Pseudomonas syringae pv. oryzae str. 1_6, whole genome shotgun [asmbl_id: NC_000000].6704257, GC%: 57.89%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12849628..2849642 attL    TCGAGCAGGGCATGC 0.0 Click
22862036..2862542 PHAGE_Mycoba_D29: gp36.1; POR16_14627; phage(gi9630421) 1e-09 Click
3complement(2862539..2864152) PHAGE_Entero_285P: gp16; POR16_14632; phage(gi326536141) 4e-08 Click
42864242..2868138 PHAGE_Macaci_4: BNRF1; POR16_14637; phage(gi51518016) 5e-33 Click
52868144..2868455 PHAGE_Megavi_lba: hypothetical protein; POR16_14642; phage(gi448826036) 2e-14 Click
6complement(2868639..2869202) hypothetical protein; POR16_14647 0.0 Click
7complement(2869280..2869831) PHAGE_Burkho_Bcep1: gp18; POR16_14652; phage(gi38638625) 2e-06 Click
82869982..2870578 mutT/nudix family protein; POR16_14657 0.0 Click
92870655..2871179 PHAGE_Bathyc_BpV1: hypothetical protein; POR16_14662; phage(gi313768028) 6e-08 Click
102871179..2871406 hypothetical protein; POR16_14667 0.0 Click
112871409..2871876 hypothetical protein; POR16_14672 0.0 Click
122871979..2873160 phosphoribosylglycinamide formyltransferase 2; POR16_14677 0.0 Click
13complement(2873216..2874526) PHAGE_Burkho_phi1026b: gp59; POR16_14682; phage(gi38707949) 2e-42 Click
14complement(2874663..2875910) CBS domain-containing protein; POR16_14687 0.0 Click
15complement(2875923..2876735) hypothetical protein; POR16_14692 0.0 Click
162876949..2877262 signal recognition particle protein; POR16_14697 0.0 Click
172877263..2877453 30S ribosomal protein S16; POR16_14702 0.0 Click
182877459..2877998 16S rRNA-processing protein RimM; POR16_14707 0.0 Click
192878004..2878756 tRNA (guanine-N(1)-)-methyltransferase; POR16_14712 0.0 Click
202878801..2879151 50S ribosomal protein L19; POR16_14717 0.0 Click
212879255..2880151 PHAGE_Thermu_26: phage XerD-like integrase; POR16_14722; phage(gi157265417) 7e-15 Click
222893340..2893354 attR    TCGAGCAGGGCATGC 0.0 Click

Region 2, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3276962..3277111) PHAGE_Pseudo_F10: Integrase; POR16_16811; phage(gi148912793) 2e-13 Click
23277187..3277893 PHAGE_Burkho_KS9: DNA adenine methylase gp25; POR16_16818; phage(gi255033757) 5e-85 Click
33277910..3278146 hypothetical protein; POR16_16823 0.0 Click
43278819..3279383 hypothetical protein; POR16_16838 0.0 Click
5complement(3279611..3280093) type III effector protein AvrPto1; POR16_16843 0.0 Click
6complement(3280821..3281120) hypothetical protein; POR16_16848 0.0 Click
73281426..3282391 avirulence protein; POR16_16853 0.0 Click
8complement(3282683..3283240) UDP-glucose 4-epimerase; POR16_16858 0.0 Click
9complement(3283406..3284062) PHAGE_Burkho_KS14: gp40; POR16_16863; phage(gi327198309) 2e-43 Click
103284228..3284662 hypothetical protein; POR16_16868 0.0 Click
11complement(3284899..3285447) hypothetical protein; POR16_16873 0.0 Click
123285603..3286244 PHAGE_Burkho_KS9: hypothetical protein gp28; POR16_16878; phage(gi255033760) 2e-33 Click
133287180..3287434 SpoVT/AbrB-like protein; POR16_16883 0.0 Click
143287431..3287778 PHAGE_Lactob_Lj771: MazF-like protein; POR16_16888; phage(gi163932202) 1e-05 Click
153287795..3288046 hypothetical protein; POR16_16893 0.0 Click
163288366..3288644 hypothetical protein; POR16_16898 0.0 Click
17complement(3288662..3290584) PHAGE_Entero_mEp460: side tail fiber protein; POR16_16903; phage(gi428782336) 2e-05 Click
183290916..3291194 PROPHAGE_Xantho_33913: ISxac3 transposase; POR16_16908; phage(gi21231087) 9e-27 Click
193291185..3292066 PROPHAGE_Xantho_33913: ISxac3 transposase; POR16_16913; phage(gi21231086) 4e-102 Click
203292059..3292193 hypothetical protein; POR16_16918 0.0 Click
213292922..3293806 PHAGE_Mycoba_Omega: gp105; POR16_16923; phage(gi29566839) 6e-09 Click
22complement(3293990..3294466) hypothetical protein; POR16_16928 0.0 Click
233294545..3295492 putative oxidoreductase; POR16_16933 0.0 Click
24complement(3296268..3296682) PHAGE_Lactob_A2: integrase; POR16_16938; phage(gi22296542) 3e-05 Click

Region 3, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15242904..5242923 attL    TGGCGTTGGCGCGCCTGACT 0.0 Click
2complement(5247343..5247954) PHAGE_Entero_ST64T: C2; POR16_27086; phage(gi24371557) 4e-51 Click
35248144..5248581 hypothetical protein; POR16_27091 0.0 Click
45248863..5249398 PHAGE_Entero_SfV: hypothetical protein SfVp09; POR16_27096; phage(gi19548999) 2e-12 Click
55249395..5249583 PHAGE_Entero_SfV: hypothetical protein SfVp10; POR16_27101; phage(gi19549000) 1e-07 Click
65249602..5251098 PHAGE_Entero_SfV: tail sheath protein; POR16_27106; phage(gi19549001) 5e-148 Click
75251160..5251507 PHAGE_Entero_SfV: hypothetical protein SfVp12; POR16_27111; phage(gi19549002) 1e-16 Click
85251504..5251800 PHAGE_Entero_SfV: hypothetical protein SfVp13; POR16_27116; phage(gi19549003) 6e-14 Click
95251931..5254090 PHAGE_Entero_SfV: tail protein; POR16_27121; phage(gi19549004) 1e-36 Click
105254087..5255544 PHAGE_Entero_SfV: tail/DNA circulation protein; POR16_27126; phage(gi19549005) 4e-45 Click
115255548..5256675 PHAGE_Entero_SfV: tail protein; POR16_27131; phage(gi19549006) 7e-66 Click
125256672..5257184 PHAGE_Entero_SfV: tail protein; POR16_27136; phage(gi19549007) 2e-21 Click
135257181..5257579 PHAGE_Entero_SfV: tail protein; POR16_27141; phage(gi19549008) 3e-24 Click
145257569..5258609 PHAGE_Entero_SfV: tail protein; POR16_27146; phage(gi19549009) 6e-59 Click
155258597..5259196 PHAGE_Entero_SfV: tail protein; POR16_27151; phage(gi19548988) 2e-14 Click
165259207..5260667 PHAGE_Burkho_KS14: gp18; POR16_27156; phage(gi327198287) 8e-18 Click
175260675..5261241 PHAGE_Entero_HK630: tail fiber assembly protein; POR16_27161; phage(gi428782810) 7e-13 Click
185261493..5262551 tail fiber assembly domain-containing protein; POR16_27166 0.0 Click
195262659..5263204 PHAGE_Salmon_PVP_SE1: lysozyme; POR16_27171; phage(gi363539668) 1e-53 Click
205263201..5263710 PHAGE_Burkho_Bcep22: Bcep22gp80; POR16_27176; phage(gi38640385) 5e-11 Click
215263943..5263962 attR    TGGCGTTGGCGCGCCTGACT 0.0 Click
225264304..5265485 PROPHAGE_Escher_CFT073: putative prophage integrase; POR16_27181; phage(gi26250313) 4e-72 Click

Region 4, total : 43 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(5270483..5270806) PHAGE_Burkho_AH2: excisionase; POR16_27221; phage(gi399529070) 4e-06 Click
2complement(5270803..5271177) hypothetical protein; POR16_27226 0.0 Click
3complement(5271318..5271602) hypothetical protein; POR16_27231 0.0 Click
4complement(5271611..5272186) hypothetical protein; POR16_27236 0.0 Click
5complement(5272443..5273225) PHAGE_Pseudo_F116: transcriptional regulator; POR16_27241; phage(gi56692918) 9e-35 Click
65273313..5273570 PHAGE_Escher_HK639: cro; POR16_27246; phage(gi356870651) 8e-06 Click
75273881..5274399 PHAGE_Burkho_Bcep176: gp14; POR16_27251; phage(gi77864639) 2e-08 Click
85274392..5274619 PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp42; POR16_27256; phage(gi17313259) 6e-09 Click
95274609..5276368 PHAGE_Stenot_S1: putative primase; POR16_27261; phage(gi213163899) 1e-53 Click
105276892..5277218 PHAGE_Entero_SfV: holin; POR16_27266; phage(gi19549036) 1e-14 Click
115277215..5277601 PHAGE_Pseudo_phiCTX: predicted lysis; POR16_27271; phage(gi17313230) 8e-09 Click
125277660..5277749 hypothetical protein; POR16_27276 0.0 Click
13complement(5277926..5278333) hypothetical protein; POR16_27281 0.0 Click
145278516..5279085 hypothetical protein; POR16_27286 0.0 Click
155281121..5281327 hypothetical protein; POR16_27301 0.0 Click
165281324..5282805 PHAGE_Vibrio_vB_VpaM_MAR: portal protein; POR16_27306; phage(gi428782728) 3e-90 Click
175282802..5283947 PHAGE_Entero_mEp213: head maturation protease; POR16_27311; phage(gi428782594) 1e-41 Click
185283944..5284288 hypothetical protein; POR16_27316 0.0 Click
195284376..5285371 PHAGE_Entero_01: major capsid protein; POR16_27321; phage(gi38707831) 3e-21 Click
205285374..5285688 hypothetical protein; POR16_27326 0.0 Click
215285685..5285787 hypothetical protein; POR16_27331 0.0 Click
225285788..5286347 PHAGE_Vibrio_vB_VpaM_MAR: hypothetical protein; POR16_27336; phage(gi428782733) 6e-15 Click
235286340..5286867 PHAGE_Vibrio_vB_VpaM_MAR: hypothetical protein; POR16_27341; phage(gi428782734) 6e-11 Click
245286867..5287451 PHAGE_Burkho_phi52237: phage baseplate assembly protein; POR16_27346; phage(gi72537705) 5e-18 Click
255287620..5287772 hypothetical protein; POR16_27351 0.0 Click
265287776..5288102 PHAGE_Pseudo_phiCTX: predicted baseplate; POR16_27356; phage(gi17313236) 2e-17 Click
275288099..5288980 PHAGE_Pseudo_phiCTX: predicted baseplate or base of tail fiber; POR16_27361; phage(gi17313237) 4e-77 Click
285288982..5289587 PHAGE_Ralsto_phiRSA1: phage tail protein gpI; POR16_27366; phage(gi145708096) 4e-54 Click
295289584..5291746 PHAGE_Ralsto_phiRSA1: tail fiber protein gpH; POR16_27371; phage(gi145708097) 7e-85 Click
305291754..5292296 PHAGE_Aeromo_phiO18P: putative tail fiber assembly protein; POR16_27376; phage(gi148727172) 1e-08 Click
315292390..5293553 PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp24; POR16_27381; phage(gi17313241) 2e-57 Click
325293572..5294075 PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp25; POR16_27386; phage(gi17313242) 8e-28 Click
335294121..5294393 hypothetical protein; POR16_27391 0.0 Click
345294532..5297285 PHAGE_Haemop_SuMu: bacteriophage tail length determination protein; POR16_27396; phage(gi418489066) 5e-26 Click
355297295..5298140 PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp29; POR16_27401; phage(gi17313246) 3e-13 Click
365298115..5298321 PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp09; POR16_27406; phage(gi17313226) 1e-06 Click
375298414..5298632 PHAGE_Vibrio_vB_VpaM_MAR: putative tail protein; POR16_27411; phage(gi428782753) 4e-12 Click
385298633..5299485 PHAGE_Vibrio_vB_VpaM_MAR: putative tail protein; POR16_27416; phage(gi428782753) 9e-31 Click
395299524..5300069 PHAGE_Salmon_PVP_SE1: lysozyme; POR16_27421; phage(gi363539668) 3e-50 Click
40complement(5300110..5300571) hypothetical protein; POR16_27426 0.0 Click
41complement(5300549..5300944) bacteriocin; POR16_27431 0.0 Click
42complement(5300973..5301473) hypothetical protein; POR16_27436 0.0 Click
435301644..5302148 PHAGE_Vibrio_VP882: DNA adenine methylase; POR16_27441; phage(gi126010878) 9e-53 Click

Region 5, total : 68 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15531198..5531209 attL    GTGGCGCGCTGG 0.0 Click
25533078..5535468 PHAGE_Pseudo_MP1412: diguanylate-cyclase GGDEF domain; POR16_28642; phage(gi399529005) 9e-06 Click
3complement(5535554..5537020) D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase; POR16_28647 0.0 Click
45537335..5537679 hypothetical protein; POR16_28652 0.0 Click
5complement(5537760..5538329) PHAGE_Ectoca_1: EsV-1-181; POR16_28657; phage(gi13242651) 1e-06 Click
6complement(5538423..5539526) PHAGE_Entero_mEp235: integrase; POR16_28662; phage(gi428781836) 1e-61 Click
7complement(5539507..5539749) PHAGE_Entero_HK629: excisionase; POR16_28667; phage(gi428782042) 2e-09 Click
8complement(5539786..5540115) hypothetical protein; POR16_28672 0.0 Click
95540240..5540452 hypothetical protein; POR16_28677 0.0 Click
10complement(5540622..5541306) PHAGE_Pseudo_F116: hypothetical protein F116p07; POR16_28682; phage(gi56692934) 1e-32 Click
11complement(5541516..5541914) hypothetical protein; POR16_28687 0.0 Click
12complement(5542117..5542716) PHAGE_Pseudo_PAJU2: hypothetical protein PAJU2_gp43; POR16_28692; phage(gi209552462) 2e-07 Click
13complement(5542713..5543018) PHAGE_Burkho_BcepNazgul: hypothetical protein Nazgul34; POR16_28697; phage(gi34610143) 3e-10 Click
145543286..5543705 hypothetical protein; POR16_28702 0.0 Click
15complement(5543702..5544559) PHAGE_Salmon_vB_SosS_Oslo: NinC protein; POR16_28707; phage(gi399528823) 4e-14 Click
165544892..5545407 hypothetical protein; POR16_28712 0.0 Click
17complement(5545540..5545947) PHAGE_Tetras_TJE1: hypothetical protein; POR16_28717; phage(gi431810837) 5e-12 Click
185546053..5546373 hypothetical protein; POR16_28722 0.0 Click
19complement(5546476..5547288) PHAGE_Xantho_CP2: hypothetical protein; POR16_28727; phage(gi448245210) 3e-48 Click
20complement(5547315..5547662) PHAGE_Vibrio_VvAW1: hypothetical protein; POR16_28732; phage(gi460042912) 4e-25 Click
21complement(5547751..5548338) hypothetical protein; POR16_28737 0.0 Click
22complement(5548338..5548676) hypothetical protein; POR16_28742 0.0 Click
23complement(5548814..5549059) PHAGE_Pseudo_F10: Conserved hypothetical protein; putative transcriptional regulator, LuxR family; POR16_28747; phage(gi148912803) 1e-11 Click
245549214..5549227 attL    CGTCAGGGTCTGTC 0.0 Click
255549467..5549775 PHAGE_Pseudo_F116: hypothetical protein F116p28; POR16_28752; phage(gi56692946) 2e-19 Click
26complement(5549928..5550344) hypothetical protein; POR16_28757 0.0 Click
27complement(5550338..5551057) hypothetical protein; POR16_28762 0.0 Click
28complement(5551054..5551443) hypothetical protein; POR16_28767 0.0 Click
29complement(5551668..5552501) PHAGE_Pseudo_phi297: putative phage repressor; POR16_28772; phage(gi374531272) 1e-53 Click
305552851..5552974 hypothetical protein; POR16_28777 0.0 Click
315552975..5553073 hypothetical protein; POR16_28782 0.0 Click
325553202..5553963 hypothetical protein; POR16_28787 0.0 Click
335553960..5554706 PHAGE_Pseudo_PAJU2: putative replication protein P; POR16_28792; phage(gi209552483) 1e-51 Click
345554703..5555008 PHAGE_Entero_mEp235: hypothetical protein; POR16_28797; phage(gi428781862) 3e-23 Click
355555005..5555436 PHAGE_Psychr_pOW20_A: hypothetical protein; POR16_28802; phage(gi472339811) 2e-15 Click
365555433..5555744 PHAGE_Pseudo_D3: Orf80; POR16_28807; phage(gi9635668) 1e-06 Click
375555741..5557018 PROPHAGE_Mesorh_MAFF303099: phage integrase; POR16_28812; phage(gi13473443) 9e-12 Click
385557021..5557392 hypothetical protein; POR16_28817 0.0 Click
395557491..5557709 hypothetical protein; POR16_28822 0.0 Click
405557712..5558095 PHAGE_Pseudo_PAJU2: putative antitermination protein Q; POR16_28827; phage(gi209552491) 1e-12 Click
41complement(5558257..5558499) hypothetical protein; POR16_28832 0.0 Click
425558654..5558904 hypothetical protein; POR16_28837 0.0 Click
435558904..5559242 PHAGE_Erwini_PEp14: hypothetical protein; POR16_28842; phage(gi374531878) 4e-06 Click
445559298..5559528 PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; POR16_28847; phage(gi414087356) 3e-17 Click
455559554..5559688 hypothetical protein; POR16_28852 0.0 Click
465559692..5560057 hypothetical protein; POR16_28857 0.0 Click
475560108..5560287 hypothetical protein; POR16_28862 0.0 Click
485560278..5560673 PHAGE_Bacill_phi105: hypothetical protein phi105_50; POR16_28867; phage(gi22855043) 3e-35 Click
495560841..5561326 PHAGE_Burkho_phi1026b: gp1; POR16_28872; phage(gi38707891) 1e-50 Click
505561327..5563060 PHAGE_Burkho_2: gp2, phage terminase, large subunit, putative; POR16_28877; phage(gi134288625) 0.0 Click
515563057..5563221 PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; POR16_28882; phage(gi374531648) 8e-12 Click
525563240..5564424 PHAGE_Pseudo_D3: portal protein; POR16_28887; phage(gi9635589) 1e-124 Click
535564428..5565270 PHAGE_Entero_mEp235: head maturation protease; POR16_28892; phage(gi428781814) 2e-60 Click
545565282..5566667 PHAGE_Pseudo_vB_PaeS_PMG1: major capsid protein; POR16_28897; phage(gi374531651) 1e-136 Click
555566718..5567134 PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; POR16_28902; phage(gi374531652) 8e-05 Click
565567138..5567614 PHAGE_Entero_mEp235: head-tail connector II; POR16_28907; phage(gi428781817) 6e-08 Click
575567614..5567952 PHAGE_Entero_mEp235: hypothetical protein; POR16_28912; phage(gi428781819) 2e-27 Click
585567945..5568382 PHAGE_Entero_mEp235: hypothetical protein; POR16_28917; phage(gi428781820) 2e-23 Click
595568383..5568558 2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase; POR16_28922 0.0 Click
605568555..5568857 hypothetical protein; POR16_28927 0.0 Click
615569093..5569206 PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; POR16_28932; phage(gi374531663) 4e-06 Click
625569254..5571830 PHAGE_Pseudo_vB_PaeS_PMG1: tail tape measure protein; POR16_28937; phage(gi374531664) 0.0 Click
635571830..5572174 PHAGE_Entero_mEp234: minor tail protein M; POR16_28942; phage(gi428782269) 2e-18 Click
645572211..5572909 PHAGE_Entero_mEp237: minor tail protein L; POR16_28947; phage(gi435439282) 7e-43 Click
655572912..5573603 PHAGE_Burkho_phiE125: putative tail component protein; POR16_28952; phage(gi17975180) 3e-41 Click
665573604..5577477 PHAGE_Burkho_KS9: tail tip fiber protein gp19; POR16_28957; phage(gi255033750) 0.0 Click
675577509..5577904 hypothetical protein; POR16_28962 0.0 Click
685577904..5578629 hypothetical protein; POR16_28967 0.0 Click
695578702..5580081 PHAGE_Escher_KBNP135: tail fiber protein; POR16_28972; phage(gi410492661) 4e-12 Click
705580147..5580680 PHAGE_Microc_LMM01: chitinase; POR16_28977; phage(gi117530240) 3e-39 Click
715586754..5586767 attR    CGTCAGGGTCTGTC 0.0 Click
725591621..5591632 attR    GTGGCGCGCTGG 0.0 Click

Region 6, total : 67 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
16604056..6604067 attL    TGGTGCTGGACC 0.0 Click
26605550..6605706 PHAGE_Salmon_vB_SenS_Ent1: putative intein containing helicase precursor; POR16_38967; phage(gi423261880) 3e-06 Click
36605707..6605947 TonB-dependent siderophore receptor; POR16_38972 0.0 Click
46605948..6606070 insulinase-like:peptidase M16; POR16_38977 0.0 Click
5complement(6606071..6606265) deoxyribose-phosphate aldolase; POR16_38982 0.0 Click
66606266..6606506 luciferase; POR16_38987 0.0 Click
7complement(6606507..6606732) major facilitator family transporter; POR16_38992 0.0 Click
86606733..6606951 ABC transporter ATP-binding protein; POR16_38997 0.0 Click
9complement(6606952..6607108) hypothetical protein; POR16_39002 0.0 Click
10complement(6607109..6607349) type III helper protein HrpK1; POR16_39007 0.0 Click
11complement(6607350..6607580) carbon starvation protein CstA; POR16_39012 0.0 Click
12complement(6607581..6607811) maltooligosyl trehalose synthase; POR16_39017 0.0 Click
136607812..6608052 PROPHAGE_Escher_Sakai: serine endoprotease; POR16_39022; phage(gi15833361) 1e-14 Click
14complement(6608053..6608161) radical SAM family protein; POR16_39027 0.0 Click
156608162..6608395 PROPHAGE_Escher_EDL933: ATP-dependent Clp protease ATP-binding subunit; POR16_39032; phage(gi15800640) 4e-16 Click
16complement(6608396..6608636) phosphopantetheinyl transferase; POR16_39037 0.0 Click
176608637..6608804 hypothetical protein; POR16_39042 0.0 Click
18complement(6608805..6608925) TonB-dependent siderophore receptor; POR16_39047 0.0 Click
19complement(6608926..6609069) glycosyl transferase family protein; POR16_39052 0.0 Click
206609070..6609309 xylose isomerase; POR16_39057 0.0 Click
216609310..6609525 cobalamin synthesis protein/P47K:cobalamin synthesis protein/P47K; POR16_39062 0.0 Click
226609542..6609777 PROPHAGE_Escher_MG1655: protease specific for Gcp(YgjD), essential for nucleoid maintanence; POR16_39067; phage(gi16129761) 4e-18 Click
23complement(6609778..6610017) PHAGE_Salmon_SPN1S: putative lipopolysaccharide modification acyltransferase 1; POR16_39072; phage(gi374531215) 3e-10 Click
246610018..6610235 amino acid adenylation; POR16_39077 0.0 Click
256610361..6610584 TPR repeat-containing von Willebrand factor, type A; POR16_39082 0.0 Click
266610585..6610825 nonribosomal peptide synthetase; POR16_39087 0.0 Click
27complement(6610826..6611032) PHAGE_Caulob_CcrColossus: putative TerD-like bacterial stress protein; POR16_39092; phage(gi414088275) 1e-09 Click
286611033..6611273 carbamoyl phosphate synthase small subunit; POR16_39097 0.0 Click
29complement(6611274..6611375) polysaccharide export protein; POR16_39102 0.0 Click
306611376..6611528 major facilitator transporter; POR16_39107 0.0 Click
31complement(6611529..6611924) glycine/betaine/L-proline ABC transporter, permease protein; POR16_39112 0.0 Click
32complement(6611925..6612165) amino acid adenylation; POR16_39117 0.0 Click
33complement(6612278..6612457) bifunctional NADH:ubiquinone oxidoreductase subunit C/D; POR16_39122 0.0 Click
34complement(6612941..6613181) major facilitator transporter; POR16_39127 0.0 Click
356613182..6613377 uroporphyrin-III C-methyltransferase, putative; POR16_39132 0.0 Click
36complement(6613420..6613602) hypothetical protein; POR16_39137 0.0 Click
376613605..6613835 ABC transporter; POR16_39142 0.0 Click
386613837..6614067 glycoside hydrolase, family alpha amylase catalytic subunit; POR16_39147 0.0 Click
39complement(6614068..6614250) hypothetical protein; POR16_39152 0.0 Click
406614333..6614476 hypothetical protein; POR16_39157 0.0 Click
416614477..6614688 oligopeptidase B; POR16_39162 0.0 Click
426614689..6614841 transcriptional regulatory protein; POR16_39167 0.0 Click
436614842..6614956 peptidylprolyl isomerase, FKBP-type; POR16_39172 0.0 Click
446614957..6615197 3-hydroxyisobutyrate dehydrogenase family protein; POR16_39177 0.0 Click
456615198..6615312 TonB-dependent siderophore receptor; POR16_39182 0.0 Click
466615313..6615409 hypothetical protein; POR16_39187 0.0 Click
47complement(6615687..6615868) hypothetical protein; POR16_39192 0.0 Click
486615928..6616149 cyclic di-GMP binding protein WssC; POR16_39197 0.0 Click
49complement(6616150..6616390) carboxyphosphonoenolpyruvate phosphonomutase; POR16_39202 0.0 Click
50complement(6616500..6616619) hypothetical protein; POR16_39207 0.0 Click
516616623..6616843 aldehyde oxidase and xanthine dehydrogenase family protein; POR16_39212 0.0 Click
526616844..6617084 amino acid adenylation; POR16_39217 0.0 Click
53complement(6617171..6617325) response regulator; POR16_39222 0.0 Click
54complement(6617326..6617566) Maf-like protein; POR16_39227 0.0 Click
556617567..6617808 hypothetical protein; POR16_39232 0.0 Click
56complement(6617809..6617994) TonB-dependent siderophore receptor; POR16_39237 0.0 Click
57complement(6618259..6618351) 3-hydroxyisobutyrate dehydrogenase; POR16_39242 0.0 Click
58complement(6618352..6618586) citrate-proton symporter; POR16_39247 0.0 Click
596618587..6618811 hypothetical protein; POR16_39252 0.0 Click
606619053..6619282 hypothetical protein; POR16_39257 0.0 Click
616619283..6619499 hypothetical protein; POR16_39262 0.0 Click
62complement(6619510..6619740) LysR family transcriptional regulator; POR16_39267 0.0 Click
63complement(6619741..6619905) type III helper protein HrpZ1; POR16_39272 0.0 Click
646620220..6620435 acetyl-CoA hydrolase; POR16_39277 0.0 Click
65complement(6620436..6620555) hypothetical protein; POR16_39282 0.0 Click
666620556..6620758 quinate dehydrogenase; POR16_39287 0.0 Click
676620761..6620999 hypothetical protein; POR16_39292 0.0 Click
686620762..6620773 attR    TGGTGCTGGACC 0.0 Click
69complement(6621000..6621240) PROPHAGE_Xantho_306: integrase/recombinase; POR16_39297; phage(gi21244651) 2e-11 Click

Region 7, total : 33 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
16688022..6688233 Phage integrase; POR16_39782 0.0 Click
2complement(6688234..6688697) RHS family protein; POR16_39787 0.0 Click
3complement(6688698..6688902) YD repeat-containing protein; POR16_39792 0.0 Click
4complement(6688903..6689123) pyoverdine sidechain peptide synthetase III, L-Thr-L-Ser component; POR16_39797 0.0 Click
5complement(6689124..6689317) Rhs family protein; POR16_39802 0.0 Click
66689552..6689753 pyoverdine sidechain peptide synthetase IV, D-Asp-L-Ser component; POR16_39807 0.0 Click
76689754..6689881 ISPsy13, transposase OrfB; POR16_39812 0.0 Click
86689882..6690045 calcium binding hemolysin protein; POR16_39817 0.0 Click
96690046..6690210 hypothetical protein; POR16_39822 0.0 Click
106690211..6690482 pyoverdine sidechain peptide synthetase III, L-Thr-L-Ser component; POR16_39827 0.0 Click
116690616..6690891 pyoverdine sidechain peptide synthetase III, L-Thr-L-Ser component; POR16_39832 0.0 Click
12complement(6690892..6691047) pyoverdine sidechain peptide synthetase IV, D-Asp-L-Ser component; POR16_39837 0.0 Click
136691048..6691174 amino acid adenylation; POR16_39842 0.0 Click
146691175..6691407 pyoverdine sidechain peptide synthetase IV, D-Asp-L-Ser component; POR16_39847 0.0 Click
15complement(6691408..6691617) hypothetical protein; POR16_39852 0.0 Click
16complement(6691618..6691810) PHAGE_Burkho_2: gp36, bacteriophage/transposase fusion protein; POR16_39857; phage(gi134288659) 7e-11 Click
17complement(6692003..6692179) hydroxydechloroatrazine ethylaminohydrolase; POR16_39862 0.0 Click
186692293..6692448 hypothetical protein; POR16_39867 0.0 Click
196692449..6692680 hypothetical protein; POR16_39872 0.0 Click
206692741..6692919 PROPHAGE_Brucel_1330: ISBm1, transposase orfA; POR16_39877; phage(gi23501424) 5e-09 Click
21complement(6692920..6693140) pyoverdine sidechain peptide synthetase III, L-Thr-L-Ser component; POR16_39882 0.0 Click
226693141..6693589 hypothetical protein; POR16_39887 0.0 Click
23complement(6693590..6693698) pyoverdine sidechain peptide synthetase III, L-Thr-L-Ser component; POR16_39892 0.0 Click
246693699..6694176 Rhs element Vgr protein; POR16_39897 0.0 Click
256694177..6694410 PHAGE_Burkho_2: gp28; POR16_39902; phage(gi134288620) 2e-05 Click
266694545..6694670 hypothetical protein; POR16_39907 0.0 Click
276694763..6695171 Phage integrase; POR16_39912 0.0 Click
286695172..6695333 PHAGE_Burkho_2: gp36, bacteriophage/transposase fusion protein; POR16_39917; phage(gi134288659) 7e-11 Click
296695334..6699207 PHAGE_Burkho_KS9: tail tip fiber protein gp19; POR16_39922; phage(gi255033750) 0.0 Click
306699239..6699634 hypothetical protein; POR16_39927 0.0 Click
316699634..6700359 hypothetical protein; POR16_39932 0.0 Click
326700432..6701811 PHAGE_Escher_KBNP135: tail fiber protein; POR16_39937; phage(gi410492661) 4e-12 Click
336701877..6702410 PHAGE_Microc_LMM01: chitinase; POR16_39942; phage(gi117530240) 3e-39 Click