Lactobacillus rhamnosus LMS2-1 , whole genome shotgun [asmbl_id: NC_000000].3109803, GC%: 46.49%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 28 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1389001..389012 attL    TCTCAAAAAAGT 0.0 Click
2398601..399755 PHAGE_Microm_MpV1: hypothetical protein; HMPREF0539_0408; phage(gi313768442) 5e-12 Click
3399864..400817 PHAGE_Mycoba_Omega: gp105; HMPREF0539_0409; phage(gi29566839) 1e-06 Click
4complement(400985..401710) family S9 peptidase; HMPREF0539_0410 0.0 Click
5complement(401714..401914) conserved hypothetical protein; HMPREF0539_0411 0.0 Click
6402115..403035 PHAGE_Cronob_vB_CsaP_GAP52: putative ribose-phosphate pyrophosphokinase; HMPREF0539_0412; phage(gi414087562) 1e-20 Click
7complement(403001..403171) hypothetical protein; HMPREF0539_0413 0.0 Click
8403241..403313 tRNA 0.0 Click
9403563..403811 integral membrane protein; HMPREF0539_0414 0.0 Click
10403827..403967 conserved hypothetical protein; HMPREF0539_0415 0.0 Click
11complement(404053..404190) hypothetical protein; HMPREF0539_0416 0.0 Click
12complement(404484..404825) PHAGE_Entero_EFRM31: head-tail adaptor protein; HMPREF0539_0417; phage(gi327198118) 3e-09 Click
13complement(404809..405099) PHAGE_Entero_EFRM31: head-tail joining protein; HMPREF0539_0418; phage(gi327198117) 6e-06 Click
14complement(405161..406702) PHAGE_Entero_EFRM31: major capsid protein; HMPREF0539_0419; phage(gi327198115) 5e-45 Click
15complement(406689..407873) PHAGE_Entero_EFRM31: portal protein; HMPREF0539_0420; phage(gi327198113) 3e-50 Click
16complement(407878..408057) conserved hypothetical protein; HMPREF0539_0421 0.0 Click
17complement(408023..409726) PHAGE_Lactob_LF1: bacteriophage terminase large subunit; HMPREF0539_0422; phage(gi418489385) 3e-119 Click
18complement(409723..410193) PHAGE_Staphy_phiPV83: phi PVL ORF 1 homologue; HMPREF0539_0423; phage(gi9635714) 1e-18 Click
19complement(410318..410692) PHAGE_Staphy_phiPV83: phi PVL ORF 63 homologue; HMPREF0539_0424; phage(gi9635713) 6e-15 Click
20complement(411479..412870) PHAGE_Entero_EFRM31: DNA primase; HMPREF0539_0425; phage(gi327198106) 1e-40 Click
21complement(412863..413699) PHAGE_Lactoc_bIL310: hypothetical protein bIL310p24; HMPREF0539_0426; phage(gi13095885) 3e-21 Click
22complement(413674..413862) conserved hypothetical protein; HMPREF0539_0427 0.0 Click
23complement(413859..414164) hypothetical protein; HMPREF0539_0428 0.0 Click
24complement(414179..414376) conserved hypothetical protein; HMPREF0539_0429 0.0 Click
25complement(414354..414488) conserved hypothetical protein; HMPREF0539_0430 0.0 Click
26complement(414481..414876) prophage Lp4 protein 12; HMPREF0539_0431 0.0 Click
27complement(414942..415223) hypothetical protein; HMPREF0539_0432 0.0 Click
28complement(415242..415490) PHAGE_Lactoc_bIL311: ps3 protein 14-like transcriptional regulator; HMPREF0539_0433; phage(gi19343481) 1e-10 Click
29415569..416180 PHAGE_Lactoc_bIL311: repressor; HMPREF0539_0434; phage(gi13095660) 2e-12 Click
30416139..416150 attR    TCTCAAAAAAGT 0.0 Click
31416298..417455 PROPHAGE_Oceano_HTE831: integrase; HMPREF0539_0435; phage(gi23097608) 9e-56 Click

Region 2, total : 58 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1847361..847373 attL    CCGGCGCGGTTAG 0.0 Click
2849726..851225 PHAGE_Megavi_lba: asparaginyl-tRNA synthetase; HMPREF0539_0884; phage(gi448825735) 8e-10 Click
3851497..851585 tRNA 0.0 Click
4complement(851707..852837) PHAGE_Lactob_Lrm1: integrase; HMPREF0539_0885; phage(gi195661224) 0.0 Click
5complement(852942..853205) PHAGE_Lactob_Lrm1: hypothetical protein Lrm1_gp40; HMPREF0539_0886; phage(gi195661240) 4e-12 Click
6853279..853587 conserved hypothetical protein; HMPREF0539_0887 0.0 Click
7complement(853655..853762) conserved hypothetical protein; HMPREF0539_0888 0.0 Click
8complement(853884..854510) conserved hypothetical protein; HMPREF0539_0889 0.0 Click
9complement(854563..855345) PHAGE_Lactob_phiAT3: putative repressor protein; HMPREF0539_0890; phage(gi48697282) 3e-95 Click
10855506..855760 PHAGE_Staphy_2638A: ORF052; HMPREF0539_0891; phage(gi66395489) 1e-12 Click
11855763..856524 PHAGE_Lactob_phiAT3: putative antirepressor protein; HMPREF0539_0892; phage(gi48697283) 2e-129 Click
12complement(856778..857368) hypothetical protein; HMPREF0539_0893 0.0 Click
13857433..857789 PHAGE_Lactob_Lrm1: hypothetical protein Lrm1_gp30; HMPREF0539_0894; phage(gi195661230) 3e-48 Click
14857874..858026 PHAGE_Lactob_Lrm1: hypothetical protein Lrm1_gp31; HMPREF0539_0895; phage(gi195661231) 5e-21 Click
15858028..858234 PHAGE_Lactob_Lrm1: hypothetical protein Lrm1_gp32; HMPREF0539_0896; phage(gi195661232) 2e-30 Click
16858253..858738 PHAGE_Lactob_Lrm1: hypothetical protein Lrm1_gp33; HMPREF0539_0897; phage(gi195661233) 9e-84 Click
17858739..859446 PHAGE_Lactob_Lrm1: NTP-binding protein; HMPREF0539_0898; phage(gi195661234) 7e-131 Click
18859450..860007 PHAGE_Lactob_Lrm1: SSB protein; HMPREF0539_0899; phage(gi195661235) 8e-105 Click
19859988..860857 PHAGE_Lactob_Nu: putative replication protein; HMPREF0539_0900; phage(gi78000008) 1e-78 Click
20860899..862116 PHAGE_Lactob_Nu: putative DnaB-like helicase; HMPREF0539_0901; phage(gi78000024) 0.0 Click
21862118..862462 PHAGE_Lactob_Nu: hypothetical protein; HMPREF0539_0902; phage(gi78000009) 8e-60 Click
22862504..862917 PHAGE_Lactob_Nu: putative Holliday junction resolvase; HMPREF0539_0903; phage(gi78000012) 9e-76 Click
23862895..863266 PHAGE_Lactob_A2: hypothetical protein A2p43; HMPREF0539_0904; phage(gi22296562) 7e-55 Click
24863278..864129 PHAGE_Lactob_Nu: putative methylase; HMPREF0539_0905; phage(gi78000013) 6e-109 Click
25864122..864838 PHAGE_Lactob_Nu: putative methylase; HMPREF0539_0906; phage(gi78000014) 3e-129 Click
26864825..865748 PHAGE_Bacill_BCJA1c: integrase; HMPREF0539_0907; phage(gi56694872) 1e-45 Click
27865759..866367 hypothetical protein; HMPREF0539_0908 0.0 Click
28866380..866505 PHAGE_Lactob_Lrm1: hypothetical protein Lrm1_gp42; HMPREF0539_0909; phage(gi195661242) 8e-14 Click
29866502..867017 PHAGE_Lactob_Lrm1: hypothetical protein Lrm1_gp44; HMPREF0539_0910; phage(gi195661244) 3e-33 Click
30867007..867297 hypothetical protein; HMPREF0539_0911 0.0 Click
31867287..867655 PHAGE_Lactob_Lrm1: hypothetical protein Lrm1_gp47; HMPREF0539_0912; phage(gi195661247) 1e-22 Click
32867652..867840 PHAGE_Lactob_Nu: hypothetical protein; HMPREF0539_0913; phage(gi78000016) 5e-30 Click
33867961..868188 PHAGE_Lactob_Nu: putative transcription regulator; HMPREF0539_0914; phage(gi78000017) 5e-28 Click
34868254..868697 PHAGE_Lactob_Lrm1: hypothetical protein Lrm1_gp49; HMPREF0539_0915; phage(gi195661249) 4e-52 Click
35869031..869696 conserved hypothetical protein; HMPREF0539_0916 0.0 Click
36870339..871487 PHAGE_Lactob_Lrm1: hypothetical protein Lrm1_gp50; HMPREF0539_0917; phage(gi195661250) 0.0 Click
37871480..871806 PHAGE_Lactob_Lrm1: hypothetical protein Lrm1_gp52; HMPREF0539_0918; phage(gi195661252) 3e-36 Click
38871808..871972 PHAGE_Lactob_Nu: hypothetical protein; HMPREF0539_0919; phage(gi78000022) 1e-22 Click
39872009..872818 PHAGE_Lactob_Lrm1: small terminase subunit; HMPREF0539_0920; phage(gi195661254) 2e-151 Click
40873014..873469 PHAGE_Lactob_Lrm1: terminase subunit; HMPREF0539_0921; phage(gi195661201) 2e-81 Click
41873512..875203 PHAGE_Lactob_Lrm1: large terminase subunit; HMPREF0539_0922; phage(gi195661202) 0.0 Click
42875215..875406 PHAGE_Lactob_Lrm1: hypothetical protein Lrm1_gp03; HMPREF0539_0923; phage(gi195661203) 1e-21 Click
43875412..876665 PHAGE_Lactob_Lrm1: portal protein; HMPREF0539_0924; phage(gi195661204) 0.0 Click
44876652..877248 PHAGE_Lactob_Lrm1: head maturation protease; HMPREF0539_0925; phage(gi195661205) 5e-105 Click
45877290..878492 PHAGE_Lactob_Lrm1: major head protein; HMPREF0539_0926; phage(gi195661206) 0.0 Click
46878504..878749 PHAGE_Pseudo_phiIBB_PF7A: minor capsid protein 10B; HMPREF0539_0927; phage(gi326536940) 5e-08 Click
47878760..879119 PHAGE_Lactob_Lrm1: DNA packaging protein; HMPREF0539_0928; phage(gi195661207) 7e-45 Click
48879124..879438 PHAGE_Lactob_Lrm1: head-tail joining protein; HMPREF0539_0929; phage(gi195661208) 1e-54 Click
49879438..879824 PHAGE_Lactob_Lrm1: head-tail joining protein; HMPREF0539_0930; phage(gi195661209) 6e-68 Click
50879824..880210 PHAGE_Lactob_Lrm1: head-tail joining protein; HMPREF0539_0931; phage(gi195661210) 6e-70 Click
51880244..880852 PHAGE_Lactob_Lrm1: major tail protein; HMPREF0539_0932; phage(gi195661211) 4e-107 Click
52880915..881094 PHAGE_Erwini_phiEa104: hypothetical protein, contains bacterial Ig-like and invasin/intimin cell-adhesion domains; HMPREF0539_0933; phage(gi327198425) 2e-13 Click
53881168..881581 PHAGE_Lactob_Lrm1: hypothetical protein Lrm1_gp12; HMPREF0539_0934; phage(gi195661212) 2e-72 Click
54881704..886557 PHAGE_Lactob_Lrm1: tape measure protein; HMPREF0539_0935; phage(gi195661213) 0.0 Click
55886558..888471 PHAGE_Lactob_Lrm1: tail component; HMPREF0539_0936; phage(gi195661214) 4e-147 Click
56888472..890997 PHAGE_Lactob_Lrm1: host specificity protein; HMPREF0539_0937; phage(gi195661215) 2e-148 Click
57891013..891342 PHAGE_Lactob_Nu: hypothetical protein; HMPREF0539_0938; phage(gi77999996) 4e-51 Click
58891339..891482 PHAGE_Lactob_Nu: hypothetical protein; HMPREF0539_0939; phage(gi77999997) 5e-20 Click
59891448..891813 PHAGE_Lactob_A2: hypothetical protein A2p16; HMPREF0539_0940; phage(gi22296538) 3e-64 Click
60891819..892262 PHAGE_Lactob_A2: holin; HMPREF0539_0941; phage(gi22296539) 5e-59 Click
61892262..893383 PHAGE_Lactob_A2: lysin; HMPREF0539_0942; phage(gi22296540) 6e-83 Click
62905107..905119 attR    CCGGCGCGGTTAG 0.0 Click

Region 3, total : 31 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11530140..1530219 attL    TTTGTCATTTGGTTCGAAAACGCCAATCACATTCACCACCATCAGGCTTACACTATCCCTGACTCGCTTGGGTTTGGTAC 0.0 Click
2complement(1530402..1531571) PROPHAGE_Oceano_HTE831: integrase; HMPREF0539_1568; phage(gi23097608) 3e-47 Click
3complement(1531614..1531934) XRE family transcriptional regulator; HMPREF0539_1569 0.0 Click
41532086..1532208 conserved hypothetical protein; HMPREF0539_1570 0.0 Click
5complement(1532221..1532505) hypothetical protein; HMPREF0539_1571 0.0 Click
6complement(1532922..1534037) PHAGE_Lactob_Nu: putative lysin; HMPREF0539_1572; phage(gi78000035) 1e-82 Click
7complement(1534082..1534414) PHAGE_Lactob_Nu: putative holin; HMPREF0539_1573; phage(gi78000034) 2e-34 Click
8complement(1534427..1534660) PHAGE_Lactob_Sha1: phage-related holin; HMPREF0539_1574; phage(gi418489822) 5e-06 Click
9complement(1534685..1534816) conserved hypothetical protein; HMPREF0539_1575 0.0 Click
10complement(1534809..1535099) PHAGE_Lactob_Nu: hypothetical protein; HMPREF0539_1576; phage(gi77999996) 1e-34 Click
11complement(1535117..1538113) PHAGE_Lactob_Nu: putative host specificity protein; HMPREF0539_1577; phage(gi77999995) 0.0 Click
12complement(1538114..1540192) PHAGE_Lactob_Nu: putative tail component; HMPREF0539_1578; phage(gi78000032) 0.0 Click
13complement(1540193..1544398) PHAGE_Lactob_Nu: putative tape measure protein; HMPREF0539_1579; phage(gi78000025) 0.0 Click
14complement(1544424..1544546) hypothetical protein; HMPREF0539_1580 0.0 Click
15complement(1544635..1545099) PHAGE_Lactob_Nu: putative tail component; HMPREF0539_1581; phage(gi78000031) 2e-55 Click
16complement(1545142..1545798) PHAGE_Lactob_Nu: major tail protein; HMPREF0539_1582; phage(gi78000030) 6e-99 Click
17complement(1545799..1546179) PHAGE_Lactob_Nu: putative tail component; HMPREF0539_1583; phage(gi77999994) 7e-61 Click
18complement(1546176..1546595) PHAGE_Lactob_Nu: putative head-tail joining protein; HMPREF0539_1584; phage(gi77999993) 5e-65 Click
19complement(1546598..1546942) PHAGE_Lactob_Nu: putative head-tail joining protein; HMPREF0539_1585; phage(gi77999992) 3e-48 Click
20complement(1546932..1547222) hypothetical protein; HMPREF0539_1586 0.0 Click
21complement(1547294..1549222) PHAGE_Lactob_1: protease-scaffold-major head protein; HMPREF0539_1587; phage(gi219563201) 1e-70 Click
22complement(1549222..1550322) PHAGE_Lactoc_bIL309: portal protein; HMPREF0539_1588; phage(gi13095846) 1e-80 Click
23complement(1550578..1552479) PHAGE_Lactob_1: terminase large subunit; HMPREF0539_1589; phage(gi219563199) 1e-156 Click
24complement(1552479..1552958) PHAGE_Lactob_1: terminase small subunit; HMPREF0539_1590; phage(gi219563198) 5e-21 Click
25complement(1553001..1553150) hypothetical protein; HMPREF0539_1591 0.0 Click
26complement(1553417..1554514) PHAGE_Lactob_Nu: putative methylase; HMPREF0539_1592; phage(gi78000014) 2e-42 Click
27complement(1554496..1555011) hypothetical protein; HMPREF0539_1593 0.0 Click
28complement(1555188..1555718) PHAGE_Lactob_1: HNH nuclease; HMPREF0539_1594; phage(gi219563244) 8e-32 Click
29complement(1555702..1556115) PHAGE_Lactob_AQ113: single-strand DNA binding protein; HMPREF0539_1595; phage(gi446730277) 4e-16 Click
30complement(1556108..1556875) hypothetical protein; HMPREF0539_1596 0.0 Click
31complement(1556875..1557093) hypothetical protein; HMPREF0539_1597 0.0 Click
32complement(1557153..1557755) PHAGE_Acanth_mimivirus: uncharacterized HNH endonuclease; HMPREF0539_1598; phage(gi311977621) 1e-14 Click
331563716..1563795 attR    TTTGTCATTTGGTTCGAAAACGCCAATCACATTCACCACCATCAGGCTTACACTATCCCTGACTCGCTTGGGTTTGGTAC 0.0 Click

Region 4, total : 13 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3059805..3060839) PHAGE_Lactoc_949: putative ribonucleotide diphosphate reductase alpha subunit; HMPREF0539_3096; phage(gi327197952) 2e-07 Click
23061026..3061610 peptidylprolyl isomerase; HMPREF0539_3097 0.0 Click
33061674..3062057 RNA binding protein; HMPREF0539_3098 0.0 Click
43063032..3063529 PROPHAGE_Xantho_33913: IS1480 transposase; HMPREF0539_3099; phage(gi21231089) 6e-42 Click
5complement(3063551..3063835) hypothetical cytosolic protein; HMPREF0539_3100 0.0 Click
6complement(3063841..3064413) PHAGE_Entero_P1: Cin; HMPREF0539_3101; phage(gi46401653) 9e-13 Click
7complement(3064414..3064653) PHAGE_Gifsy_1: bacteriophage side tail fiber protein; Lambda gpSft (gpN) homolog; HMPREF0539_3102; phage(gi169257214) 2e-07 Click
8complement(3064707..3064879) PHAGE_Lactob_phiAT3: putative transposase A; HMPREF0539_3103; phage(gi48697273) 6e-26 Click
93064880..3065340 PHAGE_Spirop_R8A2B: putative transposase; HMPREF0539_3104; phage(gi9626114) 6e-18 Click
10complement(3065400..3065472) tRNA 0.0 Click
11complement(3065504..3065580) tRNA 0.0 Click
123065597..3065753 hypothetical protein; HMPREF0539_3105 0.0 Click
13complement(3066445..3067362) plasmid replication initiation protein; HMPREF0539_3106 0.0 Click
14complement(3067430..3067502) tRNA 0.0 Click
15complement(3067505..3067577) tRNA 0.0 Click
163067866..3068036 PHAGE_Staphy_phiPV83: transposase; HMPREF0539_3107; phage(gi9635740) 1e-05 Click
173068037..3068523 PHAGE_Bacill_WBeta: putative mannose 6-phosphate isomerase; HMPREF0539_3108; phage(gi85701420) 1e-27 Click

Region 5, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13076674..3076686 attL    GGCTCAACGATCC 0.0 Click
23083864..3084227 PROPHAGE_Xantho_33913: IS1480 transposase; HMPREF0539_3127; phage(gi21231089) 3e-13 Click
33084291..3084539 manganese transport protein mntH (Hop-inducible cation transporter); HMPREF0539_3128 0.0 Click
43084696..3085604 PHAGE_Lactob_1: Mg2+/Co2+ transport protein CorA; HMPREF0539_3129; phage(gi226377699) 4e-06 Click
5complement(3085895..3086279) PROPHAGE_Xantho_33913: IS1480 transposase; HMPREF0539_3130; phage(gi21231089) 5e-35 Click
63086280..3086378 conserved hypothetical protein; HMPREF0539_3131 0.0 Click
73086391..3087143 PHAGE_Lactob_1: transposase; HMPREF0539_3132; phage(gi226377790) 9e-53 Click
8complement(3087298..3087743) PHAGE_Spirop_R8A2B: putative transposase; HMPREF0539_3133; phage(gi9626114) 3e-08 Click
93087757..3088683 PHAGE_Spirop_R8A2B: putative transposase; HMPREF0539_3134; phage(gi9626114) 7e-10 Click
103088695..3088998 PHAGE_Entero_mEp460: side tail fiber protein; HMPREF0539_3135; phage(gi428782336) 6e-10 Click
11complement(3089051..3089497) universal stress protein UspA; HMPREF0539_3136 0.0 Click
123089778..3090191 PHAGE_Lactob_phig1e: repressor; HMPREF0539_3137; phage(gi23455773) 9e-09 Click
133090057..3090069 attR    GGCTCAACGATCC 0.0 Click
14complement(3090228..3090711) PHAGE_Lactob_phiAT3: putative transposase B; HMPREF0539_3138; phage(gi48697274) 5e-91 Click