Enterococcus faecium 1,231,410 .1, whole genome shotgun [asmbl_id: NC_000000].2943813, GC%: 37.69%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11081614..1081634 attL    TGTATGCCATATTGTATGCCA 0.0 Click
2complement(1081636..1082781) PROPHAGE_Oceano_HTE831: integrase; PP_01104; phage(gi23097608) 7e-64 Click
3complement(1082842..1083489) PHAGE_Lactoc_bIL311: repressor; PP_01105; phage(gi13095660) 8e-12 Click
41083683..1083976 hypothetical protein HMPREF0351_12143 [Enterococcus faecium DO] gi|389869326|ref|YP_006376749.1|; PP_01106 7e-49 Click
51084020..1084331 hypothetical protein HMPREF0351_12142 [Enterococcus faecium DO] gi|389869325|ref|YP_006376748.1|; PP_01107 9e-50 Click
61084548..1084952 bacteriophage antirepressor protein [Enterococcus faecium DO] gi|389869323|ref|YP_006376746.1|; PP_01108 6e-70 Click
71085093..1085251 hypothetical protein HMPREF0351_12139 [Enterococcus faecium DO] gi|389869322|ref|YP_006376745.1|; PP_01109 6e-22 Click
81085252..1085614 hypothetical protein HMPREF0351_12138 [Enterococcus faecium DO] gi|389869321|ref|YP_006376744.1|; PP_01110 7e-63 Click
91085651..1086499 PHAGE_Lactoc_bIL310: hypothetical protein bIL310p24; PP_01111; phage(gi13095885) 1e-22 Click
101086489..1087964 PHAGE_Staphy_2638A: ORF003; PP_01112; phage(gi66395453) 5e-68 Click
111088230..1088637 hypothetical protein HMPREF0351_12135 [Enterococcus faecium DO] gi|389869318|ref|YP_006376741.1|; PP_01113 1e-72 Click
121088640..1088855 group 1 glycosyl transferase [Enterococcus faecium DO] gi|389869317|ref|YP_006376740.1|; PP_01114 2e-35 Click
131088926..1089048 hypothetical; PP_01115 0.0 Click
141089373..1089528 hypothetical protein HMPREF0351_12132 [Enterococcus faecium DO] gi|389869315|ref|YP_006376738.1|; PP_01116 1e-21 Click
151089597..1090070 PHAGE_Burkho_phiE125: putative terminase (small subunit); PP_01117; phage(gi17975162) 4e-13 Click
161090067..1091761 PHAGE_Lactob_LF1: bacteriophage terminase large subunit; PP_01118; phage(gi418489385) 9e-124 Click
171091916..1093091 PHAGE_Entero_EFRM31: portal protein; PP_01119; phage(gi327198113) 9e-56 Click
181093084..1094607 PHAGE_Entero_EFRM31: major capsid protein; PP_01120; phage(gi327198115) 8e-50 Click
191094663..1094947 PHAGE_Entero_EFRM31: head-tail joining protein; PP_01121; phage(gi327198117) 8e-09 Click
201094934..1095269 PHAGE_Entero_EFRM31: head-tail adaptor protein; PP_01122; phage(gi327198118) 2e-14 Click
211096216..1096236 attR    TGTATGCCATATTGTATGCCA 0.0 Click

Region 2, total : 53 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11852667..1852951 PHAGE_Bacill_36: GroES; PP_01868; phage(gi156564025) 1e-13 Click
21853002..1854627 PHAGE_Halocy_JM_2012: chaperonin GroEL; PP_01869; phage(gi389060206) 2e-68 Click
31854670..1854681 attL    TTTTTGTTTTAT 0.0 Click
4complement(1854716..1855855) PHAGE_Entero_phiEf11: phage integrase protein; PP_01870; phage(gi282598730) 1e-74 Click
5complement(1856355..1856777) PHAGE_Lactoc_bIL285: Orf3; PP_01871; phage(gi13095683) 5e-08 Click
6complement(1856795..1857115) PHAGE_Strept_6: putative repressor; PP_01872; phage(gi28876485) 3e-23 Click
71857408..1857566 hypothetical protein EFD32_2292 [Enterococcus faecalis D32] gi|397700863|ref|YP_006538651.1|; PP_01873 1e-08 Click
81857802..1857957 hypothetical; PP_01874 0.0 Click
9complement(1857938..1858189) hypothetical; PP_01875 0.0 Click
101858265..1859011 PHAGE_Staphy_phiMR25: putative anti-repressor protein; PP_01876; phage(gi189427129) 3e-52 Click
111859026..1859229 XRE family transcriptional regulator [Enterococcus faecium DO] gi|389868011|ref|YP_006375434.1|; PP_01877 4e-29 Click
121859244..1859543 PHAGE_Lactoc_bIL312: excisionase; PP_01878; phage(gi13095898) 6e-09 Click
131859591..1859875 hypothetical protein EFAU004_02406 [Enterococcus faecium Aus0004] gi|383329723|ref|YP_005355607.1|; PP_01879 5e-46 Click
141859896..1860084 PHAGE_Entero_phiFL3A: hypothetical protein; PP_01880; phage(gi281416222) 2e-11 Click
151860081..1860254 hypothetical protein EFAU004_02404 [Enterococcus faecium Aus0004] gi|383329721|ref|YP_005355605.1|; PP_01881 2e-23 Click
161860223..1860369 hypothetical protein EFAU004_02403 [Enterococcus faecium Aus0004] gi|383329720|ref|YP_005355604.1|; PP_01882 1e-13 Click
171860406..1860747 hypothetical protein HMPREF0351_10834 [Enterococcus faecium DO] gi|389868017|ref|YP_006375440.1|; PP_01883 1e-57 Click
181860740..1861309 PHAGE_Bacill_L: gp28; PP_01884; phage(gi216905993) 8e-33 Click
19complement(1861356..1861493) hypothetical; PP_01885 0.0 Click
201861557..1861691 hypothetical; PP_01886 0.0 Click
211861813..1862214 PHAGE_Pectob_phiTE: HNH endonuclease; PP_01887; phage(gi448244938) 4e-14 Click
221862323..1863174 PHAGE_Brocho_BL3: gp46; PP_01888; phage(gi327409438) 9e-55 Click
231863186..1863455 hypothetical protein EFAU004_02398 [Enterococcus faecium Aus0004] gi|383329715|ref|YP_005355599.1|; PP_01889 5e-39 Click
241863460..1863624 hypothetical protein HMPREF0351_10839 [Enterococcus faecium DO] gi|389868022|ref|YP_006375445.1|; PP_01890 5e-23 Click
251863617..1863919 hypothetical protein HMPREF0351_10840 [Enterococcus faecium DO] gi|389868023|ref|YP_006375446.1|; PP_01891 4e-49 Click
261863916..1864077 hypothetical protein M7W_2064 [Enterococcus faecium NRRL B-2354] gi|447913320|ref|YP_007394732.1|; PP_01892 2e-20 Click
271864080..1864385 hypothetical protein EFAU004_02397 [Enterococcus faecium Aus0004] gi|383329714|ref|YP_005355598.1|; PP_01893 3e-50 Click
281864379..1864669 PHAGE_Entero_phiFL3A: hypothetical protein; PP_01894; phage(gi281416234) 4e-17 Click
291864669..1864980 PHAGE_Entero_phiFL2A: recombinase; PP_01895; phage(gi281416510) 3e-29 Click
301864977..1865150 hypothetical; PP_01896 0.0 Click
311865147..1865524 PHAGE_Temper_1: hypothetical protein phiNIH1.1_19; PP_01897; phage(gi16271795) 1e-13 Click
321865702..1866115 hypothetical protein EFS1_1538 [Enterococcus faecalis str. Symbioflor 1] gi|428767219|ref|YP_007153330.1|; PP_01898 1e-09 Click
331867036..1867491 PHAGE_Brocho_NF5: gp1; PP_01899; phage(gi327197585) 2e-23 Click
341867646..1868782 PHAGE_Brocho_NF5: gp2; PP_01900; phage(gi327197586) 0.0 Click
351868793..1870427 PHAGE_Entero_phiEf11: phage portal protein; PP_01901; phage(gi282598717) 0.0 Click
361870381..1870611 hypothetical; PP_01902 0.0 Click
371870624..1870887 PHAGE_Brocho_NF5: gp56; PP_01903; phage(gi327197641) 2e-13 Click
381870892..1871845 PHAGE_Brocho_NF5: gp4; PP_01904; phage(gi327197588) 9e-59 Click
391871923..1872144 hypothetical; PP_01905 0.0 Click
401872192..1872365 hypothetical; PP_01906 0.0 Click
411872480..1873121 PHAGE_Entero_phiEf11: putative phage scaffold protein; PP_01907; phage(gi282598711) 2e-52 Click
421873133..1873486 PHAGE_Entero_phiEf11: conserved hypothetical protein; PP_01908; phage(gi282598728) 9e-45 Click
431873511..1874518 PHAGE_Entero_phiEf11: putative head protein; PP_01909; phage(gi282598750) 3e-163 Click
441874529..1874735 PHAGE_Lister_B025: gp6; PP_01910; phage(gi157325223) 3e-05 Click
451874775..1875113 PHAGE_Staphy_TEM123: head-tail connector proteins; PP_01911; phage(gi388570344) 4e-10 Click
461875110..1875436 PHAGE_Brocho_NF5: gp8; PP_01912; phage(gi327197593) 1e-14 Click
471875433..1875804 PHAGE_Brocho_NF5: gp9; PP_01913; phage(gi327197594) 1e-15 Click
481875801..1876193 PHAGE_Brocho_NF5: gp10; PP_01914; phage(gi327197595) 2e-45 Click
491876204..1876716 PHAGE_Brocho_NF5: gp11; PP_01915; phage(gi327197596) 3e-61 Click
501876762..1877130 PHAGE_Brocho_NF5: gp12; PP_01916; phage(gi327197597) 1e-19 Click
511877184..1877471 PHAGE_Brocho_NF5: gp13; PP_01917; phage(gi327197598) 2e-16 Click
521877488..1880607 PHAGE_Lactoc_Tuc2009: hypothetical protein Tuc2009_46; PP_01918; phage(gi13487847) 0.0 Click
531880619..1881407 PHAGE_Brocho_NF5: gp15; PP_01919; phage(gi327197600) 3e-63 Click
541881404..1884235 PHAGE_Brocho_NF5: gp16; PP_01920; phage(gi327197601) 0.0 Click
551893236..1893247 attR    TTTTTGTTTTAT 0.0 Click

Region 3, total : 63 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12335913..2335924 attL    TCATGTATGATT 0.0 Click
2complement(2346064..2347083) PHAGE_Lactob_A2: lysin; PP_02366; phage(gi22296540) 5e-61 Click
3complement(2347094..2347291) PHAGE_Entero_phiFL1A: holin; PP_02367; phage(gi281416382) 2e-24 Click
4complement(2347314..2347607) PHAGE_Lister_P70: hypothetical protein; PP_02368; phage(gi410490647) 9e-05 Click
5complement(2347645..2347782) Phage uncharacterized protein XkdX [Enterococcus faecium NRRL B-2354] gi|447913295|ref|YP_007394707.1|; PP_02369 6e-14 Click
6complement(2347784..2348191) hypothetical protein EFD32_1651 [Enterococcus faecalis D32] gi|397700226|ref|YP_006538014.1|; PP_02370 1e-39 Click
7complement(2348206..2348715) hypothetical protein EF2807 [Enterococcus faecalis V583] gi|29377278|ref|NP_816432.1|; PP_02371 3e-19 Click
8complement(2348715..2349164) PHAGE_Gordon_GTE2: tail fiber protein; PP_02372; phage(gi338826880) 2e-07 Click
9complement(2349168..2349785) PHAGE_Ralsto_RSL1: unnamed protein product; PP_02373; phage(gi189426961) 6e-09 Click
10complement(2349785..2350693) PHAGE_Lactoc_bIL285: Orf55; PP_02374; phage(gi13095735) 9e-16 Click
11complement(2350706..2353417) PHAGE_Lactoc_bIL285: endopeptidase; PP_02375; phage(gi13095734) 0.0 Click
12complement(2353414..2354154) PHAGE_Clostr_phiCD38_2: tail component protein; PP_02376; phage(gi333798124) 2e-13 Click
13complement(2354144..2356960) PHAGE_Entero_1: type measure protein; PP_02377; phage(gi225626385) 4e-87 Click
14complement(2357175..2357516) hypothetical protein EF2004 [Enterococcus faecalis V583] gi|29376520|ref|NP_815674.1|; PP_02378 4e-21 Click
15complement(2357516..2358124) PHAGE_Clostr_phi3626: major tail protein; PP_02379; phage(gi20065974) 4e-11 Click
16complement(2358125..2358502) hypothetical protein EF2006 [Enterococcus faecalis V583] gi|29376522|ref|NP_815676.1|; PP_02380 5e-29 Click
17complement(2358504..2358899) PHAGE_Clostr_phiC2: hypothetical protein phiC2p11; PP_02381; phage(gi134287346) 9e-05 Click
18complement(2358892..2359263) PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp11; PP_02382; phage(gi90592647) 6e-10 Click
19complement(2359263..2359604) hypothetical protein EFD32_1664 [Enterococcus faecalis D32] gi|397700239|ref|YP_006538027.1|; PP_02383 3e-22 Click
20complement(2359616..2359813) hypothetical protein EF2010 [Enterococcus faecalis V583] gi|29376525|ref|NP_815679.1|; PP_02384 3e-12 Click
21complement(2359854..2360744) PHAGE_Pseudo_UFV_P2: major head protein; PP_02385; phage(gi410491826) 7e-13 Click
22complement(2360759..2361376) PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp45; PP_02386; phage(gi122891829) 3e-06 Click
23complement(2361379..2361549) hypothetical; PP_02387 0.0 Click
24complement(2361509..2361826) hypothetical protein EFD32_1668 [Enterococcus faecalis D32] gi|397700243|ref|YP_006538031.1|; PP_02388 7e-05 Click
25complement(2361828..2362817) PHAGE_Entero_phiFL1A: phage head protein; PP_02389; phage(gi281416365) 2e-19 Click
26complement(2362786..2364321) PHAGE_Deep_s_D6E: portal protein; PP_02390; phage(gi423262330) 8e-39 Click
27complement(2364333..2365751) PHAGE_Lactoc_1: TerL; PP_02391; phage(gi13786562) 4e-121 Click
28complement(2365729..2366157) hypothetical protein [Clostridium sp. BNL1100] gi|376261696|ref|YP_005148416.1|; PP_02392 1e-21 Click
29complement(2366175..2366324) hypothetical protein EF62_1378 [Enterococcus faecalis 62] gi|384518050|ref|YP_005705355.1|; PP_02393 1e-08 Click
30complement(2366950..2367336) PHAGE_Strept_O1205: hypothetical protein O1205p22; PP_02394; phage(gi23455870) 2e-31 Click
31complement(2367349..2367630) PHAGE_Entero_phiFL1A: transcriptional regulator ArpU family; PP_02395; phage(gi281416357) 2e-37 Click
32complement(2367642..2367806) hypothetical; PP_02396 0.0 Click
33complement(2367796..2368095) ArpT [Enterococcus faecium Aus0004] gi|383329706|ref|YP_005355590.1|; PP_02397 6e-49 Click
34complement(2368092..2368295) hypothetical protein EFAU004_02390 [Enterococcus faecium Aus0004] gi|383329707|ref|YP_005355591.1|; PP_02398 1e-26 Click
35complement(2368292..2368513) hypothetical; PP_02399 0.0 Click
36complement(2368870..2369103) PHAGE_Entero_phiEf11: asch domain protein; PP_02400; phage(gi282598726) 3e-24 Click
37complement(2369100..2369462) PHAGE_Entero_phiFL1A: hypothetical protein; PP_02401; phage(gi281416350) 3e-05 Click
38complement(2369459..2369665) hypothetical; PP_02402 0.0 Click
39complement(2370187..2370612) PHAGE_Entero_phiFL1A: DNA cytosine methyltransferase; PP_02403; phage(gi281416347) 4e-66 Click
40complement(2370649..2371035) PHAGE_Bacill_IEBH: hypothetical protein IEBH_gp30; PP_02404; phage(gi197261540) 4e-11 Click
41complement(2371032..2371343) PHAGE_Entero_phiFL1A: DNA binding protein; PP_02405; phage(gi281416342) 2e-28 Click
42complement(2371355..2371480) hypothetical; PP_02406 0.0 Click
43complement(2371482..2372297) PHAGE_Entero_phiEF24C: putative anti-proliferative protein; PP_02407; phage(gi158079503) 6e-98 Click
44complement(2372294..2372614) hypothetical protein HMPREF0351_10842 [Enterococcus faecium DO] gi|389868025|ref|YP_006375448.1|; PP_02408 3e-12 Click
45complement(2372617..2372778) hypothetical protein M7W_2064 [Enterococcus faecium NRRL B-2354] gi|447913320|ref|YP_007394732.1|; PP_02409 1e-20 Click
46complement(2372793..2373152) PHAGE_Lactoc_bIL286: Orf19; PP_02410; phage(gi13095762) 2e-20 Click
47complement(2373149..2374000) PHAGE_Lactoc_r1t: putative replication protein DnaC; PP_02411; phage(gi23455731) 7e-22 Click
48complement(2374015..2374815) PHAGE_Lactob_Lrm1: DNA replication protein; PP_02412; phage(gi195661236) 2e-68 Click
49complement(2374858..2375748) PHAGE_Entero_phiFL1A: RecT family protein; PP_02413; phage(gi281416340) 8e-142 Click
50complement(2375750..2376691) PHAGE_Entero_phiFL1A: endonuclease YqaJ superfamily; PP_02414; phage(gi281416339) 2e-149 Click
51complement(2376760..2376933) hypothetical; PP_02415 0.0 Click
52complement(2376930..2377262) PHAGE_Entero_phiFL1A: hypothetical protein; PP_02416; phage(gi281416336) 8e-07 Click
53complement(2377297..2377455) hypothetical; PP_02417 0.0 Click
54complement(2377452..2377640) PHAGE_Entero_phiFL1A: hypothetical protein; PP_02418; phage(gi281416332) 1e-11 Click
552377718..2377942 hypothetical protein Sinf_0767 [Streptococcus infantarius subsp. infantarius CJ18] gi|379705120|ref|YP_005203579.1|; PP_02419 7e-31 Click
56complement(2377939..2378094) hypothetical protein SAG0549 [Streptococcus agalactiae 2603V/R] gi|22536727|ref|NP_687578.1|; PP_02420 6e-12 Click
57complement(2378234..2378446) PHAGE_Entero_phiEf11: putative phage excisionase protein; PP_02421; phage(gi282598765) 2e-05 Click
58complement(2378449..2378661) hypothetical protein lmo4a_0068 [Listeria monocytogenes L99] gi|386006781|ref|YP_005925059.1|; PP_02422 7e-05 Click
592378936..2379346 PHAGE_Bacill_BCJA1c: repressor; PP_02423; phage(gi56694874) 2e-35 Click
602379359..2379811 PHAGE_Geobac_GBSV1: hypothetical protein GPGV1_gp47; PP_02424; phage(gi115334657) 3e-10 Click
612379902..2381182 PHAGE_Strept_1: hypothetical protein EJ-1p03; PP_02425; phage(gi39653677) 5e-95 Click
622381253..2382374 PHAGE_Entero_phiEf11: phage integrase protein; PP_02426; phage(gi282598730) 9e-72 Click
63complement(2382456..2384228) PHAGE_Bacill_SPBc2: ABC transporter; PP_02427; phage(gi9630145) 2e-43 Click
64complement(2384231..2385943) PHAGE_Bacill_SPBc2: ABC transporter; PP_02428; phage(gi9630145) 6e-31 Click
652388565..2388576 attR    TCATGTATGATT 0.0 Click

Region 4, total : 32 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12750277..2751596 PHAGE_Acanth_moumouvirus: DNA topoisomerase 1; PP_02802; phage(gi441432186) 9e-07 Click
22751849..2751977 hypothetical protein HMPREF0351_10833 [Enterococcus faecium DO] gi|389868016|ref|YP_006375439.1|; PP_02803 3e-12 Click
32752036..2752377 hypothetical protein M7W_2069 [Enterococcus faecium NRRL B-2354] gi|447913324|ref|YP_007394736.1|; PP_02804 3e-55 Click
42752370..2753221 PHAGE_Bacill_L: gp28; PP_02805; phage(gi216905993) 2e-32 Click
52753268..2753537 hypothetical protein EFAU004_02398 [Enterococcus faecium Aus0004] gi|383329715|ref|YP_005355599.1|; PP_02806 1e-40 Click
62753542..2753706 hypothetical protein HMPREF0351_10839 [Enterococcus faecium DO] gi|389868022|ref|YP_006375445.1|; PP_02807 4e-24 Click
72753699..2754001 hypothetical protein HMPREF0351_10840 [Enterococcus faecium DO] gi|389868023|ref|YP_006375446.1|; PP_02808 2e-51 Click
82753998..2754159 accessory regulator R [Enterococcus faecium DO] gi|389868024|ref|YP_006375447.1|; PP_02809 2e-21 Click
92754162..2754461 hypothetical protein HMPREF0351_10842 [Enterococcus faecium DO] gi|389868025|ref|YP_006375448.1|; PP_02810 8e-51 Click
102754461..2754817 PHAGE_Lactoc_T: hypothetical protein BK5-Tp56; PP_02811; phage(gi14251179) 9e-18 Click
112754777..2755022 hypothetical protein EFAU004_01442 [Enterococcus faecium Aus0004] gi|383328760|ref|YP_005354644.1|; PP_02812 2e-38 Click
122755019..2755417 PHAGE_Entero_phiFL2A: YopX superfamily protein; PP_02813; phage(gi281416516) 8e-30 Click
132755804..2755968 hypothetical protein HMPREF0351_10851 [Enterococcus faecium DO] gi|389868034|ref|YP_006375457.1|; PP_02814 3e-23 Click
142756164..2756331 thymidylate synthase [Enterococcus faecium DO] gi|389868035|ref|YP_006375458.1|; PP_02815 9e-26 Click
152756357..2756701 PHAGE_Lister_2389: Gp54 protein; PP_02816; phage(gi17488559) 3e-20 Click
162756706..2756987 PHAGE_Lister_2389: Gp55 protein; PP_02817; phage(gi17488560) 7e-11 Click
172757090..2757404 PHAGE_Clostr_phiCD6356: putative terminase small subunit; PP_02818; phage(gi326536848) 2e-09 Click
182757382..2759076 PHAGE_Lister_2389: terminase large subunit; PP_02819; phage(gi17488505) 7e-106 Click
192759096..2760274 PHAGE_Lister_2389: hypothetical protein 2389gp03; PP_02820; phage(gi17488506) 8e-60 Click
202760237..2760923 PHAGE_Staphy_SMSAP5: protease; PP_02821; phage(gi422935811) 2e-34 Click
212760923..2762083 PHAGE_Lister_2389: major capsid protein a; PP_02822; phage(gi17488508) 1e-95 Click
222762093..2762968 PHAGE_Entero_phiFL1A: hypothetical protein; PP_02823; phage(gi281416374) 2e-131 Click
232762965..2763276 PHAGE_Lister_2389: Gp6 protein; PP_02824; phage(gi17488509) 3e-08 Click
242763266..2763619 PHAGE_Lister_2389: Gp7 protein; PP_02825; phage(gi17488510) 1e-09 Click
252763609..2764010 PHAGE_Lister_2389: Gp8 protein; PP_02826; phage(gi17488511) 3e-10 Click
262764003..2764407 PHAGE_Lister_2389: Gp9 protein; PP_02827; phage(gi17488512) 1e-08 Click
272764419..2765027 PHAGE_Lister_2389: major tail protein a; PP_02828; phage(gi17488513) 5e-37 Click
282765047..2765409 PHAGE_Lister_2389: Gp11 protein; PP_02829; phage(gi17488514) 2e-06 Click
292765454..2765594 hypothetical protein HMPREF0351_10867 [Enterococcus faecium DO] gi|389868050|ref|YP_006375473.1|; PP_02830 2e-19 Click
302765611..2769042 PHAGE_Lister_2389: tail tape measure protein; PP_02831; phage(gi17488515) 2e-88 Click
312769093..2769830 PHAGE_Lister_2389: Gp13 protein; PP_02832; phage(gi17488516) 3e-18 Click
322769840..2772131 PHAGE_Lister_2389: Gp14 protein; PP_02833; phage(gi17488517) 1e-67 Click

Region 5, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12779632..2779645 attL    AAAATAGGGTACAA 0.0 Click
2complement(2780537..2781571) PHAGE_Lactob_Lj965: putative integrase; PP_02847; phage(gi41179218) 7e-52 Click
3complement(2781595..2781741) hypothetical; PP_02848 0.0 Click
42781796..2781809 attR    AAAATAGGGTACAA 0.0 Click
5complement(2781879..2782010) hypothetical protein M7W_1613 [Enterococcus faecium NRRL B-2354] gi|447912880|ref|YP_007394292.1|; PP_02849 3e-14 Click
6complement(2782318..2782767) hypothetical protein TEH_18940 [Tetragenococcus halophilus NBRC 12172] gi|352518068|ref|YP_004887385.1|; PP_02850 5e-32 Click
7complement(2782854..2783054) PHAGE_Entero_phiEf11: conserved hypothetical protein; PP_02851; phage(gi282598725) 3e-28 Click
8complement(2783068..2783481) PHAGE_Entero_phiFL3A: hypothetical protein; PP_02852; phage(gi281416215) 4e-15 Click
92783482..2783493 attL    ACACTACAACCT 0.0 Click
10complement(2783493..2783831) PHAGE_Strept_MM1: repressor protein; PP_02853; phage(gi15088747) 3e-20 Click
112784123..2784314 PHAGE_Strept_MM1: hypothetical protein MM1p05; PP_02854; phage(gi15088748) 2e-09 Click
122784325..2784591 hypothetical; PP_02855 0.0 Click
132784603..2784773 hypothetical protein M7W_2072 [Enterococcus faecium NRRL B-2354] gi|447913327|ref|YP_007394739.1|; PP_02856 2e-23 Click
142784777..2784950 hypothetical protein M7W_2071 [Enterococcus faecium NRRL B-2354] gi|447913326|ref|YP_007394738.1|; PP_02857 1e-24 Click
15complement(2785001..2785789) hypothetical; PP_02858 0.0 Click
162785843..2785989 PHAGE_Lactob_Sha1: phage-related antirepressor; PP_02859; phage(gi418489833) 2e-08 Click
172785980..2786354 PHAGE_Entero_phiFL3A: anti-repressor protein; PP_02860; phage(gi281416221) 2e-13 Click
18complement(2786546..2787922) permease family protein [Enterococcus faecalis 62] gi|384518880|ref|YP_005706185.1|; PP_02861 0.0 Click
19complement(2787922..2788578) PHAGE_Plankt_PaV_LD: ABC transporter; PP_02862; phage(gi371496158) 6e-26 Click
20complement(2788588..2789757) permease family protein [Enterococcus faecalis 62] gi|384518882|ref|YP_005706187.1|; PP_02863 0.0 Click
21complement(2790113..2790472) thioredoxin family protein [Enterococcus faecalis V583] gi|29376401|ref|NP_815555.1|; PP_02864 1e-60 Click
22complement(2790628..2791170) hypothetical protein CDR20291_1801 [Clostridium difficile R20291] gi|260687157|ref|YP_003218291.1|; PP_02865 1e-74 Click
232791294..2791422 hypothetical; PP_02866 0.0 Click
24complement(2791607..2791813) hypothetical; PP_02867 0.0 Click
252791951..2792910 PHAGE_Spirop_R8A2B: putative transposase; PP_02868; phage(gi9626114) 3e-21 Click
26complement(2792897..2793502) hypothetical; PP_02869 0.0 Click
27complement(2793664..2794218) PHAGE_Bacill_BtCS33: integrase; PP_02870; phage(gi392972759) 4e-37 Click
282807600..2807611 attR    ACACTACAACCT 0.0 Click

Region 6, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2823694..2824299) PHAGE_Orycte_virus: FIC protein-like protein; PP_02898; phage(gi213159337) 7e-06 Click
2complement(2824901..2825200) hypothetical; PP_02899 0.0 Click
3complement(2825369..2826661) PROPHAGE_Staphy_N315: transposase; PP_02900; phage(gi15927655) 7e-62 Click
4complement(2826958..2828145) PROPHAGE_Escher_CFT073: transposase; PP_02901; phage(gi26246249) 2e-33 Click
52828347..2828856 putative cytoplasmic protein [Enterococcus faecium NRRL B-2354] gi|447911767|ref|YP_007393179.1|; PP_02902 5e-91 Click
62828956..2829606 hypothetical protein HMPREF0351_10294 [Enterococcus faecium DO] gi|389867477|ref|YP_006374900.1|; PP_02903 2e-120 Click
7complement(2829816..2830664) PHAGE_Lactob_phiAT3: putative transposase B; PP_02904; phage(gi48697274) 8e-32 Click
8complement(2830700..2830990) PHAGE_Lactob_phiAT3: putative transposase A; PP_02905; phage(gi48697273) 3e-07 Click
9complement(2831059..2832285) PROPHAGE_Staphy_N315: transposase; PP_02906; phage(gi15927655) 1e-57 Click
102832369..2833466 PROPHAGE_Staphy_N315: transposase; PP_02907; phage(gi15927655) 2e-35 Click
11complement(2833624..2834685) PROPHAGE_Staphy_N315: transposase; PP_02908; phage(gi15927655) 4e-37 Click
122834771..2835046 PHAGE_Staphy_CN125: hypothetical protein CURR004; PP_02909; phage(gi239507426) 1e-17 Click
13complement(2835043..2835195) hypothetical protein HMPREF0351_10849 [Enterococcus faecium DO] gi|389868032|ref|YP_006375455.1|; PP_02910 9e-21 Click
14complement(2835504..2836778) PROPHAGE_Escher_CFT073: transposase; PP_02911; phage(gi26246249) 3e-46 Click
152836971..2837930 PHAGE_Spirop_R8A2B: putative transposase; PP_02912; phage(gi9626114) 2e-24 Click
16complement(2837917..2838393) PHAGE_Clostr_st: putative IS transposase (OrfB); PP_02913; phage(gi80159731) 1e-52 Click
17complement(2838410..2838814) PROPHAGE_Escher_Sakai: putative transposase; PP_02914; phage(gi15834436) 6e-23 Click
18complement(2838993..2839946) PHAGE_Spirop_R8A2B: putative transposase; PP_02915; phage(gi9626114) 9e-24 Click
192840240..2840773 PHAGE_Staphy_phi2958PVL: hypothetical protein phi2958PVL_gp05; PP_02916; phage(gi209363557) 5e-26 Click
20complement(2841049..2842014) PHAGE_Lactob_A2: lysin; PP_02917; phage(gi22296540) 1e-61 Click
21complement(2842054..2842353) hypothetical protein M7W_1120 [Enterococcus faecium NRRL B-2354] gi|447912394|ref|YP_007393806.1|; PP_02918 2e-51 Click
22complement(2842359..2842589) hypothetical protein M7W_1121 [Enterococcus faecium NRRL B-2354] gi|447912395|ref|YP_007393807.1|; PP_02919 3e-33 Click
23complement(2842977..2843279) hypothetical protein HMPREF0351_10847 [Enterococcus faecium DO] gi|389868030|ref|YP_006375453.1|; PP_02920 1e-49 Click
24complement(2843276..2843833) PHAGE_Entero_phiEF24C: hypothetical protein EFP_gp160; PP_02921; phage(gi158079456) 2e-14 Click