Enterococcus faecalis ARO1/DG strain AR01/DG .1, whole genome [asmbl_id: NC_000000].2821089, GC%: 37.55%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 61 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1513023..513367 PHAGE_Entero_phiFL3A: ribosomal protein; PP_00479; phage(gi281416258) 4e-05 Click
2513380..513667 50S ribosomal protein L27 [Enterococcus faecalis V583] gi|29375553|ref|NP_814707.1|; PP_00480 1e-47 Click
3513729..513743 attL    TTTGACCATACTTTT 0.0 Click
4complement(513755..514909) PROPHAGE_Oceano_HTE831: integrase; PP_00481; phage(gi23097608) 4e-76 Click
5complement(514975..515442) putative lipoprotein [Enterococcus faecalis 62] gi|384518023|ref|YP_005705328.1|; PP_00482 4e-85 Click
6complement(515484..515963) PHAGE_Bacill_phi105: hypothetical protein phi105_33; PP_00483; phage(gi22855026) 3e-14 Click
7complement(515975..516400) PHAGE_Bacill_BCJA1c: repressor; PP_00484; phage(gi56694874) 8e-32 Click
8516635..516835 PHAGE_Lactoc_bIL312: repressor; PP_00485; phage(gi13095896) 2e-09 Click
9516848..517132 hypothetical protein EF62_1354 [Enterococcus faecalis 62] gi|384518027|ref|YP_005705332.1|; PP_00486 9e-47 Click
10517147..517869 PHAGE_Entero_phiFL3A: anti-repressor protein; PP_00487; phage(gi281416221) 1e-46 Click
11complement(517903..518085) prophage Lp2 protein 14 domain protein [Enterococcus faecalis D32] gi|397700267|ref|YP_006538055.1|; PP_00488 3e-26 Click
12518138..518314 PHAGE_Entero_phiFL3A: hypothetical protein; PP_00489; phage(gi281416225) 8e-25 Click
13518321..518494 PHAGE_Entero_phiFL3A: hypothetical protein; PP_00490; phage(gi281416229) 4e-24 Click
14518551..518874 PHAGE_Entero_phiFL3A: hypothetical protein; PP_00491; phage(gi281416230) 2e-51 Click
15518874..519101 PHAGE_Entero_phiFL2A: hypothetical protein; PP_00492; phage(gi281416504) 2e-36 Click
16519086..519199 PHAGE_Entero_phiFL2A: hypothetical protein; PP_00493; phage(gi281416505) 6e-12 Click
17519196..519471 hypothetical; PP_00494 0.0 Click
18complement(519433..519810) hypothetical; PP_00495 0.0 Click
19519883..520824 PHAGE_Entero_phiFL3A: endonuclease YqaJ superfamily; PP_00496; phage(gi281416231) 6e-164 Click
20520827..521717 PHAGE_Entero_phiFL3A: RecT family protein; PP_00497; phage(gi281416232) 1e-151 Click
21521731..522690 PHAGE_Entero_phiFL3A: recombinase; PP_00498; phage(gi281416233) 6e-178 Click
22522694..522993 PHAGE_Entero_phiFL3A: ArpR DNA binding protein; PP_00499; phage(gi281416235) 9e-45 Click
23523011..523436 PHAGE_Entero_phiFL3A: resolvase; PP_00500; phage(gi281416236) 2e-65 Click
24523433..524194 PHAGE_Entero_phiFL3A: hypothetical protein; PP_00501; phage(gi281416237) 4e-105 Click
25524187..524330 PHAGE_Entero_phiFL1A: hypothetical protein; PP_00502; phage(gi281416345) 7e-19 Click
26complement(524337..524450) hypothetical protein EF62_1371 [Enterococcus faecalis 62] gi|384518044|ref|YP_005705349.1|; PP_00503 7e-12 Click
27524766..524972 hypothetical protein EF2123 [Enterococcus faecalis V583] gi|29376632|ref|NP_815786.1|; PP_00504 8e-29 Click
28524976..525170 hypothetical; PP_00505 0.0 Click
29525183..525407 hypothetical protein EF2121 [Enterococcus faecalis V583] gi|29376630|ref|NP_815784.1|; PP_00506 2e-33 Click
30525460..525918 PHAGE_Entero_EF62phi: hypothetical protein; PP_00507; phage(gi384519769) 2e-34 Click
31525930..526649 PHAGE_Entero_phiFL3A: hypothetical protein; PP_00508; phage(gi281416245) 4e-10 Click
32526832..527065 PHAGE_Entero_phiFL3A: hypothetical protein; PP_00509; phage(gi281416246) 1e-11 Click
33527152..527271 hypothetical protein EF62_1375 [Enterococcus faecalis 62] gi|384518048|ref|YP_005705353.1|; PP_00510 3e-15 Click
34527264..527680 PHAGE_Entero_phiFL3A: transcriptional regulator; PP_00511; phage(gi281416247) 1e-61 Click
35528065..528136 tRNA 0.0 Click
36528502..528735 hypothetical protein EF62_1378 [Enterococcus faecalis 62] gi|384518050|ref|YP_005705355.1|; PP_00512 2e-38 Click
37528738..530072 PHAGE_Entero_phiFL3A: DNA adenine methyltransferase; PP_00513; phage(gi281416249) 0.0 Click
38530110..530301 PHAGE_Entero_phiFL3A: hypothetical protein; PP_00514; phage(gi281416250) 2e-27 Click
39530438..530626 PHAGE_Entero_phiFL3A: hypothetical protein; PP_00515; phage(gi281416251) 9e-27 Click
40530712..531386 PHAGE_Entero_phiFL3A: terminase small subunit; PP_00516; phage(gi281416253) 3e-06 Click
41531433..532290 PHAGE_Entero_phiFL3A: terminase small subunit; PP_00517; phage(gi281416254) 5e-31 Click
42532271..533560 PHAGE_Lactob_Lj965: putative terminase large subunit; PP_00518; phage(gi41179257) 1e-166 Click
43533560..535044 PHAGE_Lactoc_ul36: putative portal protein; PP_00519; phage(gi21716109) 2e-89 Click
44535037..535963 PHAGE_Lactoc_1: ORF33; PP_00520; phage(gi13786564) 5e-64 Click
45536086..536721 PHAGE_Entero_phiEf11: putative phage scaffold protein; PP_00521; phage(gi282598711) 4e-16 Click
46536735..537631 PHAGE_Lactob_H: major capsid protein gp34; PP_00522; phage(gi148750840) 9e-71 Click
47537702..538034 PHAGE_Staphy_TEM123: head-tail connector proteins; PP_00523; phage(gi388570344) 7e-11 Click
48538154..538306 hypothetical protein EF62_1390, partial [Enterococcus faecalis 62] gi|384518062|ref|YP_005705367.1|; PP_00524 7e-21 Click
49538303..538641 PHAGE_Lactob_Lj928: putative major tail protein; PP_00525; phage(gi41179323) 1e-11 Click
50538638..539030 PHAGE_Lactob_Lj928: hypothetical protein Ljo_1429; PP_00526; phage(gi41179324) 3e-14 Click
51539049..539654 PHAGE_Entero_phiEf11: phage major tail protein; PP_00527; phage(gi282598708) 5e-20 Click
52539657..539965 PHAGE_Entero_phiEf11: putative phage major tail protein; PP_00528; phage(gi282598736) 1e-12 Click
53540028..540426 PHAGE_Entero_phiEf11: putative phage protein; PP_00529; phage(gi282598743) 5e-08 Click
54540495..540800 hypothetical protein EF62_1396 [Enterococcus faecalis 62] gi|384518068|ref|YP_005705373.1|; PP_00530 4e-50 Click
55540787..545241 PHAGE_Strept_phi3396: putative phage-related tail tape measure protein; PP_00531; phage(gi126011107) 5e-93 Click
56545238..545960 PHAGE_Strept_5093: hypothetical protein st5093phage_28; PP_00532; phage(gi238801908) 1e-43 Click
57545960..547405 PHAGE_Clostr_phi8074_B1: putative phage tail protein; PP_00533; phage(gi431810378) 4e-25 Click
58547420..548151 hypothetical protein EF62_1400 [Enterococcus faecalis 62] gi|384518072|ref|YP_005705377.1|; PP_00534 4e-135 Click
59548169..548648 PHAGE_Entero_1: host specificity protein; PP_00535; phage(gi225626383) 4e-09 Click
60548662..549057 hypothetical protein EF62_1402 [Enterococcus faecalis 62] gi|384518074|ref|YP_005705379.1|; PP_00536 5e-70 Click
61549059..549196 hypothetical protein EF2805 [Enterococcus faecalis V583] gi|29377276|ref|NP_816430.1|; PP_00537 2e-15 Click
62549226..549630 PHAGE_Strept_3: putative holin protein; PP_00538; phage(gi28876267) 5e-28 Click
63549614..550447 PHAGE_Brocho_NF5: gp23; PP_00539; phage(gi327197608) 1e-70 Click
64551628..551642 attR    TTTGACCATACTTTT 0.0 Click

Region 2, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1862109..863995 PHAGE_Strept_YMC_2011: lpxtg cell wall surface protein, collagen binding domain protein; PP_00834; phage(gi399498696) 6e-05 Click
2864201..864674 hypothetical protein OG1RF_11038 [Enterococcus faecalis OG1RF] gi|384513002|ref|YP_005708095.1|; PP_00835 1e-82 Click
3864818..866017 transcription elongation factor NusA [Enterococcus faecalis V583] gi|29375840|ref|NP_814994.1|; PP_00836 0.0 Click
4866038..866337 hypothetical protein EF1272 [Enterococcus faecalis V583] gi|29375841|ref|NP_814995.1|; PP_00837 3e-50 Click
5866327..866632 50S ribosomal protein L7A family protein [Enterococcus faecalis V583] gi|29375842|ref|NP_814996.1|; PP_00838 8e-49 Click
6866645..869038 PHAGE_Cafete_BV_PW1: putative eIF-2/eIF-5B; PP_00839; phage(gi310831102) 2e-23 Click
7869063..869413 ribosome-binding factor A [Enterococcus faecalis V583] gi|29375844|ref|NP_814998.1|; PP_00840 6e-59 Click
8complement(869786..870259) PHAGE_Entero_phiEf11: conserved hypothetical protein; PP_00841; phage(gi282598746) 3e-62 Click
9complement(870306..870788) PHAGE_Entero_phiEf11: cI-like repressor; PP_00842; phage(gi282598745) 9e-21 Click
10871005..871139 hypothetical protein EF1278 [Enterococcus faecalis V583] gi|29375847|ref|NP_815001.1|; PP_00843 3e-14 Click
11871170..871313 PHAGE_Brocho_NF5: gp37; PP_00844; phage(gi327197622) 3e-12 Click
12871317..871940 PHAGE_Lactob_AQ113: DNA replication protein; PP_00845; phage(gi446730274) 1e-15 Click
13871959..872801 PHAGE_Entero_EF62phi: D replication protein DC; PP_00846; phage(gi384519773) 1e-26 Click
14872889..873260 hypothetical protein EF1282 [Enterococcus faecalis V583] gi|29375851|ref|NP_815005.1|; PP_00847 1e-64 Click
15873280..873687 PHAGE_Lactob_Sha1: phage transcriptional activator RinA; PP_00848; phage(gi418489798) 2e-18 Click
16873933..874325 PHAGE_Entero_phiEf11: putative major structural protein; PP_00849; phage(gi282598740) 9e-08 Click
17874338..874850 PHAGE_Strept_TP_J34: putative major tail protein; PP_00850; phage(gi444475914) 1e-38 Click
18874885..875244 PHAGE_Strept_858: orf17; PP_00851; phage(gi168229290) 3e-12 Click
19875262..875630 PHAGE_Lactoc_Tuc2009: hypothetical protein Tuc2009_45; PP_00852; phage(gi13487846) 1e-10 Click
20875620..878553 PHAGE_Strept_Dp_1: TMP; PP_00853; phage(gi327198366) 3e-122 Click
21878555..879481 PHAGE_Entero_phiEf11: putative phage tail protein; PP_00854; phage(gi282598752) 6e-147 Click
22879494..880951 PHAGE_Entero_phiEf11: putative phage structural protein; PP_00855; phage(gi282598760) 1e-172 Click
23880984..882753 PHAGE_Entero_phiEf11: conserved hypothetical protein; PP_00856; phage(gi282598748) 0.0 Click
24882777..883172 PHAGE_Entero_EF62phi: holin; PP_00857; phage(gi384519787) 5e-38 Click
25883318..884415 PHAGE_Lister_A511: gp79; PP_00858; phage(gi157325034) 9e-39 Click

Region 3, total : 54 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12014701..2014725 attL    TAAATTATTTAGTTTCACGGTGTAA 0.0 Click
2complement(2016648..2017949) PHAGE_Entero_phiFL4A: endolysin; PP_01912; phage(gi281416489) 0.0 Click
3complement(2017952..2018158) PHAGE_Entero_phiEf11: phage holin; PP_01913; phage(gi282598749) 3e-31 Click
4complement(2018161..2018394) PHAGE_Entero_phiFL4A: holin; PP_01914; phage(gi281416487) 2e-26 Click
5complement(2018429..2018566) hypothetical protein EF2805 [Enterococcus faecalis V583] gi|29377276|ref|NP_816430.1|; PP_01915 6e-17 Click
6complement(2018568..2018963) hypothetical protein EF62_1402 [Enterococcus faecalis 62] gi|384518074|ref|YP_005705379.1|; PP_01916 7e-68 Click
7complement(2018977..2019468) PHAGE_Entero_1: host specificity protein; PP_01917; phage(gi225626383) 1e-06 Click
8complement(2019468..2019755) PHAGE_Weisse_phiYS61: putative tail fiber protein; PP_01918; phage(gi399528395) 4e-09 Click
9complement(2019752..2020348) PHAGE_Ralsto_RSL1: unnamed protein product; PP_01919; phage(gi189426961) 9e-11 Click
10complement(2020341..2021222) PHAGE_Lactoc_bIL285: Orf55; PP_01920; phage(gi13095735) 6e-17 Click
11complement(2021241..2024036) PHAGE_Bacill_phBC6A52: endopeptidase; PP_01921; phage(gi31415861) 1e-45 Click
12complement(2024033..2024746) PHAGE_Clostr_phiCP26F: putative phage tail component; PP_01922; phage(gi422933966) 2e-05 Click
13complement(2024743..2027046) PHAGE_Staphy_P954: tail length tape measure protein; PP_01923; phage(gi257136415) 9e-133 Click
14complement(2027238..2027693) PHAGE_Bacill_phBC6A52: hypothetical protein BC2593; PP_01924; phage(gi31415858) 6e-15 Click
15complement(2027693..2028328) PHAGE_Bacill_phBC6A52: hypothetical protein BC2592; PP_01925; phage(gi31415857) 2e-19 Click
16complement(2028334..2028696) PHAGE_Bacill_phBC6A52: hypothetical protein BC2591; PP_01926; phage(gi31415856) 4e-16 Click
17complement(2028686..2029024) PHAGE_Bacill_phBC6A52: hypothetical protein BC2590; PP_01927; phage(gi31415855) 2e-27 Click
18complement(2029014..2029298) PHAGE_Bacill_phBC6A52: hypothetical protein BC2589; PP_01928; phage(gi31415854) 4e-09 Click
19complement(2029318..2029599) PHAGE_Bacill_phBC6A52: hypothetical protein BC2588; PP_01929; phage(gi31415853) 6e-23 Click
20complement(2029601..2030962) PHAGE_Bacill_phBC6A52: prohead protease; PP_01930; phage(gi31415852) 1e-127 Click
21complement(2030975..2031547) PHAGE_Clostr_phi3626: putative prohead protease; PP_01931; phage(gi20065968) 1e-33 Click
22complement(2031519..2032745) PHAGE_Bacill_phBC6A52: Portal protein; PP_01932; phage(gi31415850) 2e-141 Click
23complement(2032769..2034496) PHAGE_Bacill_phBC6A52: Terminase large subunit; PP_01933; phage(gi31415848) 0.0 Click
24complement(2034493..2034945) PHAGE_Bacill_phBC6A52: Terminase small subunit; PP_01934; phage(gi31415847) 5e-28 Click
25complement(2035056..2035430) PHAGE_Bacill_phBC6A52: endonuclease; PP_01935; phage(gi31415846) 2e-46 Click
26complement(2035430..2035837) PHAGE_Bacill_phBC6A52: hypothetical protein BC2580; PP_01936; phage(gi31415845) 2e-13 Click
27complement(2035993..2036064) tRNA 0.0 Click
28complement(2036366..2036833) PHAGE_Brocho_NF5: gp53; PP_01937; phage(gi327197638) 8e-11 Click
29complement(2037221..2037421) PHAGE_Entero_phiFL2A: hypothetical protein; PP_01938; phage(gi281416521) 3e-31 Click
30complement(2037604..2038122) PHAGE_Entero_phiFL1A: hypothetical protein; PP_01939; phage(gi281416352) 9e-41 Click
31complement(2038335..2038547) hypothetical protein EFD32_2437 [Enterococcus faecalis D32] gi|397701008|ref|YP_006538796.1|; PP_01940 1e-16 Click
32complement(2038544..2038768) hypothetical; PP_01941 0.0 Click
33complement(2038879..2039304) PHAGE_Entero_EF62phi: hypothetical protein; PP_01942; phage(gi384519769) 5e-37 Click
34complement(2039306..2039767) PHAGE_Entero_phiFL2A: DNA cytosine methyltransferase; PP_01943; phage(gi281416514) 4e-79 Click
35complement(2039857..2040006) hypothetical protein EF2834 [Enterococcus faecalis V583] gi|29377302|ref|NP_816456.1|; PP_01944 1e-18 Click
36complement(2040073..2040465) PHAGE_Strept_O1205: hypothetical protein O1205p22; PP_01945; phage(gi23455870) 3e-34 Click
37complement(2040471..2041079) PHAGE_Lister_B054: gp58; PP_01946; phage(gi157325342) 2e-17 Click
38complement(2041099..2041569) hypothetical protein EF2836 [Enterococcus faecalis V583] gi|29377304|ref|NP_816458.1|; PP_01947 3e-87 Click
39complement(2041718..2041987) PHAGE_Entero_phiEf11: conserved hypothetical protein; PP_01948; phage(gi282598762) 6e-09 Click
40complement(2042126..2042965) PHAGE_Lactoc_bIL309: DnaC; PP_01949; phage(gi13095820) 2e-24 Click
41complement(2042977..2043756) PHAGE_Lactob_phiAT3: putative DNA replication protein; PP_01950; phage(gi48697290) 4e-43 Click
42complement(2043771..2044586) PHAGE_Strept_3: hypothetical protein SpyM3_1132; PP_01951; phage(gi28876302) 8e-63 Click
43complement(2044549..2045514) PHAGE_Strept_1: hypothetical protein EJ-1p21; PP_01952; phage(gi39653695) 9e-78 Click
44complement(2045511..2045627) PHAGE_Entero_phiFL2A: hypothetical protein; PP_01953; phage(gi281416505) 7e-10 Click
45complement(2045615..2045839) PHAGE_Entero_phiFL2A: hypothetical protein; PP_01954; phage(gi281416504) 1e-24 Click
46complement(2045836..2046135) PHAGE_Entero_phiFL2A: hypothetical protein; PP_01955; phage(gi281416503) 2e-09 Click
47complement(2046202..2046381) PHAGE_Entero_phiEf11: conserved hypothetical protein; PP_01956; phage(gi282598741) 1e-19 Click
48complement(2046416..2046685) hypothetical protein EFD32_2452 [Enterococcus faecalis D32] gi|397701023|ref|YP_006538811.1|; PP_01957 2e-44 Click
49complement(2046701..2046877) PHAGE_Entero_phiFL3A: hypothetical protein; PP_01958; phage(gi281416219) 3e-15 Click
502046961..2047170 hypothetical; PP_01959 0.0 Click
51complement(2047167..2047349) hypothetical; PP_01960 0.0 Click
522047657..2047989 PHAGE_Entero_phiFL3A: CI phage repressor protein; PP_01961; phage(gi281416216) 1e-33 Click
532048008..2048352 PHAGE_Entero_phiFL3A: hypothetical protein; PP_01962; phage(gi281416215) 7e-50 Click
54complement(2048378..2048611) hypothetical protein BN194_10540 [Lactobacillus casei W56] gi|409996719|ref|YP_006751120.1|; PP_01963 6e-09 Click
552048623..2049384 hypothetical protein LAR_0683 [Lactobacillus reuteri JCM 1112] gi|184153338|ref|YP_001841679.1|; PP_01964 5e-18 Click
562049561..2050742 PHAGE_Temper_1: integrase-like protein; PP_01965; phage(gi16271777) 3e-55 Click
572050841..2050865 attR    TAAATTATTTAGTTTCACGGTGTAA 0.0 Click