Neisseria gonorrhoeae PID24-1 .1, whole genome shotgun [asmbl_id: NC_000000].2033752, GC%: 52.70%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 33 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1632748..632811 attL    GCCGTTTCCGCCGCAAAGCAAAACCGCCCTGATTCAGGGCGGTTCTTTTTTGTTCAGGTTGTGT 0.0 Click
2632927..634147 PROPHAGE_Escher_MG1655: CP4-57 prophage; integrase; PP_00795; phage(gi16130540) 3e-51 Click
3complement(634503..634772) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800901|ref|YP_207613.1|; PP_00796 4e-44 Click
4complement(634967..635650) PHAGE_Pseudo_JBD24: hypothetical protein; PP_00797; phage(gi448245062) 8e-26 Click
5635775..636035 hypothetical; PP_00798 0.0 Click
6636275..636493 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801486|ref|YP_208198.1|; PP_00799 1e-31 Click
7complement(636510..636869) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801485|ref|YP_208197.1|; PP_00800 2e-67 Click
8complement(636870..637409) PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_00801; phage(gi399498806) 3e-33 Click
9complement(637569..638273) PHAGE_Pseudo_F116: transcriptional regulator; PP_00802; phage(gi56692918) 6e-26 Click
10638604..639221 PHAGE_Synech_S_CBS4: hypothetical protein; PP_00803; phage(gi374531810) 4e-05 Click
11complement(639279..639398) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801473|ref|YP_208185.1|; PP_00804 4e-20 Click
12639398..639547 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801473|ref|YP_208185.1|; PP_00805 4e-20 Click
13639616..639918 PHAGE_Pseudo_F116: hypothetical protein F116p35; PP_00806; phage(gi56692951) 1e-15 Click
14639915..640298 PHAGE_Pseudo_PAJU2: putative NinB; PP_00807; phage(gi209552487) 5e-21 Click
15640289..640807 PHAGE_Xantho_OP1: HNH endonuclease family protein; PP_00808; phage(gi84662624) 2e-32 Click
16complement(640782..640925) hypothetical; PP_00809 0.0 Click
17640899..641294 PHAGE_Pseudo_F116: hypothetical protein F116p37; PP_00810; phage(gi56692953) 1e-16 Click
18641261..641536 PHAGE_Escher_HK639: terminase small subunit; PP_00811; phage(gi356870601) 1e-06 Click
19641591..641833 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801466|ref|YP_208178.1|; PP_00812 5e-37 Click
20641814..643088 PHAGE_Bdello_phi1422: putative TerL large-subunit terminase; PP_00813; phage(gi422936857) 1e-54 Click
21643085..645319 PHAGE_Pseudo_F116: portal protein; PP_00814; phage(gi56692922) 0.0 Click
22645562..646440 PHAGE_Salmon_SPN3UB: KilA-N domain protein; PP_00815; phage(gi423262448) 2e-21 Click
23646686..647882 PHAGE_Pseudo_F116: hypothetical protein F116p58; PP_00816; phage(gi56692969) 1e-05 Click
24complement(647843..647959) hypothetical; PP_00818 0.0 Click
25647933..649555 PHAGE_Human__2: EBNA-1; PP_00817; phage(gi139424506) 1e-10 Click
26649521..652991 PHAGE_Pseudo_F116: hypothetical protein F116p60; PP_00819; phage(gi56692971) 4e-40 Click
27653084..653596 PHAGE_Pseudo_F116: hypothetical protein F116p42; PP_00820; phage(gi56692955) 2e-20 Click
28653617..654912 PHAGE_Pseudo_F116: virion structural protein; PP_00821; phage(gi56692923) 1e-135 Click
29654967..655440 PHAGE_Pseudo_F116: virion structural protein; PP_00822; phage(gi56692924) 6e-29 Click
30655446..655931 PHAGE_Pseudo_F116: hypothetical protein F116p45; PP_00823; phage(gi56692956) 2e-09 Click
31655928..656203 PHAGE_Pseudo_F116: hypothetical protein F116p46; PP_00824; phage(gi56692957) 2e-12 Click
32656194..656601 PHAGE_Pseudo_F116: hypothetical protein F116p46; PP_00825; phage(gi56692957) 3e-30 Click
33656598..656753 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801453|ref|YP_208165.1|; PP_00826 1e-20 Click
34complement(656790..657635) PHAGE_Haemop_Aaphi23: putative antirepressor protein Ant; PP_00827; phage(gi31544021) 5e-38 Click
35658582..658645 attR    GCCGTTTCCGCCGCAAAGCAAAACCGCCCTGATTCAGGGCGGTTCTTTTTTGTTCAGGTTGTGT 0.0 Click

Region 2, total : 45 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11131414..1131429 attL    CGTTTCAGACGGCATC 0.0 Click
21137793..1138956 PHAGE_Burkho_AH2: integrase; PP_01399; phage(gi399529076) 2e-49 Click
3complement(1139006..1139272) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801942|ref|YP_208654.1|; PP_01400 3e-44 Click
4complement(1139380..1139631) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801943|ref|YP_208655.1|; PP_01401 2e-44 Click
5complement(1139638..1140258) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801943|ref|YP_208655.1|; PP_01402 6e-116 Click
6complement(1140267..1140521) PHAGE_Human__2: EBNA-1; PP_01403; phage(gi139424506) 1e-16 Click
7complement(1140539..1141015) PHAGE_Iodoba_phiPLPE: hypothetical protein phiPLPE_84; PP_01404; phage(gi197085698) 4e-26 Click
8complement(1141048..1141248) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801487|ref|YP_208199.1|; PP_01405 1e-29 Click
91141382..1141395 attL    AAAAAACCGCCCGA 0.0 Click
10complement(1141446..1141859) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800914|ref|YP_207626.1|; PP_01406 2e-75 Click
11complement(1141856..1142317) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800915|ref|YP_207627.1|; PP_01407 1e-75 Click
12complement(1142334..1142771) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800916|ref|YP_207628.1|; PP_01408 2e-79 Click
13complement(1142884..1143546) PHAGE_Salmon_ST160: C2; PP_01409; phage(gi318065925) 6e-20 Click
141144034..1144441 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800929|ref|YP_207641.1|; PP_01410 1e-72 Click
151144532..1145692 hypothetical protein D11S_1188 [Aggregatibacter actinomycetemcomitans D11S-1] gi|261867868|ref|YP_003255790.1|; PP_01411 3e-141 Click
161145974..1146843 PHAGE_Haemop_Aaphi23: putative antirepressor protein Ant; PP_01412; phage(gi31544021) 3e-47 Click
171147136..1147585 PHAGE_Entero_Sf6: gene 1 protein; PP_01413; phage(gi41057279) 3e-29 Click
181147647..1149068 PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_01414; phage(gi423262000) 3e-156 Click
191149065..1151212 PHAGE_Thermo_THSA_485A: hypothetical protein; PP_01415; phage(gi397912638) 1e-53 Click
201151280..1152437 PHAGE_Thermo_THSA_485A: hypothetical protein; PP_01416; phage(gi397912637) 1e-21 Click
211152478..1153977 PHAGE_Thermo_THSA_485A: hypothetical protein; PP_01417; phage(gi397912636) 1e-32 Click
221153984..1154346 PHAGE_Saimir_2: unnamed protein product; PP_01418; phage(gi9626029) 4e-05 Click
231154349..1154879 PHAGE_Strept_phiSASD1: gp29; PP_01419; phage(gi298103494) 1e-06 Click
241154879..1155361 hypothetical protein NMAA_1620 [Neisseria meningitidis WUE 2594] gi|385338742|ref|YP_005892615.1|; PP_01420 2e-76 Click
251155358..1155786 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800940|ref|YP_207652.1|; PP_01421 3e-77 Click
261155812..1156585 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800941|ref|YP_207653.1|; PP_01422 6e-144 Click
271156646..1156975 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800942|ref|YP_207654.1|; PP_01423 8e-54 Click
281156987..1157253 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800943|ref|YP_207655.1|; PP_01424 1e-44 Click
291157253..1157852 PHAGE_Caulob_CcrRogue: hypothetical protein; PP_01425; phage(gi414088956) 6e-05 Click
301157849..1158703 PHAGE_Caulob_CcrMagneto: putative tail protein; PP_01426; phage(gi414088603) 3e-18 Click
311158705..1159136 PHAGE_Roseob_1: phage cell wall peptidase; PP_01427; phage(gi331028137) 6e-12 Click
32complement(1159164..1159610) PHAGE_Pseudo_phiKZ: ORF114; PP_01428; phage(gi29135050) 6e-13 Click
331159682..1163827 PHAGE_Burkho_KL1: tail protein; PP_01429; phage(gi399528737) 1e-12 Click
341163812..1163937 hypothetical; PP_01430 0.0 Click
351163939..1164244 hypothetical protein NGO0511 [Neisseria gonorrhoeae FA 1090] gi|59800949|ref|YP_207661.1|; PP_01431 2e-52 Click
361164306..1164785 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800951|ref|YP_207663.1|; PP_01432 3e-84 Click
371164786..1164986 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800952|ref|YP_207664.1|; PP_01433 2e-18 Click
381165015..1165149 hypothetical; PP_01434 0.0 Click
39complement(1165146..1165379) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800953|ref|YP_207665.1|; PP_01435 2e-36 Click
40complement(1165387..1165734) PHAGE_Strept_1: transcriptional regulator; PP_01436; phage(gi39653708) 5e-08 Click
41complement(1165734..1165970) pemI-like protein (PemI), phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800955|ref|YP_207667.1|; PP_01437 3e-37 Click
421166177..1166650 PHAGE_Pseudo_vB_Pae_Kakheti25: endolysin; PP_01438; phage(gi388542662) 5e-34 Click
43complement(1166634..1166756) hypothetical; PP_01439 0.0 Click
441166833..1166982 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800959|ref|YP_207671.1|; PP_01440 3e-20 Click
451167012..1170059 PHAGE_Burkho_KL1: tail tape measure; PP_01441; phage(gi399528734) 9e-67 Click
46complement(1170121..1170633) hypothetical protein NMBM01240149_1189 [Neisseria meningitidis M01-240149] gi|385342107|ref|YP_005895978.1|; PP_01442 2e-90 Click
47complement(1170930..1171919) PHAGE_Mannhe_phiMHaA1: integrase; PP_01443; phage(gi109289985) 2e-79 Click
481174205..1174218 attR    AAAAAACCGCCCGA 0.0 Click
491180458..1180473 attR    CGTTTCAGACGGCATC 0.0 Click

Region 3, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11382699..1382731 attL    AACGCCGTACTGGTTTAAATTTAATCCACTATA 0.0 Click
21392566..1393579 PHAGE_Abalon_Victoria/AUS/2009: hypothetical protein; PP_01688; phage(gi410493530) 2e-05 Click
31393624..1393764 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801142|ref|YP_207854.1|; PP_01689 9e-21 Click
4complement(1393749..1393910) hypothetical; PP_01690 0.0 Click
51394003..1394251 PHAGE_Haemop_HP2: hypothetical protein HP2p14; PP_01691; phage(gi17981828) 3e-05 Click
6complement(1394265..1394573) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801145|ref|YP_207857.1|; PP_01692 6e-54 Click
7complement(1394698..1395948) PHAGE_Haemop_HP2: tail fibers; PP_01693; phage(gi17981847) 9e-60 Click
8complement(1396380..1396949) PHAGE_Haemop_HP2: tail fibers; PP_01694; phage(gi17981847) 1e-17 Click
9complement(1396989..1397552) PHAGE_Burkho_phiE255: gp25, tail fiber; PP_01695; phage(gi134288819) 1e-26 Click
10complement(1397642..1397959) PHAGE_Burkho_BcepMu: gp50; PP_01696; phage(gi48696960) 1e-05 Click
11complement(1397935..1398435) PROPHAGE_Salmon_Ty2: phage baseplate assembly protein; PP_01697; phage(gi29143752) 1e-34 Click
12complement(1398456..1398782) PHAGE_Pseudo_phiCTX: predicted baseplate; PP_01699; phage(gi17313236) 9e-18 Click
13complement(1398779..1398973) PHAGE_Escher_D108: baseplate assembly protein; PP_01698; phage(gi281199690) 9e-05 Click
14complement(1399073..1399279) hypothetical; PP_01700 0.0 Click
15complement(1399369..1399491) hypothetical; PP_01701 0.0 Click
16complement(1399464..1399676) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801148|ref|YP_207860.1|; PP_01702 3e-35 Click
17complement(1399688..1399960) PROPHAGE_Shigel_301: putative P4-type integrase; PP_01703; phage(gi24114228) 1e-20 Click
18complement(1400169..1400948) oxidoreductase [Neisseria gonorrhoeae FA 1090] gi|59801152|ref|YP_207864.1|; PP_01704 2e-147 Click
191401257..1401370 hypothetical; PP_01705 0.0 Click
20complement(1401540..1401749) putative hemagglutinin [Neisseria meningitidis alpha710] gi|385329026|ref|YP_005883329.1|; PP_01706 1e-21 Click
211401848..1402906 PHAGE_Salmon_vB_SosS_Oslo: error-prone lesion bypass DNA polymerase V; PP_01707; phage(gi399528790) 2e-17 Click
221407179..1407211 attR    AACGCCGTACTGGTTTAAATTTAATCCACTATA 0.0 Click

Region 4, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1691665..1692312) PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_02075; phage(gi399498806) 5e-08 Click
2complement(1692432..1692833) PHAGE_Haemop_HP2: hypothetical protein HP2p14; PP_02076; phage(gi17981828) 9e-16 Click
3complement(1692937..1693119) PHAGE_Haemop_HP2: hypothetical protein HP2p13; PP_02077; phage(gi19289355) 1e-12 Click
4complement(1693289..1694092) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801957|ref|YP_208669.1|; PP_02078 3e-149 Click
5complement(1694380..1695135) PHAGE_Pseudo_F116: transcriptional regulator; PP_02079; phage(gi56692918) 8e-24 Click
61695272..1695457 PHAGE_Pseudo_F116: Cro-like protein; PP_02080; phage(gi56692919) 1e-11 Click
71695526..1696566 PHAGE_Aggreg_S1249: replication protein; PP_02081; phage(gi273809588) 3e-16 Click
81696580..1697359 PHAGE_Pseudo_F10: DNA replication protein DnaC; PP_02082; phage(gi148912818) 3e-34 Click
91697674..1697958 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801973|ref|YP_208685.1|; PP_02083 1e-43 Click
101697959..1699146 PHAGE_Ralsto_p12J: ORF7; PP_02084; phage(gi156535142) 6e-28 Click
111699106..1699279 hypothetical protein NMBB_1046 [Neisseria meningitidis alpha710] gi|385328254|ref|YP_005882557.1|; PP_02085 3e-24 Click
121699361..1700317 PROPHAGE_Escher_CFT073: transposase; PP_02086; phage(gi26248352) 2e-08 Click
13complement(1700330..1700461) hypothetical; PP_02087 0.0 Click
141700608..1701093 PHAGE_Vibrio_ICP1: putative Gp5 baseplate hub subunit and tail lysozyme; PP_02088; phage(gi325171175) 1e-12 Click
15complement(1701162..1701278) hypothetical; PP_02089 0.0 Click
161701296..1701637 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801978|ref|YP_208690.1|; PP_02090 2e-61 Click
171701683..1701802 hypothetical protein NMBB_1006 [Neisseria meningitidis alpha710] gi|385328216|ref|YP_005882519.1|; PP_02091 8e-14 Click
18complement(1701842..1702684) PHAGE_Haemop_Aaphi23: putative antirepressor protein Ant; PP_02092; phage(gi31544021) 5e-34 Click