_2389: terminase large subunit; PP_02527; phage(gi17488505) 7e-106 Click
17complement(2486117..2486431) PHAGE_Clostr_phiCD6356: putative terminase small subunit; PP_02528; phage(gi326536848) 2e-09 Click
18complement(2486534..2486815) PHAGE_Lister_2389: Gp55 protein; PP_02529; phage(gi17488560) 7e-11 Click
19complement(2487190..2487357) thymidylate synthase [Enterococcus faecium DO] gi|389868035|ref|YP_006375458.1|; PP_02530 9e-26 Click
20complement(2487553..2487717) hypothetical protein HMPREF0351_10851 [Enterococcus faecium DO] gi|389868034|ref|YP_006375457.1|; PP_02531 3e-23 Click
21complement(2487920..2488339) PHAGE_Temper_1: hypothetical protein phiNIH1.1_19; PP_02532; phage(gi16271795) 1e-13 Click
22complement(2488336..2488509) hypothetical; PP_02533 0.0 Click
23complement(2488506..2488817) PHAGE_Entero_phiFL2A: recombinase; PP_02534; phage(gi281416510) 3e-29 Click
24complement(2488817..2489107) PHAGE_Entero_phiFL3A: hypothetical protein; PP_02535; phage(gi281416234) 4e-17 Click
25complement(2489101..2489406) hypothetical protein EFAU004_02397 [Enterococcus faecium Aus0004] gi|383329714|ref|YP_005355598.1|; PP_02536 3e-50 Click
26complement(2489409..2489570) hypothetical protein M7W_2064 [Enterococcus faecium NRRL B-2354] gi|447913320|ref|YP_007394732.1|; PP_02537 2e-20 Click
27complement(2489567..2489869) hypothetical protein HMPREF0351_10840 [Enterococcus faecium DO] gi|389868023|ref|YP_006375446.1|; PP_02538 4e-49 Click
28complement(2489862..2490026) hypothetical protein HMPREF0351_10839 [Enterococcus faecium DO] gi|389868022|ref|YP_006375445.1|; PP_02539 5e-23 Click
29complement(2490031..2490300) hypothetical protein EFAU004_02398 [Enterococcus faecium Aus0004] gi|383329715|ref|YP_005355599.1|; PP_02540 5e-39 Click
30complement(2490312..2491163) PHAGE_Brocho_BL3: gp46; PP_02541; phage(gi327409438) 9e-55 Click
31complement(2491272..2491673) PHAGE_Pectob_phiTE: HNH endonuclease; PP_02542; phage(gi448244938) 4e-14 Click
32complement(2491795..2491929) hypothetical; PP_02544 0.0 Click
332491993..2492130 hypothetical; PP_02543 0.0 Click
34complement(2492177..2492479) hypothetical protein HMPREF0351_10834 [Enterococcus faecium DO] gi|389868017|ref|YP_006375440.1|; PP_02545 8e-41 Click
35complement(2492516..2492662) hypothetical protein EFAU004_02403 [Enterococcus faecium Aus0004] gi|383329720|ref|YP_005355604.1|; PP_02546 1e-13 Click
36complement(2492631..2492804) hypothetical protein EFAU004_02404 [Enterococcus faecium Aus0004] gi|383329721|ref|YP_005355605.1|; PP_02547 2e-23 Click
37complement(2492801..2492989) PHAGE_Entero_phiFL3A: hypothetical protein; PP_02548; phage(gi281416222) 2e-11 Click
38complement(2493010..2493294) hypothetical protein EFAU004_02406 [Enterococcus faecium Aus0004] gi|383329723|ref|YP_005355607.1|; PP_02549 5e-46 Click
39complement(2493342..2493641) PHAGE_Lactoc_bIL312: excisionase; PP_02550; phage(gi13095898) 6e-09 Click
40complement(2493656..2493859) XRE family transcriptional regulator [Enterococcus faecium DO] gi|389868011|ref|YP_006375434.1|; PP_02551 4e-29 Click
41complement(2493874..2494620) PHAGE_Staphy_phiMR25: putative anti-repressor protein; PP_02552; phage(gi189427129) 3e-52 Click
422494696..2494947 hypothetical; PP_02553 0.0 Click
43complement(2494928..2495083) hypothetical; PP_02554 0.0 Click
44complement(2495319..2495477) hypothetical protein EFD32_2292 [Enterococcus faecalis D32] gi|397700863|ref|YP_006538651.1|; PP_02555 1e-08 Click
452495770..2496090 PHAGE_Strept_6: putative repressor; PP_02556; phage(gi28876485) 3e-23 Click
462496108..2496530 PHAGE_Lactoc_bIL285: Orf3; PP_02557; phage(gi13095683) 5e-08 Click
472496797..2496922 hypothetical; PP_02558 0.0 Click
482496809..2496820 attR    TCTTTTTTTGTT 0.0 Click
492497030..2498169 PHAGE_Entero_phiEf11: phage integrase protein; PP_02559; phage(gi282598730) 1e-74 Click
50complement(2498258..2499883) PHAGE_Halocy_JM_2012: chaperonin GroEL; PP_02560; phage(gi389060206) 2e-68 Click
51complement(2499934..2500218) PHAGE_Bacill_36: GroES; PP_02561; phage(gi156564025) 1e-13 Click