Escherichia sp. 1_1_43 .1, whole genome shotgun sequence. [asmbl_id: NC_000000].2186403, GC%: 51.10%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 15 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11782107..1782129 attL    GACTCCTGTGATCTTCCGCCAAA 0.0 Click
21782290..1783453 PROPHAGE_Escher_CFT073: putative prophage integrase; PP_01735; phage(gi26250313) 1e-164 Click
31783463..1785334 PHAGE_Strept_YMC_2011: Helicase; PP_01736; phage(gi399498700) 1e-14 Click
41785331..1785753 hypothetical protein plu0154 [Photorhabdus luminescens subsp. laumondii TTO1] gi|37524176|ref|NP_927520.1|; PP_01737 3e-25 Click
51785851..1785982 hypothetical; PP_01738 0.0 Click
6complement(1786064..1786636) PHAGE_Entero_P4: amber mutation-suppressing protein; PP_01739; phage(gi9627520) 4e-102 Click
7complement(1786710..1787135) PHAGE_Entero_P4: transactivation protein; PP_01740; phage(gi9627519) 4e-73 Click
8complement(1787207..1787941) PHAGE_Entero_P4: head size determination protein sid; PP_01741; phage(gi9627518) 4e-134 Click
91788493..1788759 PHAGE_Entero_P4: transcriptional regulator; PP_01742; phage(gi9627517) 1e-46 Click
101788756..1789346 PHAGE_Entero_P4: putative CI repressor; PP_01743; phage(gi9627516) 5e-60 Click
111789339..1789626 PHAGE_Entero_P4: helper derepression protein; PP_01744; phage(gi9627515) 1e-49 Click
121789619..1790074 PHAGE_Entero_P4: hypothetical protein P4p08; PP_01745; phage(gi9627514) 3e-87 Click
131790210..1790500 PHAGE_Entero_P4: hypothetical protein P4p07; PP_01746; phage(gi9627513) 1e-48 Click
141790535..1792877 PHAGE_Entero_P4: DNA primase; PP_01747; phage(gi9627512) 0.0 Click
151792846..1792980 hypothetical; PP_01748 0.0 Click
161793083..1793229 PHAGE_Entero_P4: hypothetical protein P4p05; PP_01749; phage(gi19263411) 2e-20 Click
171793354..1793376 attR    GACTCCTGTGATCTTCCGCCAAA 0.0 Click

Region 2, total : 49 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12037136..2038119 PHAGE_Strept_Sfi11: putative minor tail protein; PP_01984; phage(gi9635024) 3e-06 Click
22038268..2038942 hypothetical protein ECBD_4113 [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253775450|ref|YP_003038281.1|; PP_01985 3e-129 Click
3complement(2039048..2040421) PHAGE_Feldma_virus: putative hybrid sensor histdine kinase; PP_01986; phage(gi197322490) 1e-08 Click
4complement(2040418..2041116) PHAGE_Feldma_virus: putative sensor histidine kinase; PP_01987; phage(gi197322366) 4e-09 Click
52041266..2041766 repressor CpxP [Shigella sonnei Ss046] gi|161986403|ref|YP_312833.2|; PP_01988 9e-88 Click
62041790..2041816 attL    GACACCATCCCTGTCTTCCCCCACATG 0.0 Click
7complement(2041952..2042932) PHAGE_Yersin_413C: Int; PP_01989; phage(gi30065733) 0.0 Click
8complement(2043002..2043295) PHAGE_Yersin_413C: gpC; PP_01990; phage(gi30065734) 3e-26 Click
92043448..2043720 PHAGE_Yersin_413C: Cox; PP_01991; phage(gi30065735) 6e-39 Click
102043723..2043893 PHAGE_Yersin_413C: hypothetical protein L-413Cp32; PP_01992; phage(gi30065736) 4e-26 Click
112043884..2044390 PHAGE_Yersin_413C: gpB; PP_01993; phage(gi30065737) 1e-92 Click
122044454..2044678 PHAGE_Yersin_413C: hypothetical protein L-413Cp34; PP_01994; phage(gi30065738) 1e-33 Click
132044678..2044980 PHAGE_Yersin_413C: hypothetical protein L-413Cp35; PP_01995; phage(gi30065739) 1e-43 Click
142044980..2045204 PHAGE_Yersin_413C: hypothetical protein L-413Cp36; PP_01996; phage(gi30065740) 1e-35 Click
152045201..2045476 PHAGE_Yersin_413C: hypothetical protein L-413Cp37; PP_01997; phage(gi30065741) 5e-46 Click
162045466..2047739 PHAGE_Yersin_413C: gpA; PP_01998; phage(gi30065742) 0.0 Click
172047851..2048900 PHAGE_Ranid__2: ORF120; PP_01999; phage(gi109638623) 3e-16 Click
18complement(2048942..2050900) PHAGE_Pseudo_LUZ7: N4 gp33-like protein; PP_02000; phage(gi282599438) 3e-05 Click
192051132..2051293 hypothetical protein ECOK1_0941 [Escherichia coli IHE3034] gi|386598654|ref|YP_006100160.1|; PP_02001 6e-19 Click
20complement(2051332..2052366) PHAGE_Yersin_413C: gpQ; PP_02002; phage(gi30065705) 0.0 Click
21complement(2052366..2054138) PHAGE_Yersin_413C: gpP; PP_02003; phage(gi30065706) 0.0 Click
222054312..2055166 PHAGE_Yersin_413C: gpO; PP_02004; phage(gi30065707) 8e-160 Click
232055225..2056298 PHAGE_Yersin_413C: gpN; PP_02005; phage(gi30065708) 0.0 Click
242056302..2057045 PHAGE_Yersin_413C: gpM; PP_02006; phage(gi30065709) 2e-134 Click
252057145..2057654 PHAGE_Yersin_413C: gpL; PP_02007; phage(gi30065710) 3e-92 Click
262057654..2057857 PHAGE_Yersin_413C: gpX; PP_02008; phage(gi30065711) 4e-32 Click
272057861..2058142 PHAGE_Yersin_413C: gpY; PP_02009; phage(gi30065712) 2e-45 Click
282058142..2058639 PHAGE_Yersin_413C: gpK; PP_02010; phage(gi30065713) 3e-94 Click
292058654..2059079 PHAGE_Yersin_413C: LysA; PP_02011; phage(gi30065714) 1e-66 Click
302059067..2059492 PHAGE_Yersin_413C: LysB; PP_02012; phage(gi30065715) 1e-67 Click
312059479..2059637 PHAGE_Erwini_ENT90: putative host lysis-related protein; PP_02013; phage(gi431810968) 2e-10 Click
322059600..2060067 PHAGE_Yersin_413C: gpR; PP_02014; phage(gi30065716) 7e-83 Click
332060060..2060512 PHAGE_Yersin_413C: gpS; PP_02015; phage(gi30065717) 4e-80 Click
342060579..2061214 PHAGE_Yersin_413C: gpV; PP_02016; phage(gi30065718) 2e-117 Click
352061211..2061558 PHAGE_Yersin_413C: gpW; PP_02017; phage(gi30065719) 1e-59 Click
362061563..2062471 PHAGE_Yersin_413C: gpJ; PP_02018; phage(gi30065720) 1e-165 Click
372062464..2062991 PHAGE_Yersin_413C: gpI; PP_02019; phage(gi30065721) 9e-100 Click
382063002..2065761 PHAGE_Yersin_413C: gpH; PP_02020; phage(gi30065722) 0.0 Click
392065765..2066292 PHAGE_Yersin_413C: gpG; PP_02021; phage(gi30065723) 1e-74 Click
402066514..2067107 hypothetical; PP_02022 0.0 Click
412067436..2068626 PHAGE_Yersin_413C: gpFI; PP_02023; phage(gi30065725) 0.0 Click
422068639..2069157 PHAGE_Yersin_413C: FII; PP_02024; phage(gi30065726) 6e-93 Click
432069214..2069489 PHAGE_Yersin_413C: gpE; PP_02025; phage(gi30065727) 3e-44 Click
442069486..2069641 PHAGE_Yersin_413C: gpE+E'; PP_02026; phage(gi30065728) 7e-24 Click
452069634..2072081 PHAGE_Yersin_413C: gpT; PP_02027; phage(gi30065729) 0.0 Click
462072096..2072575 PHAGE_Yersin_413C: gpU; PP_02028; phage(gi30065730) 4e-86 Click
472072575..2073738 PHAGE_Yersin_413C: gpD; PP_02029; phage(gi30065731) 0.0 Click
482073784..2074038 PHAGE_Yersin_413C: Ogr; PP_02030; phage(gi30065732) 2e-45 Click
492074150..2074176 attR    GACACCATCCCTGTCTTCCCCCACATG 0.0 Click
502074275..2075177 ferrous iron efflux protein F [Shigella dysenteriae Sd197] gi|82778918|ref|YP_405267.1|; PP_02031 4e-166 Click
512075358..2076320 PHAGE_Ostreo_OlV5: 6-phosphofructokinase; PP_02032; phage(gi472341206) 4e-16 Click