Escherichia sp. 3_2_53FAA .1, whole genome shotgun sequence. [asmbl_id: NC_000000].5094952, GC%: 50.51%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 51 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(591..884) PHAGE_Halomo_1: hypothetical protein HAPgp19; PP_00001; phage(gi167832364) 2e-07 Click
2complement(897..1175) PHAGE_Escher_bV_EcoS_AKFV33: hypothetical protein; PP_00002; phage(gi388570496) 8e-06 Click
31107..1120 attL    CCAGTCAAGAGATG 0.0 Click
4complement(1172..3232) PHAGE_Escher_bV_EcoS_AKFV33: putative tail fiber protein; PP_00003; phage(gi388570497) 5e-80 Click
5complement(3291..4400) PHAGE_Stx2_c_1717: putative tail fiber component J; PP_00004; phage(gi209447196) 0.0 Click
6complement(4607..5236) PHAGE_Entero_lambda: tail:host specificity protein; PP_00005; phage(gi9626264) 2e-103 Click
7complement(5297..7576) PHAGE_Entero_lambda: tail component; PP_00006; phage(gi9626259) 0.0 Click
8complement(7647..7832) PHAGE_Entero_lambda: tail component; PP_00007; phage(gi9626259) 7e-21 Click
9complement(7825..8259) PHAGE_Entero_lambda: tail component; PP_00008; phage(gi9626258) 4e-81 Click
10complement(8241..8663) PHAGE_Entero_lambda: tail component; PP_00009; phage(gi9626257) 1e-62 Click
11complement(8679..9419) PHAGE_Entero_lambda: tail component; PP_00010; phage(gi9626256) 2e-135 Click
12complement(9427..9822) PHAGE_Entero_lambda: tail component; PP_00011; phage(gi9626255) 1e-70 Click
13complement(9819..10397) PHAGE_Entero_lambda: tail component; PP_00012; phage(gi9626254) 2e-100 Click
14complement(10409..10762) PHAGE_Entero_lambda: head-tail joining protein; PP_00013; phage(gi9626253) 9e-40 Click
15complement(10755..11129) PHAGE_Entero_HK225: head assembly protein Fi; PP_00014; phage(gi428782384) 1e-07 Click
16complement(11181..12209) PHAGE_Entero_lambda: capsid component; PP_00015; phage(gi9626251) 6e-117 Click
17complement(12267..12491) PHAGE_Entero_lambda: head-DNA stabilization protein; PP_00016; phage(gi9626250) 1e-15 Click
18complement(12481..14076) PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; PP_00017; phage(gi169257233) 0.0 Click
19complement(14767..14949) hypothetical protein ECS88_1189 [Escherichia coli S88] gi|218558054|ref|YP_002390967.1|; PP_00018 1e-26 Click
2015963..16256 PHAGE_Entero_lambda: Bor protein precursor; PP_00019; phage(gi19263395) 4e-47 Click
21complement(16347..16517) PHAGE_Entero_lambda: cell lysis protein; PP_00020; phage(gi9626310) 1e-22 Click
22complement(16514..17011) PHAGE_Entero_cdtI: lysin; PP_00021; phage(gi148609440) 2e-91 Click
23complement(17011..17226) PHAGE_Stx2_c_II: holin; PP_00022; phage(gi302393164) 4e-28 Click
2417755..18897 outer membrane porin [Escherichia coli S88] gi|218558048|ref|YP_002390961.1|; PP_00023 0.0 Click
25complement(19086..19469) PHAGE_Entero_2008: antitermination protein Q; PP_00024; phage(gi209427762) 2e-56 Click
26complement(19555..19695) PHAGE_Entero_mEp237: hypothetical protein; PP_00025; phage(gi435439319) 2e-09 Click
27complement(19692..20054) PHAGE_Entero_mEp237: Holliday junction resolvase RusA; PP_00026; phage(gi435439318) 1e-61 Click
28complement(20778..21305) PHAGE_Entero_HK544: putative N-6-adenine-methyltransferase; PP_00027; phage(gi428783266) 5e-101 Click
29complement(21302..21742) PHAGE_Entero_lambda: NinB; PP_00028; phage(gi9626298) 9e-82 Click
30complement(21816..22106) PHAGE_Entero_lambda: ren exclusion protein; PP_00029; phage(gi9626297) 1e-48 Click
31complement(22103..22804) PHAGE_Entero_lambda: DNA replication protein; PP_00030; phage(gi9626296) 6e-128 Click
32complement(22801..23700) PHAGE_Entero_lambda: DNA replication protein; PP_00031; phage(gi9626295) 3e-174 Click
33complement(23733..23849) PHAGE_Entero_HK629: CII protein; PP_00032; phage(gi428782059) 2e-14 Click
3424462..25157 PHAGE_Stx2_c_II: CI protein; PP_00033; phage(gi302393138) 8e-135 Click
3525751..26503 PHAGE_Burkho_2: gp47, conserved hypothetical protein; PP_00034; phage(gi134288670) 6e-06 Click
36complement(27079..27192) hypothetical protein ECOK1_1259 [Escherichia coli IHE3034] gi|386598958|ref|YP_006100464.1|; PP_00035 7e-12 Click
37complement(27229..27783) PHAGE_Entero_HK140: superinfection exclusion protein; PP_00036; phage(gi428781984) 4e-95 Click
3828102..28224 PHAGE_Entero_lambda: restriction alleviation protein; PP_00037; phage(gi9626286) 3e-17 Click
3928407..28775 PHAGE_Entero_lambda: Putative single-stranded DNA binding protein; PP_00038; phage(gi9626285) 2e-68 Click
4028981..29124 PHAGE_Entero_lambda: host-killing protein; PP_00039; phage(gi9626283) 4e-20 Click
4129200..29496 PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; PP_00040; phage(gi116222045) 8e-52 Click
4229502..30287 PHAGE_Entero_lambda: bet; PP_00041; phage(gi9626281) 7e-151 Click
4330284..30964 PHAGE_Stx2_c_1717: exonuclease; PP_00042; phage(gi209447136) 1e-132 Click
4431194..31307 PHAGE_Entero_lambda: hypothetical protein lambdap38; PP_00043; phage(gi9626278) 1e-12 Click
4531384..31500 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; PP_00044; phage(gi20065893) 3e-08 Click
46complement(31733..31876) hypothetical protein ECS88_1156 [Escherichia coli S88] gi|218558023|ref|YP_002390936.1|; PP_00045 5e-19 Click
4731915..32241 PHAGE_Entero_ST104: ORF6; PP_00046; phage(gi46358654) 2e-49 Click
4832348..32464 hypothetical protein ECS88_1154 [Escherichia coli S88] gi|218558021|ref|YP_002390934.1|; PP_00047 2e-14 Click
4932518..32531 attR    CCAGTCAAGAGATG 0.0 Click
5032830..33972 PHAGE_Entero_mEp235: integrase; PP_00048; phage(gi428781836) 2e-61 Click
51complement(34086..35336) isocitrate dehydrogenase [Shigella flexneri 5 str. 8401] gi|110805164|ref|YP_688684.1|; PP_00049 0.0 Click
5235538..36161 hypothetical protein i02_1357 [Escherichia coli str. 'clone D i2'] gi|386628841|ref|YP_006148561.1|; PP_00050 3e-117 Click
5336171..36632 PHAGE_Vibrio_KVP40: NMN adenylyl tranferase; PP_00051; phage(gi34419395) 6e-05 Click

Region 2, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1278642..278653 attL    ATCGTGTCACGA 0.0 Click
2complement(289872..292148) PROPHAGE_Escher_EDL933: ATP-dependent Clp protease ATP-binding subunit; PP_00292; phage(gi15800640) 0.0 Click
3complement(292179..292499) PHAGE_Cronob_vB_CsaM_GAP32: ATP-dependent Clp protease; PP_00293; phage(gi414087232) 2e-05 Click
4292863..293042 hypothetical protein ECOK1_0898 [Escherichia coli IHE3034] gi|386598614|ref|YP_006100120.1|; PP_00294 5e-26 Click
5complement(293192..293473) hypothetical protein ECOK1_0897 [Escherichia coli IHE3034] gi|386598613|ref|YP_006100119.1|; PP_00295 1e-45 Click
6complement(293730..294272) PHAGE_Entero_N15: gp1; PP_00296; phage(gi9630465) 2e-37 Click
7complement(294480..294893) head-tail preconnector protein [Escherichia coli IHE3034] gi|386598611|ref|YP_006100117.1|; PP_00297 2e-71 Click
8complement(294906..295241) PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; PP_00298; phage(gi169257231) 7e-08 Click
9complement(295253..296308) PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; PP_00299; phage(gi169257230) 1e-81 Click
10complement(296308..296514) hypothetical protein G2583_1399 [Escherichia coli O55:H7 str. CB9615] gi|291282158|ref|YP_003498976.1|; PP_00300 1e-31 Click
11296672..296806 hypothetical; PP_00301 0.0 Click
12complement(296930..297352) PHAGE_Pseudo_F116: single-stranded DNA-binding protein; PP_00302; phage(gi56692915) 4e-10 Click
13complement(297349..297606) hypothetical protein ECOK1_0890 [Escherichia coli IHE3034] gi|386598606|ref|YP_006100112.1|; PP_00303 7e-42 Click
14complement(297895..299643) PHAGE_Entero_P4: DNA primase; PP_00304; phage(gi9627512) 3e-92 Click
15complement(299640..299939) hypothetical protein CE10_1216 [Escherichia coli O7:K1 str. CE10] gi|386623592|ref|YP_006143320.1|; PP_00305 3e-51 Click
16complement(299945..300172) hypothetical protein CE10_1215 [Escherichia coli O7:K1 str. CE10] gi|386623591|ref|YP_006143319.1|; PP_00306 5e-35 Click
17complement(300165..300476) hypothetical protein ECOK1_0886 [Escherichia coli IHE3034] gi|386598602|ref|YP_006100108.1|; PP_00308 4e-52 Click
18300568..300747 hypothetical protein ECOK1_0885 [Escherichia coli IHE3034] gi|386598601|ref|YP_006100107.1|; PP_00307 3e-25 Click
19complement(301093..301302) PHAGE_Entero_P4: transcriptional regulator; PP_00309; phage(gi9627517) 6e-09 Click
20301463..301474 attR    ATCGTGTCACGA 0.0 Click
21complement(301722..302960) PHAGE_Salmon_vB_SosS_Oslo: integrase; PP_00310; phage(gi399528791) 1e-49 Click

Region 3, total : 55 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11688907..1688918 attL    AAGCACAAGAAG 0.0 Click
2complement(1689053..1690225) PHAGE_Cronob_phiES15: putative integrase; PP_01664; phage(gi401817566) 6e-148 Click
3complement(1690434..1691300) hypothetical protein ECS88_2915 [Escherichia coli S88] gi|218559642|ref|YP_002392555.1|; PP_01665 2e-167 Click
4complement(1691409..1691933) PHAGE_Entero_SfV: hypothetical protein SfVp30; PP_01666; phage(gi19549017) 2e-94 Click
5complement(1692061..1692885) PHAGE_Entero_SfV: hypothetical protein SfVp31; PP_01667; phage(gi19549018) 9e-152 Click
6complement(1692951..1693313) PHAGE_Entero_SfV: hypothetical protein SfVp32; PP_01668; phage(gi19549019) 4e-62 Click
71693782..1694294 hypothetical protein ECS88_2910 [Escherichia coli S88] gi|218559638|ref|YP_002392551.1|; PP_01669 4e-92 Click
81694373..1694489 hypothetical protein ECS88_2909 [Escherichia coli S88] gi|218559637|ref|YP_002392550.1|; PP_01670 3e-12 Click
9complement(1694497..1694730) PHAGE_Entero_SfV: repressor; PP_01672; phage(gi19549021) 1e-41 Click
101694828..1694968 hypothetical; PP_01671 0.0 Click
111695262..1695462 PHAGE_Entero_SfV: repressor; PP_01673; phage(gi19549022) 4e-33 Click
121695506..1696057 PHAGE_Entero_SfV: hypothetical protein SfVp36; PP_01674; phage(gi19549023) 2e-93 Click
131696402..1697343 PHAGE_Entero_phiP27: hypothetical protein P27p17; PP_01675; phage(gi18249881) 2e-41 Click
141697583..1697834 PHAGE_Entero_SfV: hypothetical protein SfVp40; PP_01676; phage(gi19549027) 2e-42 Click
151697834..1698487 PHAGE_Entero_SfV: DNA adenine methylase; PP_01677; phage(gi19549028) 2e-126 Click
161698484..1698810 PHAGE_Entero_SfV: hypothetical protein SfVp42; PP_01678; phage(gi19549029) 1e-54 Click
171698807..1699196 PHAGE_Entero_SfV: crossover junction endodeoxyribonuclease; PP_01679; phage(gi19549030) 1e-70 Click
181699216..1700013 PHAGE_Entero_SfV: hypothetical protein SfVp44; PP_01680; phage(gi19549031) 4e-133 Click
191700021..1701010 PHAGE_Entero_SfV: hypothetical protein SfVp45; PP_01681; phage(gi19549032) 1e-177 Click
201701024..1701776 PHAGE_Entero_SfV: antitermination protein Q; PP_01682; phage(gi19549033) 3e-143 Click
211701962..1702297 hypothetical protein ECS88_2895 [Escherichia coli S88] gi|218559624|ref|YP_002392537.1|; PP_01683 3e-60 Click
221702449..1702754 PHAGE_Salmon_ST160: Gp13; PP_01684; phage(gi318065943) 3e-39 Click
231702741..1703217 PHAGE_Escher_HK75: lysozyme; PP_01685; phage(gi356870730) 8e-83 Click
241703413..1703598 PHAGE_Escher_HK75: Rz1; PP_01686; phage(gi356870732) 1e-24 Click
251703749..1703973 hypothetical protein ECS88_2891 [Escherichia coli S88] gi|218559620|ref|YP_002392533.1|; PP_01687 2e-37 Click
26complement(1704080..1704520) hypothetical protein ECS88_2890 [Escherichia coli S88] gi|218559619|ref|YP_002392532.1|; PP_01688 4e-77 Click
271704623..1704973 PHAGE_Entero_SfV: hypothetical protein SfVp53; PP_01689; phage(gi19549040) 1e-64 Click
281705099..1705593 PHAGE_Entero_SfV: small terminase subunit; PP_01690; phage(gi19548991) 4e-90 Click
291705662..1707323 PHAGE_Entero_SfV: large terminase subunit; PP_01691; phage(gi19548992) 0.0 Click
301707335..1707517 PHAGE_Salmon_ST64B: putative integral membrane protein; PP_01692; phage(gi23505448) 2e-28 Click
311707517..1708758 PHAGE_Salmon_ST64B: Portal Protein; PP_01693; phage(gi23505449) 0.0 Click
321708736..1709386 PHAGE_Salmon_ST64B: Pro-head protease; PP_01694; phage(gi23505450) 5e-119 Click
331709401..1710606 PHAGE_Salmon_ST64B: Major capsid protein precursor; PP_01695; phage(gi23505451) 0.0 Click
341710656..1710856 PHAGE_Salmon_ST64B: hypothetical protein sb7; PP_01696; phage(gi23505452) 9e-24 Click
351710859..1711182 PHAGE_Entero_SfV: hypothetical protein SfVp06; PP_01697; phage(gi19548996) 3e-34 Click
361711179..1711589 PHAGE_Entero_SfV: hypothetical protein SfVp07; PP_01698; phage(gi19548997) 5e-52 Click
371711564..1712070 PHAGE_Entero_SfV: hypothetical protein SfVp08; PP_01699; phage(gi19548998) 2e-94 Click
381712067..1712627 PHAGE_Entero_SfV: hypothetical protein SfVp09; PP_01700; phage(gi19548999) 5e-104 Click
391712636..1712806 PHAGE_Entero_SfV: hypothetical protein SfVp10; PP_01701; phage(gi19549000) 1e-27 Click
401712790..1714286 PHAGE_Entero_SfV: tail sheath protein; PP_01702; phage(gi19549001) 0.0 Click
411714286..1714642 PHAGE_Entero_SfV: hypothetical protein SfVp12; PP_01703; phage(gi19549002) 3e-65 Click
421714642..1714911 PHAGE_Entero_SfV: hypothetical protein SfVp13; PP_01704; phage(gi19549003) 2e-44 Click
431714878..1715060 hypothetical protein ECOK1_2982 [Escherichia coli IHE3034] gi|386600606|ref|YP_006102112.1|; PP_01705 2e-29 Click
441715053..1716888 PHAGE_Entero_SfV: tail protein; PP_01706; phage(gi19549004) 0.0 Click
451716949..1718277 PHAGE_Entero_SfV: tail/DNA circulation protein; PP_01707; phage(gi19549005) 0.0 Click
461718274..1719353 PHAGE_Entero_SfV: tail protein; PP_01708; phage(gi19549006) 0.0 Click
471719353..1719901 PHAGE_Entero_SfV: tail protein; PP_01709; phage(gi19549007) 2e-98 Click
481719901..1720326 PHAGE_Entero_SfV: tail protein; PP_01710; phage(gi19549008) 4e-80 Click
491720313..1721371 PHAGE_Entero_SfV: tail protein; PP_01711; phage(gi19549009) 0.0 Click
501721362..1721946 PHAGE_Entero_SfV: tail protein; PP_01712; phage(gi19548988) 8e-113 Click
511721950..1722693 PHAGE_Entero_SfV: hypothetical protein SfVp21; PP_01713; phage(gi19548989) 7e-52 Click
521722693..1723295 PHAGE_Entero_HK106: tail fiber assembly protein; PP_01714; phage(gi428783304) 3e-96 Click
53complement(1723267..1723710) PHAGE_Entero_mEp213: tail fiber assembly protein; PP_01715; phage(gi428782612) 2e-24 Click
54complement(1723713..1724204) PHAGE_Entero_SfV: hypothetical protein SfVp21; PP_01716; phage(gi19548989) 6e-06 Click
55complement(1724458..1726347) hypothetical protein ECS88_2860 [Escherichia coli S88] gi|218559591|ref|YP_002392504.1|; PP_01717 0.0 Click
56complement(1726772..1726909) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp30; PP_01718; phage(gi148609412) 1e-14 Click
571738670..1738681 attR    AAGCACAAGAAG 0.0 Click

Region 4, total : 55 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11858732..1858754 attL    GATCCGTGGGTGTTTATGTTCTC 0.0 Click
2complement(1858819..1859949) PHAGE_Entero_HK629: integrase; PP_01862; phage(gi428782041) 4e-50 Click
3complement(1860240..1862711) PHAGE_Entero_mEp460: putative exonuclease; PP_01863; phage(gi428782342) 1e-58 Click
4complement(1862804..1862995) hypothetical protein ECS88_1330 [Escherichia coli S88] gi|218558189|ref|YP_002391102.1|; PP_01864 2e-29 Click
51863122..1863319 hypothetical protein APECO1_375 [Escherichia coli APEC O1] gi|117623475|ref|YP_852388.1|; PP_01865 9e-31 Click
61863581..1863745 hypothetical protein i02_1287 [Escherichia coli str. 'clone D i2'] gi|386628772|ref|YP_006148492.1|; PP_01866 1e-23 Click
7complement(1863746..1863967) hypothetical protein ECS88_1333 [Escherichia coli S88] gi|218558192|ref|YP_002391105.1|; PP_01867 2e-34 Click
8complement(1863997..1864125) hypothetical protein ECW_m1736 [Escherichia coli W] gi|386608962|ref|YP_006124448.1|; PP_01868 1e-15 Click
9complement(1864127..1864363) PHAGE_Salico_CGphi29: hypothetical protein; PP_01869; phage(gi472340166) 8e-09 Click
10complement(1864575..1865174) PHAGE_Entero_HK629: prophage repressor; PP_01870; phage(gi428782057) 1e-14 Click
111865305..1865547 PHAGE_Pectob_ZF40: putative cro anti-repressor; PP_01871; phage(gi422936651) 4e-09 Click
121865531..1865956 PHAGE_Escher_HK639: cII; PP_01872; phage(gi356870652) 6e-06 Click
131866028..1867098 PHAGE_Entero_phiP27: hypothetical protein P27p17; PP_01873; phage(gi18249881) 4e-29 Click
141867139..1867561 hypothetical protein ECOK1_1422 [Escherichia coli IHE3034] gi|386599114|ref|YP_006100620.1|; PP_01874 9e-74 Click
151867693..1868715 hypothetical protein ECS88_1341 [Escherichia coli S88] gi|218558200|ref|YP_002391113.1|; PP_01875 0.0 Click
161868731..1869732 hypothetical protein ECS88_1342 [Escherichia coli S88] gi|218558201|ref|YP_002391114.1|; PP_01876 0.0 Click
17complement(1870547..1870681) hypothetical protein ECNA114_48171 [Escherichia coli NA114] gi|386622361|ref|YP_006141941.1|; PP_01877 4e-13 Click
181870953..1871999 PHAGE_Entero_mEp460: hypothetical protein; PP_01878; phage(gi428782365) 1e-110 Click
191872120..1872386 PHAGE_Escher_HK75: RusA-like protein; PP_01879; phage(gi356870726) 6e-20 Click
201872383..1873204 PHAGE_Entero_HK225: late gene regulator Q; PP_01880; phage(gi428782441) 2e-90 Click
211873429..1873626 PHAGE_Entero_phiP27: hypothetical protein P27p23; PP_01881; phage(gi18249887) 4e-31 Click
221873777..1874826 PHAGE_Entero_phiP27: putative DNA methylase; PP_01882; phage(gi18249888) 0.0 Click
231874876..1874951 tRNA 0.0 Click
241875049..1875125 tRNA 0.0 Click
251876101..1876328 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; PP_01883; phage(gi209427766) 1e-32 Click
261876286..1876447 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp03; PP_01884; phage(gi116221995) 3e-15 Click
271876597..1876812 PHAGE_Escher_P13374: lysis protein, holin; PP_01885; phage(gi410491645) 3e-34 Click
281876817..1877161 PHAGE_Entero_mEp460: hypothetical protein; PP_01886; phage(gi428782371) 7e-39 Click
29complement(1877127..1877279) hypothetical protein ECS88_1355 [Escherichia coli S88] gi|218558210|ref|YP_002391123.1|; PP_01887 1e-21 Click
301877505..1878038 PHAGE_Stx2_c_86: lysozyme protein R; PP_01888; phage(gi116221999) 5e-100 Click
311878198..1878335 hypothetical protein ECS88_1358 [Escherichia coli S88] gi|218558211|ref|YP_002391124.1|; PP_01889 4e-19 Click
321878337..1878507 PHAGE_Escher_TL_2011c: hypothetical protein; PP_01890; phage(gi418487099) 4e-22 Click
33complement(1879335..1879454) hypothetical; PP_01891 0.0 Click
341880094..1881689 PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; PP_01892; phage(gi169257233) 0.0 Click
351881679..1881903 PHAGE_Entero_HK629: head decoration protein; PP_01893; phage(gi428782018) 2e-15 Click
361881961..1882989 PHAGE_Entero_HK629: major head subunit; PP_01894; phage(gi428782019) 2e-114 Click
371883041..1883424 PHAGE_Gifsy_1: bacteriophage accessory DNA packaging protein; Lambda FI homolog; PP_01895; phage(gi169257229) 4e-12 Click
381883417..1883770 PHAGE_Entero_HK629: head-tail connector Fii; PP_01896; phage(gi428782021) 5e-43 Click
391883786..1884319 PHAGE_Entero_HK629: minor tail protein; PP_01897; phage(gi428782022) 2e-66 Click
401884316..1884711 PHAGE_Entero_HK629: minor tail protein; PP_01898; phage(gi428782023) 8e-59 Click
411884719..1885471 PHAGE_Entero_HK629: major tail protein; PP_01899; phage(gi428782024) 3e-112 Click
421885485..1885916 PHAGE_Entero_HK629: minor tail protein; PP_01900; phage(gi428782025) 2e-45 Click
431885967..1886356 PHAGE_Entero_HK629: tail assembly protein; PP_01901; phage(gi428782026) 4e-43 Click
441886337..1887008 PHAGE_Entero_HK629: tail length tape measure protein; PP_01902; phage(gi428782027) 6e-103 Click
451886998..1888497 PHAGE_Entero_HK629: tail length tape measure protein; PP_01903; phage(gi428782027) 0.0 Click
461888520..1888903 PHAGE_Entero_HK629: tail component protein; PP_01904; phage(gi428782031) 2e-52 Click
471889190..1889315 hypothetical protein ECS88_1384 [Escherichia coli S88] gi|218558234|ref|YP_002391147.1|; PP_01905 5e-16 Click
481889382..1890011 PHAGE_Entero_HK629: tail fiber; PP_01906; phage(gi428782032) 1e-103 Click
491890218..1891324 PHAGE_Stx2_c_1717: putative tail fiber component J; PP_01907; phage(gi209447196) 1e-165 Click
501891392..1891991 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; PP_01908; phage(gi148609401) 2e-107 Click
511892143..1892700 PHAGE_Entero_HK629: tail fiber protein; PP_01909; phage(gi428782034) 1e-65 Click
52complement(1892653..1893390) PHAGE_Entero_lambda: hypothetical protein lambdap90; PP_01910; phage(gi9626267) 4e-55 Click
531893426..1893560 hypothetical protein ECNA114_0896 [Escherichia coli NA114] gi|386618413|ref|YP_006137993.1|; PP_01911 7e-17 Click
541893521..1895263 PHAGE_Entero_HK629: tail fiber; PP_01912; phage(gi428782035) 1e-89 Click
551895263..1895847 PHAGE_Entero_HK629: tail fiber assembly protein; PP_01913; phage(gi428782036) 1e-104 Click
56complement(1895902..1896075) hypothetical protein SSON_2178 [Shigella sonnei Ss046] gi|74312645|ref|YP_311064.1|; PP_01914 3e-25 Click
571896627..1896896 PHAGE_Entero_HK629: tail fiber assembly protein; PP_01915; phage(gi428782036) 8e-22 Click
581897011..1897181 PHAGE_Entero_phiP27: hypothetical protein P27p57; PP_01916; phage(gi18249921) 3e-10 Click
591897569..1897591 attR    GATCCGTGGGTGTTTATGTTCTC 0.0 Click

Region 5, total : 58 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13057659..3057675 attL    CTGCAGGGGACACCATT 0.0 Click
23057799..3058992 PHAGE_Entero_IME10: integrase; PP_03029; phage(gi422934296) 0.0 Click
3complement(3059232..3060029) PHAGE_Bathyc_BpV1: hypothetical protein; PP_03030; phage(gi313768028) 2e-06 Click
4complement(3060183..3063131) PHAGE_Escher_phAPEC8: tail fiber protein; PP_03031; phage(gi448260439) 0.0 Click
5complement(3063232..3064161) PHAGE_Stx2_c_1717: phage antirepressor protein; PP_03032; phage(gi209447193) 3e-152 Click
6complement(3064225..3064398) hypothetical; PP_03033 0.0 Click
73064776..3064910 phage regulatory protein [Escherichia coli S88] gi|218559263|ref|YP_002392176.1|; PP_03034 8e-16 Click
8complement(3065201..3065317) hypothetical; PP_03035 0.0 Click
9complement(3065927..3066370) PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_03036; phage(gi399498806) 2e-60 Click
103066820..3067134 PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_03037; phage(gi399498805) 6e-54 Click
11complement(3067159..3068988) PHAGE_Salmon_vB_SemP_Emek: injection protein; PP_03038; phage(gi399498804) 0.0 Click
12complement(3068985..3070400) PHAGE_Salmon_vB_SemP_Emek: injection protein; PP_03039; phage(gi399498803) 0.0 Click
13complement(3070410..3071099) PHAGE_Entero_P22: injection protein; PP_03040; phage(gi51236730) 7e-120 Click
14complement(3071102..3071557) PHAGE_Entero_IME10: head assembly protein; PP_03041; phage(gi422934287) 2e-86 Click
15complement(3071557..3072258) PHAGE_Entero_IME10: DNA stabilization protein; PP_03042; phage(gi422934286) 2e-122 Click
16complement(3072258..3073676) PHAGE_Entero_IME10: DNA stabilization protein; PP_03043; phage(gi422934285) 0.0 Click
17complement(3073686..3074147) PHAGE_Sodali_phiSG1: phage DNA stabilization protein; PP_03044; phage(gi89885996) 2e-27 Click
18complement(3074128..3074304) hypothetical protein ECOK1_2645 [Escherichia coli IHE3034] gi|386600285|ref|YP_006101791.1|; PP_03045 4e-27 Click
19complement(3074358..3075611) PHAGE_Entero_P22: coat protein; PP_03046; phage(gi9635538) 7e-35 Click
20complement(3075630..3076523) PHAGE_Entero_Sf6: gene 4 protein; PP_03047; phage(gi41057282) 1e-28 Click
21complement(3076614..3078812) PHAGE_Bacter_2: portal protein; PP_03048; phage(gi212499722) 0.0 Click
22complement(3078814..3080229) PHAGE_Entero_Sf6: gene 2 protein; PP_03049; phage(gi41057280) 0.0 Click
23complement(3080226..3080666) PHAGE_Riemer_RAP44: hypothetical protein; PP_03050; phage(gi418489899) 6e-30 Click
24complement(3080669..3080911) PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_03051; phage(gi399498861) 6e-38 Click
25complement(3081212..3081736) PHAGE_Escher_HK639: rha protein; PP_03052; phage(gi356870673) 4e-90 Click
26complement(3081939..3082082) PHAGE_Entero_mEp460: hypothetical protein; PP_03053; phage(gi428782374) 5e-20 Click
27complement(3082079..3082546) PHAGE_Salmon_SPN9CC: endopeptidase; PP_03054; phage(gi389060532) 4e-79 Click
28complement(3082543..3083016) PHAGE_Escher_HK75: lysozyme; PP_03055; phage(gi356870730) 9e-89 Click
29complement(3083003..3083326) PHAGE_Entero_IME10: holin; PP_03056; phage(gi422934276) 1e-55 Click
30complement(3083569..3083644) tRNA 0.0 Click
31complement(3083650..3083724) tRNA 0.0 Click
32complement(3083999..3084622) PHAGE_Entero_IME10: regulatory protein Q; PP_03057; phage(gi422934275) 2e-117 Click
33complement(3084804..3085166) PHAGE_Escher_HK75: RusA-like protein; PP_03058; phage(gi356870726) 2e-64 Click
34complement(3085163..3085327) PHAGE_Entero_mEpX2: hypothetical protein; PP_03059; phage(gi428765668) 1e-24 Click
35complement(3085453..3085722) PHAGE_Entero_mEp235: hypothetical protein; PP_03060; phage(gi428781861) 6e-46 Click
36complement(3085715..3085885) PHAGE_Escher_HK75: NinF; PP_03061; phage(gi356870723) 5e-28 Click
37complement(3086061..3086471) PHAGE_Escher_HK75: NinB; PP_03062; phage(gi356870721) 4e-73 Click
38complement(3086443..3086688) PHAGE_Entero_mEp213: hypothetical protein; PP_03063; phage(gi428782648) 1e-39 Click
39complement(3086817..3086981) PHAGE_Entero_mEpX1: hypothetical protein; PP_03064; phage(gi428781921) 1e-22 Click
40complement(3087100..3088932) PHAGE_Entero_c_1: hypothetical protein; PP_03065; phage(gi428781787) 0.0 Click
413088891..3089049 hypothetical protein CE10_1035 [Escherichia coli O7:K1 str. CE10] gi|386623411|ref|YP_006143139.1|; PP_03066 1e-21 Click
42complement(3089088..3089948) PHAGE_Entero_c_1: DNA replication protein O; PP_03067; phage(gi428781786) 5e-165 Click
43complement(3089941..3090087) PHAGE_Entero_mEp235: hypothetical protein; PP_03068; phage(gi428781853) 4e-22 Click
44complement(3090123..3090404) PHAGE_Entero_c_1: CII protein; PP_03069; phage(gi428781784) 4e-47 Click
45complement(3090521..3090751) PHAGE_Entero_c_1: prophage antirepressor; PP_03070; phage(gi428781783) 6e-39 Click
463090977..3091546 PHAGE_Entero_c_1: prophage repressor; PP_03071; phage(gi428781782) 5e-109 Click
473092265..3092591 PHAGE_Entero_HK633: anti-termination protein N; PP_03072; phage(gi428782565) 5e-57 Click
483092748..3092870 PHAGE_Entero_HK544: restriction alleviation protein; PP_03073; phage(gi428783253) 1e-16 Click
493093649..3094023 PHAGE_Entero_IME10: Orf53; PP_03074; phage(gi422934294) 4e-62 Click
503093980..3094495 PHAGE_Entero_IME10: Orf53; PP_03075; phage(gi422934294) 2e-82 Click
513094636..3094788 PHAGE_Escher_HK75: kil protein; PP_03076; phage(gi356870711) 4e-23 Click
523094785..3094943 PHAGE_Entero_Sf6: gene 30 protein; PP_03077; phage(gi41057308) 5e-25 Click
533095045..3095650 PHAGE_Entero_mEp234: essential recombination function protein; PP_03078; phage(gi428782283) 8e-111 Click
543095650..3096033 PHAGE_Entero_mEp213: hypothetical protein; PP_03079; phage(gi428782627) 2e-68 Click
553096057..3096353 PHAGE_Entero_mEp235: Abc2 protein; PP_03080; phage(gi428781839) 1e-54 Click
56complement(3096402..3097088) hypothetical protein APECO1_4175 [Escherichia coli APEC O1] gi|117624579|ref|YP_853492.1|; PP_03081 7e-128 Click
573097264..3097836 PHAGE_Entero_ST104: ORF8; PP_03082; phage(gi46358656) 9e-48 Click
583098113..3098397 PHAGE_Entero_ST104: ORF6; PP_03083; phage(gi46358654) 2e-49 Click
593098470..3098637 PHAGE_Entero_HK630: hypothetical protein; PP_03084; phage(gi428782816) 9e-29 Click
603098695..3098895 PHAGE_Entero_HK633: hypothetical protein; PP_03085; phage(gi428782548) 3e-34 Click
613098969..3098985 attR    CTGCAGGGGACACCATT 0.0 Click
62complement(3099083..3100018) PHAGE_Burkho_phi1026b: gp58; PP_03086; phage(gi38707948) 4e-16 Click

Region 6, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4904159..4905748) PHAGE_Prochl_P_SSM2: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase; PP_04856; phage(gi61806062) 4e-71 Click
24905866..4905988 hypothetical protein ECOK1_4483 [Escherichia coli IHE3034] gi|386602043|ref|YP_006103549.1|; PP_04857 3e-15 Click
3complement(4906215..4906751) RepA protein [Escherichia coli ABU 83972] gi|386637349|ref|YP_006104015.1|; PP_04858 3e-46 Click
44907853..4907981 PHAGE_Entero_mEp460: host specificity protein; PP_04859; phage(gi428782334) 7e-13 Click
54907971..4908714 PHAGE_Entero_HK630: tail fiber J; PP_04860; phage(gi428782808) 7e-140 Click
64908870..4909007 PHAGE_Entero_cdtI: putative tail tip assembly protein; PP_04861; phage(gi148609400) 3e-12 Click
7complement(4909313..4909765) PROPHAGE_Escher_CFT073: transposase/IS protein; PP_04862; phage(gi26248359) 1e-65 Click
8complement(4909765..4910895) PROPHAGE_Escher_CFT073: transposase; PP_04863; phage(gi26248360) 0.0 Click
94910977..4911189 PHAGE_Entero_4795: putative transposase OrfB protein of IS629; PP_04864; phage(gi157166067) 1e-21 Click
104911781..4912113 putative transposase protein [Escherichia coli UM146] gi|386602626|ref|YP_006104134.1|; PP_04865 9e-55 Click
11complement(4912141..4912278) hypothetical protein XCR_3970 [Xanthomonas campestris pv. raphani 756C] gi|384429587|ref|YP_005638947.1|; PP_04866 6e-11 Click
12complement(4912443..4913006) PHAGE_Thalas_BA3: hypothetical protein BA3_0002; PP_04867; phage(gi160700596) 5e-19 Click