Yersinia ruckeri ATCC 29473 , whole genome shotgun [asmbl_id: NC_000000].3739990, GC%: 47.42%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1382571..382582 attL    ACTTGTTAAATT 0.0 Click
2complement(395389..397392) PHAGE_Synech_S_SKS1: nucleotide-sugar epimerase; yruck0001_14010; phage(gi472340882) 1e-12 Click
3complement(397730..398356) PHAGE_Entero_SfV: bactoprenol glucosyltransferase; yruck0001_14030; phage(gi19549012) 4e-19 Click
4complement(398358..399512) PHAGE_Ostreo_1: hypothetical protein H665_p041; yruck0001_14040; phage(gi260665911) 1e-21 Click
5complement(399894..400655) PHAGE_Plankt_PaV_LD: ABC transporter; yruck0001_14050; phage(gi371496158) 1e-10 Click
6complement(400818..401825) PHAGE_Lactob_Lj771: minor tail protein gp26-like protein; yruck0001_14060; phage(gi163932195) 5e-06 Click
7complement(402171..402458) PHAGE_Yersin_413C: Int; yruck0001_14070; phage(gi30065733) 6e-26 Click
8402680..403297 PHAGE_Ralsto_phiRSA1: tail completion protein gpS; yruck0001_14080; phage(gi145708091) 3e-11 Click
9403391..403579 hypothetical protein; yruck0001_14090 0.0 Click
10403882..404163 Cell filamentation protein fic; yruck0001_14100 0.0 Click
11404277..404936 PHAGE_Yersin_413C: gpV; yruck0001_14110; phage(gi30065718) 2e-47 Click
12405023..405550 PHAGE_Yersin_413C: gpD; yruck0001_14120; phage(gi30065731) 2e-37 Click
13405716..405949 PHAGE_Yersin_413C: Ogr; yruck0001_14130; phage(gi30065732) 9e-10 Click
14complement(405964..406488) hypothetical protein; yruck0001_14140 0.0 Click
15complement(406669..406965) PHAGE_Bacill_36: DNA-binding HU protein; yruck0001_14150; phage(gi156564019) 9e-16 Click
16414108..414119 attR    ACTTGTTAAATT 0.0 Click

Region 2, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1703292..703303 attL    ATTTTCTCAATG 0.0 Click
2710033..710054 attL    ATTGGTACACGTTTAGGTACAC 0.0 Click
3710105..711319 PHAGE_Entero_P4: integrase; yruck0001_7180; phage(gi9627511) 2e-66 Click
4711361..712470 hypothetical protein; yruck0001_7190 0.0 Click
5712601..712792 hypothetical protein; yruck0001_7200 0.0 Click
6712917..713255 hypothetical protein; yruck0001_7210 0.0 Click
7complement(713572..713685) hypothetical protein; yruck0001_7220 0.0 Click
8complement(713820..714521) PHAGE_Entero_P4: head size determination protein sid; yruck0001_7230; phage(gi9627518) 2e-17 Click
9715132..715380 PHAGE_Entero_P4: transcriptional regulator; yruck0001_7240; phage(gi9627517) 4e-17 Click
10715428..715616 hypothetical protein; yruck0001_7250 0.0 Click
11715621..716166 PHAGE_Entero_P4: putative CI repressor; yruck0001_7260; phage(gi9627516) 4e-30 Click
12716423..716764 PHAGE_Entero_P4: hypothetical protein P4p07; yruck0001_7270; phage(gi9627513) 9e-16 Click
13716778..719111 PHAGE_Entero_P4: DNA primase; yruck0001_7280; phage(gi9627512) 0.0 Click
14719575..719596 attR    ATTGGTACACGTTTAGGTACAC 0.0 Click
15719785..721338 PHAGE_Entero_P4: integrase; yruck0001_7290; phage(gi9627511) 3e-62 Click
16735824..735835 attR    ATTTTCTCAATG 0.0 Click

Region 3, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13338842..3339597 PHAGE_Tricho_2c: hypothetical protein TNAV2c_gp071; yruck0001_25520; phage(gi116326757) 3e-19 Click
23339619..3340677 Glycosyl hydrolase, family 88; yruck0001_25530 0.0 Click
33340923..3341096 hypothetical protein; yruck0001_9570 0.0 Click
4complement(3341213..3341785) PHAGE_Entero_2: DNA-invertase; yruck0001_9580; phage(gi169936026) 5e-67 Click
53342235..3342657 PHAGE_Entero_SfV: tail fibre assembly protein; yruck0001_9590; phage(gi19549010) 8e-11 Click
6complement(3342695..3343192) PHAGE_Entero_SfV: tail fibre assembly protein; yruck0001_9600; phage(gi19549010) 5e-05 Click
7complement(3343194..3343835) PHAGE_Entero_SfV: hypothetical protein SfVp21; yruck0001_9610; phage(gi19548989) 2e-21 Click
8complement(3343886..3344434) PHAGE_Entero_SfV: tail protein; yruck0001_9620; phage(gi19548988) 4e-18 Click
9complement(3344479..3345615) PHAGE_Entero_SfV: tail protein; yruck0001_9630; phage(gi19549009) 3e-35 Click
10complement(3345619..3345909) PHAGE_Entero_SfV: tail protein; yruck0001_9640; phage(gi19549008) 4e-10 Click
11complement(3346646..3347698) PHAGE_Entero_SfV: tail protein; yruck0001_9660; phage(gi19549006) 1e-39 Click
12complement(3347713..3349122) PHAGE_Entero_SfV: tail/DNA circulation protein; yruck0001_9670; phage(gi19549005) 5e-21 Click
13complement(3349271..3349543) hypothetical protein; yruck0001_9680 0.0 Click
14complement(3349783..3351594) PHAGE_Yersin_Berlin: Internal virion protein D; yruck0001_9690; phage(gi119637782) 2e-10 Click
15complement(3351712..3352014) hypothetical protein; yruck0001_9700 0.0 Click
16complement(3352016..3352384) PHAGE_Entero_SfV: hypothetical protein SfVp12; yruck0001_9710; phage(gi19549002) 8e-09 Click

Region 4, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13571410..3571422 attL    TATTTTTAATTTA 0.0 Click
2complement(3579867..3580337) PHAGE_Entero_2: P2 Int-like protein; yruck0001_11080; phage(gi169936064) 6e-50 Click
3complement(3580623..3580889) PHAGE_Entero_2: P2 Int-like protein; yruck0001_11090; phage(gi169936064) 2e-15 Click
4complement(3580910..3582607) PHAGE_Clostr_phiSM101: phage tail tape measure protein, TP901 family, core region domain protein; yruck0001_11100; phage(gi110804068) 1e-07 Click
53583126..3583248 hypothetical protein; yruck0001_11110 0.0 Click
63583261..3583464 PHAGE_Vibrio_kappa: putative regulator; yruck0001_11120; phage(gi165970239) 3e-05 Click
73583476..3583682 Hypothetical phage-related protein; yruck0001_11130 0.0 Click
83583727..3583945 hypothetical protein; yruck0001_11140 0.0 Click
93583977..3584132 hypothetical protein; yruck0001_11150 0.0 Click
103584173..3584448 hypothetical protein; yruck0001_11160 0.0 Click
113584531..3584728 PHAGE_Entero_2: hypothetical protein STM2732.Fels2; yruck0001_11170; phage(gi169936057) 3e-05 Click
123584787..3585560 PHAGE_Entero_2: DNA adenine methylase-like protein; yruck0001_11180; phage(gi169936055) 3e-71 Click
133585697..3586704 PHAGE_Entero_2: P2 gpA-like protein; yruck0001_11190; phage(gi169936054) 3e-37 Click
143586901..3587854 PHAGE_Entero_2: P2 gpA-like protein; yruck0001_11200; phage(gi169936054) 1e-50 Click
153588292..3588633 PHAGE_Pectob_ZF40: hypothetical protein; yruck0001_11210; phage(gi422936662) 2e-23 Click
163589701..3589713 attR    TATTTTTAATTTA 0.0 Click

Region 5, total : 22 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13713443..3713460 attL    GAGACTCGAACTCGCGAC 0.0 Click
2complement(3717123..3717389) PROPHAGE_Xantho_306: ISxcd1 transposase; yruck0001_20; phage(gi21243158) 2e-35 Click
3complement(3718204..3718914) PHAGE_Entero_Sf6: putative transposase OrfB; yruck0001_34700; phage(gi41057343) 4e-63 Click
43719317..3719602 hypothetical protein; yruck0001_34530 0.0 Click
53719605..3720222 PROPHAGE_Escher_CFT073: transposase insF; yruck0001_15520; phage(gi26250329) 3e-72 Click
63720246..3720863 PROPHAGE_Escher_CFT073: transposase insF; yruck0001_16720; phage(gi26250329) 3e-72 Click
73720887..3721504 PROPHAGE_Escher_CFT073: transposase insF; yruck0001_25540; phage(gi26250329) 3e-72 Click
83721528..3722145 PROPHAGE_Escher_CFT073: transposase insF; yruck0001_21580; phage(gi26250329) 3e-72 Click
93722231..3722515 PROPHAGE_Xantho_33913: ISxac3 transposase; yruck0001_25550; phage(gi21231087) 1e-23 Click
103722536..3722754 PROPHAGE_Xantho_33913: ISxac3 transposase; yruck0001_25560; phage(gi21231086) 2e-15 Click
113722819..3723103 PROPHAGE_Xantho_33913: ISxac3 transposase; yruck0001_21590; phage(gi21231087) 1e-23 Click
123723124..3723342 PROPHAGE_Xantho_33913: ISxac3 transposase; yruck0001_21600; phage(gi21231086) 2e-15 Click
133723407..3723691 PROPHAGE_Xantho_33913: ISxac3 transposase; yruck0001_16730; phage(gi21231087) 1e-23 Click
143723712..3723930 PROPHAGE_Xantho_33913: ISxac3 transposase; yruck0001_16740; phage(gi21231086) 2e-15 Click
153723995..3724279 PROPHAGE_Xantho_33913: ISxac3 transposase; yruck0001_15530; phage(gi21231087) 1e-23 Click
163724300..3724518 PROPHAGE_Xantho_33913: ISxac3 transposase; yruck0001_15540; phage(gi21231086) 2e-15 Click
173724540..3725095 Flagellin; yruck0001_34650 0.0 Click
18complement(3725096..3725338) Possible adhesin/hemolysin; yruck0001_34630 0.0 Click
193725498..3725610 Large exoprotein involved in heme utilization or adhesion; yruck0001_34620 0.0 Click
20complement(3725717..3726082) hypothetical protein; yruck0001_31120 0.0 Click
21complement(3726182..3726499) PHAGE_Entero_Sf6: gene 56 protein; yruck0001_34690; phage(gi41057344) 4e-15 Click
223727176..3727503 flagellin; yruck0001_34570 0.0 Click
233728114..3728239 bacteriophage integrase; yruck0001_31230 0.0 Click
243733736..3733753 attR    GAGACTCGAACTCGCGAC 0.0 Click