Enterococcus gallinarum EG2 .1, whole genome shotgun sequence. [asmbl_id: NC_000000].3134429, GC%: 40.60%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 45 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11999145..1999164 attL    GACTACCATTTTGACTACCA 0.0 Click
2complement(1999168..1999938) PHAGE_Lactoc_ul36: putative integrase; PP_02004; phage(gi21716073) 7e-58 Click
3complement(2000406..2001002) hypothetical protein EFD32_2296 [Enterococcus faecalis D32] gi|397700867|ref|YP_006538655.1|; PP_02005 9e-40 Click
4complement(2001094..2001456) PHAGE_Lactoc_bIL285: Orf3; PP_02006; phage(gi13095683) 1e-05 Click
52001509..2001521 attL    CATCGCTTTACTT 0.0 Click
6complement(2001516..2001827) PHAGE_Lister_B025: gp37; PP_02007; phage(gi157325254) 7e-19 Click
72002118..2002309 PHAGE_Lactob_phiadh: hypothetical protein phiadhp12; PP_02008; phage(gi9633012) 2e-11 Click
82002320..2002559 hypothetical protein TEH_08350 [Tetragenococcus halophilus NBRC 12172] gi|352517009|ref|YP_004886326.1|; PP_02009 2e-14 Click
92003016..2003240 PHAGE_Entero_phiFL2A: hypothetical protein; PP_02010; phage(gi281416504) 6e-15 Click
102003253..2003447 hypothetical; PP_02011 0.0 Click
112003450..2004466 PHAGE_Strept_1: hypothetical protein EJ-1p21; PP_02012; phage(gi39653695) 2e-66 Click
122004429..2005244 PHAGE_Lactob_LF1: hypothetical protein; PP_02013; phage(gi418489429) 2e-61 Click
132005258..2006049 PHAGE_Staphy_StB27: DNA replication protein; PP_02014; phage(gi431809696) 1e-45 Click
142006145..2006900 PHAGE_Entero_EF62phi: D replication protein DC; PP_02015; phage(gi384519773) 1e-23 Click
152006903..2007367 PHAGE_Lactoc_bIL286: Orf19; PP_02016; phage(gi13095762) 9e-20 Click
162007367..2007573 hypothetical; PP_02017 0.0 Click
172007598..2008191 PHAGE_Lister_B054: gp58; PP_02018; phage(gi157325342) 3e-17 Click
182008181..2008375 hypothetical; PP_02019 0.0 Click
192008432..2008551 hypothetical; PP_02020 0.0 Click
202008717..2009715 PHAGE_Staphy_vB_SepiS_phiIPLA5: integrase; PP_02021; phage(gi399528924) 5e-13 Click
212009753..2010844 PHAGE_Strept_phiNJ2: putative C-5 cytosine-specific DNA methylase; PP_02022; phage(gi414090243) 5e-82 Click
222010834..2011022 hypothetical; PP_02023 0.0 Click
232011023..2011163 hypothetical; PP_02024 0.0 Click
242011165..2011278 hypothetical; PP_02025 0.0 Click
252011346..2011816 PHAGE_Bacill_WBeta: conserved phage protein; PP_02026; phage(gi85701424) 2e-27 Click
262011954..2011966 attR    CATCGCTTTACTT 0.0 Click
272013010..2013381 hypothetical; PP_02027 0.0 Click
282013510..2014013 hypothetical protein CAR_50p240 [Carnobacterium sp. 17-4] gi|328958827|ref|YP_004373738.1|; PP_02028 7e-13 Click
292014052..2014381 hypothetical protein EFD32_2265 [Enterococcus faecalis D32] gi|397700836|ref|YP_006538624.1|; PP_02029 6e-24 Click
302014531..2014692 PHAGE_Lister_B025: gp65; PP_02030; phage(gi157325282) 1e-11 Click
312014868..2015185 PHAGE_Lister_B025: gp1; PP_02031; phage(gi157325218) 8e-14 Click
322015182..2016864 PHAGE_Lister_B025: putative terminase large subunit; PP_02032; phage(gi157325219) 0.0 Click
332017204..2017365 hypothetical protein EFD32_2261 [Enterococcus faecalis D32] gi|397700832|ref|YP_006538620.1|; PP_02033 9e-07 Click
342017428..2017601 hypothetical; PP_02034 0.0 Click
352017636..2018805 PHAGE_Lister_B025: gp3; PP_02035; phage(gi157325220) 1e-88 Click
362018792..2019496 PHAGE_Staphy_2638A: ORF013; PP_02036; phage(gi66395463) 1e-37 Click
372019500..2020684 PHAGE_Lister_B025: Cps; PP_02037; phage(gi157325222) 1e-56 Click
382020702..2020827 hypothetical; PP_02038 0.0 Click
392020828..2021106 PHAGE_Lister_B025: gp7; PP_02039; phage(gi157325224) 4e-11 Click
402021096..2021467 PHAGE_Lister_B025: gp8; PP_02040; phage(gi157325226) 3e-26 Click
412021464..2021862 PHAGE_Strept_1: hypothetical protein SpyM3_0717; PP_02041; phage(gi28876182) 2e-18 Click
422021859..2022254 PHAGE_Lister_B025: gp10; PP_02042; phage(gi157325227) 3e-20 Click
432022286..2022906 PHAGE_Lister_B025: Tsh; PP_02043; phage(gi157325228) 2e-22 Click
442022969..2023346 hypothetical protein EFD32_2251 [Enterococcus faecalis D32] gi|397700822|ref|YP_006538610.1|; PP_02044 3e-13 Click
452023394..2023549 hypothetical protein EFD32_2250 [Enterococcus faecalis D32] gi|397700821|ref|YP_006538609.1|; PP_02045 4e-05 Click
462023551..2027876 PHAGE_Strept_phi3396: putative phage-related tail tape measure protein; PP_02046; phage(gi126011107) 3e-167 Click
472027873..2029372 PHAGE_Lactoc_1706: putative tail protein; PP_02047; phage(gi182637496) 5e-11 Click
482029369..2031900 PHAGE_Entero_1: host specificity protein; PP_02048; phage(gi225626383) 1e-19 Click
492040449..2040468 attR    GACTACCATTTTGACTACCA 0.0 Click