Enterococcus faecium 1,230,933 .1, whole genome shotgun [asmbl_id: NC_000000].2951887, GC%: 37.85%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 62 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11556918..1556929 attL    AAAAATTGAAAT 0.0 Click
2complement(1558432..1559328) PHAGE_Entero_EF62phi: chromosome partitioning ATPase; PP_01577; phage(gi384519759) 1e-24 Click
3complement(1559646..1559963) hypothetical; PP_01578 0.0 Click
4complement(1560064..1561200) PHAGE_Lactoc_bIL311: integrase; PP_01579; phage(gi13095659) 6e-22 Click
51561583..1561960 PHAGE_Liberi_SC1: hypothetical protein; PP_01580; phage(gi423262485) 5e-05 Click
61561970..1561983 attL    AAAGAAGCCCATTG 0.0 Click
7complement(1562123..1562677) PHAGE_Bacill_phi105: hypothetical protein phi105_33; PP_01581; phage(gi22855026) 2e-15 Click
8complement(1562729..1563178) PHAGE_Geobac_GBSV1: immunity repressor protein; PP_01582; phage(gi115334658) 2e-11 Click
91563465..1564028 hypothetical protein Closa_2767 [Clostridium saccharolyticum WM1] gi|302387110|ref|YP_003822932.1|; PP_01583 4e-40 Click
101564291..1564596 PHAGE_Lister_A118: putative repressor protein; PP_01584; phage(gi16798819) 2e-07 Click
111564686..1564808 hypothetical; PP_01585 0.0 Click
121565111..1565518 PHAGE_Clostr_st: PemK family transcriptional regulator; PP_01586; phage(gi80159713) 3e-08 Click
131565525..1565761 PHAGE_Bacill_SPP1: hypothetical protein SPP1p083; PP_01587; phage(gi22855124) 2e-05 Click
141565879..1566502 periplasmic molybdate-binding protein [Clostridium sp. SY8519] gi|339442099|ref|YP_004708104.1|; PP_01588 5e-50 Click
151566507..1567880 PHAGE_Bacill_phBC6A52: DNA integration/recombination/invertion protein; PP_01589; phage(gi31415821) 1e-36 Click
161567965..1568270 hypothetical; PP_01590 0.0 Click
17complement(1568777..1569916) PHAGE_Lactoc_bIL309: integrase; PP_01591; phage(gi13095806) 6e-100 Click
181569957..1569970 attR    AAAGAAGCCCATTG 0.0 Click
19complement(1570215..1570850) hypothetical protein EFAU004_01464 [Enterococcus faecium Aus0004] gi|383328782|ref|YP_005354666.1|; PP_01592 7e-115 Click
20complement(1570963..1571598) PHAGE_Brocho_NF5: gp27; PP_01593; phage(gi327197612) 1e-05 Click
21complement(1571632..1572093) PHAGE_Strept_PH10: hypothetical protein PH10_gp02; PP_01594; phage(gi238821319) 3e-14 Click
22complement(1572223..1572654) PHAGE_Lactoc_bIL285: Orf3; PP_01595; phage(gi13095683) 1e-07 Click
23complement(1572672..1572992) PHAGE_Lactoc_bIL312: repressor; PP_01596; phage(gi13095896) 1e-16 Click
241573291..1574067 PHAGE_Staphy_phiMR25: putative anti-repressor protein; PP_01597; phage(gi189427129) 8e-75 Click
251574082..1574285 XRE family transcriptional regulator [Enterococcus faecium DO] gi|389868011|ref|YP_006375434.1|; PP_01598 4e-29 Click
261574301..1574639 PHAGE_Staphy_EW: ORF040; PP_01599; phage(gi66395845) 1e-10 Click
271574626..1574805 succinate dehydrogenase cytochrome b558 subunit [Enterococcus faecium DO] gi|389868013|ref|YP_006375436.1|; PP_01600 8e-27 Click
28complement(1574848..1575297) hypothetical protein HMPREF0351_10831 [Enterococcus faecium DO] gi|389868014|ref|YP_006375437.1|; PP_01601 5e-79 Click
291575405..1576103 PHAGE_Entero_phiFL3A: anti-repressor protein; PP_01602; phage(gi281416221) 5e-29 Click
301576096..1576224 hypothetical protein HMPREF0351_10833 [Enterococcus faecium DO] gi|389868016|ref|YP_006375439.1|; PP_01603 3e-18 Click
311576281..1576622 hypothetical protein HMPREF0351_10834 [Enterococcus faecium DO] gi|389868017|ref|YP_006375440.1|; PP_01604 4e-62 Click
321576615..1577286 PHAGE_Bacill_L: gp28; PP_01605; phage(gi216905993) 1e-32 Click
331577292..1577978 PHAGE_Entero_phiEf11: conserved hypothetical protein; PP_01606; phage(gi282598737) 1e-89 Click
341577981..1578730 PHAGE_Lactob_c5: putative DNA replication protein; PP_01607; phage(gi418488187) 8e-38 Click
351579017..1579181 hypothetical protein HMPREF0351_10839 [Enterococcus faecium DO] gi|389868022|ref|YP_006375445.1|; PP_01608 4e-24 Click
361579174..1579473 hypothetical protein EFAU004_02397 [Enterococcus faecium Aus0004] gi|383329714|ref|YP_005355598.1|; PP_01609 2e-48 Click
371579473..1579775 PHAGE_Entero_phiFL2A: recombinase; PP_01610; phage(gi281416510) 5e-35 Click
381579815..1580180 hypothetical; PP_01611 0.0 Click
391580670..1580810 hypothetical protein EF2835 [Enterococcus faecalis V583] gi|29377303|ref|NP_816457.1|; PP_01612 9e-10 Click
401580807..1580995 hypothetical; PP_01613 0.0 Click
411581006..1581197 hypothetical; PP_01614 0.0 Click
42complement(1581230..1581442) hypothetical; PP_01615 0.0 Click
431581570..1581770 hypothetical; PP_01616 0.0 Click
441581767..1582039 PHAGE_Entero_phiEf11: asch domain protein; PP_01617; phage(gi282598726) 5e-22 Click
451582040..1582225 hypothetical; PP_01618 0.0 Click
461582519..1582995 PHAGE_Bacill_WBeta: conserved phage protein; PP_01619; phage(gi85701424) 2e-30 Click
47complement(1583141..1583854) PHAGE_Strept_SM1: gp14; PP_01620; phage(gi32469445) 1e-27 Click
481583917..1584195 hypothetical protein EF2013 [Enterococcus faecalis V583] gi|29376528|ref|NP_815682.1|; PP_01621 7e-07 Click
491584197..1584583 PHAGE_Bacill_phBC6A52: hypothetical protein BC2580; PP_01622; phage(gi31415845) 9e-11 Click
501584742..1584960 PHAGE_Bacill_phBC6A52: endonuclease; PP_01623; phage(gi31415846) 1e-24 Click
511585072..1585524 PHAGE_Bacill_phBC6A52: Terminase small subunit; PP_01624; phage(gi31415847) 3e-29 Click
521585521..1587248 PHAGE_Bacill_phBC6A52: Terminase large subunit; PP_01625; phage(gi31415848) 0.0 Click
531587265..1587276 attR    AAAAATTGAAAT 0.0 Click
541587270..1588499 PHAGE_Bacill_phBC6A52: Portal protein; PP_01626; phage(gi31415850) 6e-141 Click
551588471..1589040 PHAGE_Clostr_phi3626: putative prohead protease; PP_01627; phage(gi20065968) 3e-38 Click
561589053..1590417 PHAGE_Bacill_phBC6A52: prohead protease; PP_01628; phage(gi31415852) 3e-124 Click
571590419..1590697 PHAGE_Bacill_phBC6A52: hypothetical protein BC2588; PP_01629; phage(gi31415853) 4e-22 Click
581590720..1591004 PHAGE_Bacill_phBC6A52: hypothetical protein BC2589; PP_01630; phage(gi31415854) 2e-07 Click
591590994..1591332 PHAGE_Bacill_phBC6A52: hypothetical protein BC2590; PP_01631; phage(gi31415855) 2e-23 Click
601591322..1591687 PHAGE_Bacill_phBC6A52: hypothetical protein BC2591; PP_01632; phage(gi31415856) 1e-18 Click
611591694..1592320 PHAGE_Bacill_phBC6A52: hypothetical protein BC2592; PP_01633; phage(gi31415857) 6e-19 Click
621592320..1592784 PHAGE_Bacill_phBC6A52: hypothetical protein BC2593; PP_01634; phage(gi31415858) 7e-17 Click
631592979..1595288 PHAGE_Lister_2389: tail tape measure protein; PP_01635; phage(gi17488515) 2e-108 Click
641595285..1596004 PHAGE_Clostr_PhiS63: gp14; PP_01636; phage(gi388570643) 6e-08 Click
651596001..1598760 PHAGE_Bacill_phBC6A52: endopeptidase; PP_01637; phage(gi31415861) 8e-49 Click
661598773..1599078 PHAGE_Lactoc_bIL285: Orf55; PP_01638; phage(gi13095735) 2e-05 Click

Region 2, total : 61 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11614056..1616701 PHAGE_Megavi_lba: isoleucyl-tRNA synthetase; PP_01655; phage(gi448825309) 7e-52 Click
21616877..1617011 hypothetical protein M7W_2195 [Enterococcus faecium NRRL B-2354] gi|447913447|ref|YP_007394859.1|; PP_01656 3e-17 Click
31617011..1618324 Dihydrofolate synthase, Folylpolyglutamate synthase [Enterococcus faecium NRRL B-2354] gi|447913446|ref|YP_007394858.1|; PP_01657 0.0 Click
41618314..1618967 PHAGE_Parame_FR483: hypothetical protein FR483_N177L; PP_01658; phage(gi155370275) 5e-08 Click
51619284..1619295 attL    TGATCGAATTAG 0.0 Click
6complement(1619588..1620940) PHAGE_Entero_phiFL1A: integrase; PP_01659; phage(gi281416324) 3e-142 Click
7complement(1621006..1622295) PHAGE_Strept_1: hypothetical protein EJ-1p03; PP_01660; phage(gi39653677) 4e-99 Click
8complement(1622382..1623086) PHAGE_Brocho_NF5: gp28; PP_01661; phage(gi327197613) 1e-42 Click
91623286..1623552 PHAGE_Staphy_vB_SepiS_phiIPLA7: DNA binding protein; PP_01662; phage(gi399529151) 8e-15 Click
101623565..1623723 hypothetical protein Thit_1411 [Thermoanaerobacter italicus Ab9] gi|289578604|ref|YP_003477231.1|; PP_01663 1e-08 Click
11complement(1623720..1623950) hypothetical protein Desca_0282 [Desulfotomaculum carboxydivorans CO-1-SRB] gi|333922518|ref|YP_004496098.1|; PP_01664 6e-20 Click
121624022..1624177 hypothetical; PP_01665 0.0 Click
131624334..1624489 hypothetical protein SAG0549 [Streptococcus agalactiae 2603V/R] gi|22536727|ref|NP_687578.1|; PP_01666 2e-11 Click
14complement(1624486..1624710) hypothetical protein Sinf_0767 [Streptococcus infantarius subsp. infantarius CJ18] gi|379705120|ref|YP_005203579.1|; PP_01667 7e-31 Click
151624788..1624916 hypothetical; PP_01668 0.0 Click
161624977..1625312 hypothetical protein EF2135 [Enterococcus faecalis V583] gi|29376644|ref|NP_815798.1|; PP_01669 1e-21 Click
171625309..1625476 hypothetical; PP_01670 0.0 Click
181625545..1626486 PHAGE_Entero_phiFL1A: endonuclease YqaJ superfamily; PP_01671; phage(gi281416339) 9e-149 Click
191626488..1627378 PHAGE_Entero_phiFL1A: RecT family protein; PP_01672; phage(gi281416340) 8e-142 Click
201627421..1628221 PHAGE_Lactob_Lrm1: DNA replication protein; PP_01673; phage(gi195661236) 2e-68 Click
211628236..1629087 PHAGE_Lactoc_r1t: putative replication protein DnaC; PP_01674; phage(gi23455731) 7e-22 Click
221629084..1629443 PHAGE_Lactoc_bIL286: Orf19; PP_01675; phage(gi13095762) 2e-20 Click
231629458..1629619 hypothetical protein M7W_2064 [Enterococcus faecium NRRL B-2354] gi|447913320|ref|YP_007394732.1|; PP_01676 1e-20 Click
241629622..1629942 hypothetical protein HMPREF0351_10842 [Enterococcus faecium DO] gi|389868025|ref|YP_006375448.1|; PP_01677 3e-12 Click
251629939..1630754 PHAGE_Entero_phiEF24C: putative anti-proliferative protein; PP_01678; phage(gi158079503) 6e-98 Click
261630756..1630881 hypothetical; PP_01679 0.0 Click
271630893..1631204 PHAGE_Entero_phiFL1A: DNA binding protein; PP_01680; phage(gi281416342) 2e-28 Click
281631201..1631431 hypothetical; PP_01681 0.0 Click
291631438..1631641 hypothetical protein EFAU004_02390 [Enterococcus faecium Aus0004] gi|383329707|ref|YP_005355591.1|; PP_01682 1e-26 Click
301631638..1631937 ArpT [Enterococcus faecium Aus0004] gi|383329706|ref|YP_005355590.1|; PP_01683 7e-47 Click
311631927..1632091 hypothetical; PP_01684 0.0 Click
321632180..1632593 PHAGE_Entero_phiFL1A: transcriptional regulator ArpU family; PP_01685; phage(gi281416357) 7e-59 Click
331632606..1632992 PHAGE_Strept_O1205: hypothetical protein O1205p22; PP_01686; phage(gi23455870) 2e-31 Click
341633543..1633767 hypothetical protein EF62_1378 [Enterococcus faecalis 62] gi|384518050|ref|YP_005705355.1|; PP_01687 5e-16 Click
351633785..1634213 hypothetical protein [Clostridium sp. BNL1100] gi|376261696|ref|YP_005148416.1|; PP_01688 1e-21 Click
361634191..1635609 PHAGE_Lactoc_1: TerL; PP_01689; phage(gi13786562) 4e-121 Click
371635621..1637156 PHAGE_Deep_s_D6E: portal protein; PP_01690; phage(gi423262330) 8e-39 Click
381637125..1638114 PHAGE_Entero_phiFL1A: phage head protein; PP_01691; phage(gi281416365) 2e-19 Click
391638116..1638433 hypothetical protein EFD32_1668 [Enterococcus faecalis D32] gi|397700243|ref|YP_006538031.1|; PP_01692 7e-05 Click
401638393..1638563 hypothetical; PP_01693 0.0 Click
411638566..1639183 PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp45; PP_01694; phage(gi122891829) 3e-06 Click
421639198..1640088 PHAGE_Pseudo_UFV_P2: major head protein; PP_01695; phage(gi410491826) 7e-13 Click
431640164..1640325 hypothetical protein EF2010 [Enterococcus faecalis V583] gi|29376525|ref|NP_815679.1|; PP_01696 6e-12 Click
441640337..1640678 hypothetical protein EFD32_1664 [Enterococcus faecalis D32] gi|397700239|ref|YP_006538027.1|; PP_01697 3e-22 Click
451640678..1641049 PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp11; PP_01698; phage(gi90592647) 6e-10 Click
461641042..1641437 PHAGE_Clostr_phiC2: hypothetical protein phiC2p11; PP_01699; phage(gi134287346) 9e-05 Click
471641439..1641816 hypothetical protein EF2006 [Enterococcus faecalis V583] gi|29376522|ref|NP_815676.1|; PP_01700 5e-29 Click
481641817..1642425 PHAGE_Clostr_phi3626: major tail protein; PP_01701; phage(gi20065974) 4e-11 Click
491642425..1642766 hypothetical protein EF2004 [Enterococcus faecalis V583] gi|29376520|ref|NP_815674.1|; PP_01702 4e-21 Click
501642981..1645797 PHAGE_Entero_1: type measure protein; PP_01703; phage(gi225626385) 2e-88 Click
511645787..1646527 PHAGE_Clostr_phiCD38_2: tail component protein; PP_01704; phage(gi333798124) 2e-13 Click
521646524..1649235 PHAGE_Lactoc_bIL285: endopeptidase; PP_01705; phage(gi13095734) 0.0 Click
531649248..1649496 PHAGE_Lactoc_ul36: structural protein; PP_01706; phage(gi21716124) 5e-05 Click
541649456..1649653 hypothetical; PP_01707 0.0 Click
551649646..1649786 PHAGE_Staphy_IPLA88: hypothetical protein SauSIPLA88_gp56; PP_01708; phage(gi215401226) 5e-06 Click
561649856..1650275 PHAGE_Entero_EF62phi: holin; PP_01709; phage(gi384519787) 1e-47 Click
571650272..1651282 PHAGE_Lactob_A2: lysin; PP_01710; phage(gi22296540) 2e-60 Click
581651397..1651528 hypothetical; PP_01711 0.0 Click
591651534..1652604 hypothetical protein SP_1145 [Streptococcus pneumoniae TIGR4] gi|15901011|ref|NP_345615.1|; PP_01712 4e-54 Click
601652588..1652758 hypothetical; PP_01713 0.0 Click
611653013..1653086 tRNA 0.0 Click
621653502..1653627 DNA repair protein RadC [Enterococcus faecium DO] gi|389869365|ref|YP_006376788.1|; PP_01714 4e-16 Click
631653777..1653977 PHAGE_Lactoc_bIL312: Csp; PP_01715; phage(gi13095918) 4e-23 Click
64complement(1654234..1655913) PHAGE_Brocho_NF5: gp36; PP_01716; phage(gi327197621) 2e-05 Click
651661502..1661513 attR    TGATCGAATTAG 0.0 Click

Region 3, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11689055..1689075 attL    TGTATGCCATATTGTATGCCA 0.0 Click
2complement(1689077..1690222) PROPHAGE_Oceano_HTE831: integrase; PP_01751; phage(gi23097608) 7e-64 Click
3complement(1690283..1690930) PHAGE_Lactoc_bIL311: repressor; PP_01752; phage(gi13095660) 8e-12 Click
41691124..1691417 hypothetical protein HMPREF0351_12143 [Enterococcus faecium DO] gi|389869326|ref|YP_006376749.1|; PP_01753 7e-49 Click
51691461..1691772 hypothetical protein HMPREF0351_12142 [Enterococcus faecium DO] gi|389869325|ref|YP_006376748.1|; PP_01754 9e-50 Click
61691769..1692008 PHAGE_Haemop_Aaphi23: putative antirepressor protein Ant; PP_01755; phage(gi31544021) 2e-06 Click
71691989..1692393 bacteriophage antirepressor protein [Enterococcus faecium DO] gi|389869323|ref|YP_006376746.1|; PP_01756 6e-70 Click
81692534..1692692 hypothetical protein HMPREF0351_12139 [Enterococcus faecium DO] gi|389869322|ref|YP_006376745.1|; PP_01757 6e-22 Click
91692693..1693055 hypothetical protein HMPREF0351_12138 [Enterococcus faecium DO] gi|389869321|ref|YP_006376744.1|; PP_01758 7e-63 Click
101693092..1693940 PHAGE_Lactoc_bIL310: hypothetical protein bIL310p24; PP_01759; phage(gi13095885) 1e-22 Click
111693930..1695405 PHAGE_Staphy_2638A: ORF003; PP_01760; phage(gi66395453) 5e-68 Click
121695671..1696078 hypothetical protein HMPREF0351_12135 [Enterococcus faecium DO] gi|389869318|ref|YP_006376741.1|; PP_01761 1e-72 Click
131696081..1696296 group 1 glycosyl transferase [Enterococcus faecium DO] gi|389869317|ref|YP_006376740.1|; PP_01762 2e-35 Click
141696367..1696489 hypothetical; PP_01763 0.0 Click
151696814..1696969 hypothetical protein HMPREF0351_12132 [Enterococcus faecium DO] gi|389869315|ref|YP_006376738.1|; PP_01764 1e-21 Click
161697038..1697511 PHAGE_Burkho_phiE125: putative terminase (small subunit); PP_01765; phage(gi17975162) 4e-13 Click
171697508..1699202 PHAGE_Lactob_LF1: bacteriophage terminase large subunit; PP_01766; phage(gi418489385) 9e-124 Click
181699357..1700532 PHAGE_Entero_EFRM31: portal protein; PP_01767; phage(gi327198113) 9e-56 Click
191700525..1702048 PHAGE_Entero_EFRM31: major capsid protein; PP_01768; phage(gi327198115) 8e-50 Click
201702105..1702389 PHAGE_Entero_EFRM31: head-tail joining protein; PP_01769; phage(gi327198117) 8e-09 Click
211702376..1702711 PHAGE_Entero_EFRM31: head-tail adaptor protein; PP_01770; phage(gi327198118) 2e-14 Click
221703659..1703679 attR    TGTATGCCATATTGTATGCCA 0.0 Click

Region 4, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2719255..2720163) PROPHAGE_Shewan_MR-1: ISSod6, transposase; PP_02787; phage(gi24374783) 5e-05 Click
2complement(2720242..2720784) permease [Enterococcus faecalis V583] gi|29376398|ref|NP_815552.1|; PP_02788 3e-92 Click
32721280..2721576 hypothetical protein BAMEG_B0117 [Bacillus anthracis str. CDC 684] gi|227811426|ref|YP_002808788.1|; PP_02789 1e-08 Click
42721578..2722000 hypothetical; PP_02790 0.0 Click
52722145..2722957 PHAGE_Parame_AR158: hypothetical protein AR158_C785L; PP_02791; phage(gi157953975) 5e-12 Click
6complement(2722954..2723688) PHAGE_Acanth_1: hypothetical protein ATCV1_Z300R; PP_02792; phage(gi155371247) 2e-32 Click
72723712..2724071 PHAGE_Lactob_phiAT3: putative transposase A; PP_02793; phage(gi48697273) 7e-07 Click
82724107..2724772 PROPHAGE_Escher_CFT073: transposase insF; PP_02794; phage(gi26249410) 6e-17 Click
92724778..2725359 PHAGE_Clostr_st: putative IS transposase (OrfB); PP_02795; phage(gi80159731) 2e-48 Click
102725567..2725857 PHAGE_Lactob_phiAT3: putative transposase A; PP_02796; phage(gi48697273) 3e-07 Click
112725893..2726321 PROPHAGE_Escher_CFT073: transposase insF; PP_02797; phage(gi26249410) 2e-16 Click
122726381..2726785 PROPHAGE_Escher_CFT073: transposase; PP_02798; phage(gi26246249) 7e-19 Click
132726804..2727076 PROPHAGE_Escher_CFT073: transposase; PP_02799; phage(gi26246249) 2e-05 Click
14complement(2727137..2727823) PHAGE_Spirop_R8A2B: putative transposase; PP_02800; phage(gi9626114) 3e-20 Click
152727942..2728679 rRNA adenine N-6-methyltransferase [Staphylococcus pseudintermedius ED99] gi|386319727|ref|YP_006015890.1|; PP_02801 2e-137 Click
162729301..2729465 PHAGE_Entero_EF62phi: hypothetical protein; PP_02802; phage(gi384519768) 2e-19 Click
172729485..2730189 PHAGE_Clostr_st: putative IS transposase (OrfB); PP_02803; phage(gi80159731) 2e-53 Click
182730313..2730510 PHAGE_Lactoc_bIL312: Csp; PP_02804; phage(gi13095918) 2e-25 Click
19complement(2730705..2731412) polymerase and histidinol phosphatase domain-containing protein [Enterococcus faecium DO] gi|389869102|ref|YP_006376525.1|; PP_02805 2e-114 Click
202731493..2731618 transposase, insertion sequence element IS905 family protein [Enterococcus faecalis 62] gi|384517612|ref|YP_005704917.1|; PP_02806 5e-16 Click
212731944..2732060 hypothetical; PP_02807 0.0 Click
222732138..2732689 PHAGE_Clostr_phiCD38_2: recombinase/resolvase; PP_02808; phage(gi333798162) 2e-11 Click
232732740..2732812 tRNA 0.0 Click
242732816..2732888 tRNA 0.0 Click
252732896..2732977 tRNA 0.0 Click
262732995..2733067 tRNA 0.0 Click
272733079..2733150 tRNA 0.0 Click
282733167..2733252 tRNA 0.0 Click
292733263..2733336 tRNA 0.0 Click
30complement(2733302..2733868) PROPHAGE_Escher_CFT073: transposase; PP_02809; phage(gi26246249) 2e-28 Click
31complement(2733958..2734341) PHAGE_Spirop_R8A2B: putative transposase; PP_02810; phage(gi9626114) 2e-09 Click
32complement(2734521..2735123) PROPHAGE_Escher_CFT073: transposase; PP_02811; phage(gi26246249) 2e-29 Click

Region 5, total : 35 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12845124..2845136 attL    TATAAAATATTAA 0.0 Click
22845519..2846073 PHAGE_Bacill_BtCS33: integrase; PP_02943; phage(gi392972759) 4e-37 Click
32846129..2846839 hypothetical protein SMU_1160c [Streptococcus mutans UA159] gi|24379591|ref|NP_721546.1|; PP_02944 4e-05 Click
4complement(2846826..2847842) PHAGE_Spirop_R8A2B: putative transposase; PP_02945; phage(gi9626114) 1e-20 Click
52847966..2848508 hypothetical protein CDR20291_1801 [Clostridium difficile R20291] gi|260687157|ref|YP_003218291.1|; PP_02946 1e-74 Click
62848664..2849080 thioredoxin family protein [Enterococcus faecalis V583] gi|29376401|ref|NP_815555.1|; PP_02947 1e-60 Click
72849377..2850546 permease family protein [Enterococcus faecalis 62] gi|384518882|ref|YP_005706187.1|; PP_02948 0.0 Click
82850556..2851212 PHAGE_Plankt_PaV_LD: ABC transporter; PP_02949; phage(gi371496158) 6e-26 Click
92851212..2851745 permease [Enterococcus faecalis V583] gi|29376398|ref|NP_815552.1|; PP_02950 2e-87 Click
10complement(2851701..2852663) PHAGE_Strept_7201: ORF4; PP_02951; phage(gi9634630) 8e-18 Click
11complement(2853012..2853338) hypothetical; PP_02952 0.0 Click
12complement(2853325..2854113) PHAGE_Natria_PhiCh1: putative plasmid partitioning protein Soj; PP_02953; phage(gi22091150) 2e-23 Click
13complement(2854429..2854770) hypothetical; PP_02954 0.0 Click
14complement(2854906..2855085) hypothetical protein EHR_3115 [Enterococcus hirae ATCC 9790] gi|340620761|ref|YP_004739213.1|; PP_02955 3e-16 Click
15complement(2855082..2855432) DNA-directed RNA polymerase beta subunit [Enterococcus faecium NRRL B-2354] gi|447912390|ref|YP_007393802.1|; PP_02956 4e-58 Click
16complement(2855425..2856750) PHAGE_Bacill_SPBc2: IMPB/MUCB/SAMB family protein; PP_02957; phage(gi9630142) 4e-78 Click
172857602..2857739 hypothetical; PP_02958 0.0 Click
18complement(2857853..2858230) PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp44; PP_02959; phage(gi90592680) 4e-17 Click
19complement(2858276..2858464) PHAGE_Entero_EF62phi: ycfA-like family protein, putative toxin component; PP_02960; phage(gi384519802) 1e-14 Click
202858656..2859177 PHAGE_Lactoc_bIL311: repressor; PP_02961; phage(gi13095660) 1e-13 Click
212859372..2860268 PHAGE_Lactoc_bIL311: repressor; PP_02962; phage(gi13095660) 2e-13 Click
222860317..2861699 PHAGE_Thermo_THSA_485A: transcriptional regulator, XRE family; PP_02963; phage(gi397912657) 1e-12 Click
232861713..2862495 PHAGE_Lactoc_bIL311: repressor; PP_02964; phage(gi13095660) 7e-13 Click
242862535..2863146 PHAGE_Ralsto_RSM3: hypothetical protein RSM3_gp14; PP_02965; phage(gi209901327) 6e-16 Click
252863306..2863422 hypothetical; PP_02966 0.0 Click
262863590..2863739 hypothetical; PP_02967 0.0 Click
272863748..2863897 hypothetical; PP_02968 0.0 Click
28complement(2864136..2864264) hypothetical; PP_02969 0.0 Click
292864263..2864610 putative transposase [Staphylococcus aureus subsp. aureus ED133] gi|384548863|ref|YP_005738116.1|; PP_02970 2e-21 Click
302864598..2864834 transposase [Clostridium sp. BNL1100] gi|376260273|ref|YP_005146993.1|; PP_02971 9e-12 Click
312864867..2865457 PROPHAGE_Escher_MG1655: IS150 transposase B; PP_02972; phage(gi16131429) 1e-29 Click
32complement(2865542..2868466) PROPHAGE_Xantho_33913: Tn5041 transposase; PP_02973; phage(gi21231545) 3e-40 Click
332868612..2869187 PHAGE_Entero_P1: Cin; PP_02974; phage(gi46401653) 9e-22 Click
342869238..2869250 attR    TATAAAATATTAA 0.0 Click
352869401..2870096 Vancomycin response regulator VanR [Bacillus cereus F837/76] gi|376267122|ref|YP_005119834.1|; PP_02975 7e-120 Click
362870134..2871228 PHAGE_Ectoca_1: EsV-1-65; PP_02976; phage(gi13242537) 1e-08 Click
372871443..2872411 PHAGE_Parame_1: hypothetical protein; PP_02977; phage(gi9631622) 6e-42 Click