Neisseria gonorrhoeae PID1 .1, whole genome shotgun sequence. [asmbl_id: NC_000000].2091324, GC%: 52.51%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 54 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1723575..723629 attL    CCGTTTCCGCCGCAAAGCAAAACCGCCCTGATTCAGGGCGGTTCTTTTTTGTTCA 0.0 Click
2723753..724970 PROPHAGE_Escher_MG1655: CP4-57 prophage; integrase; PP_00852; phage(gi16130540) 1e-49 Click
3complement(725326..725595) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800901|ref|YP_207613.1|; PP_00853 4e-44 Click
4complement(725790..726473) PHAGE_Pseudo_JBD24: hypothetical protein; PP_00854; phage(gi448245062) 8e-26 Click
5complement(726484..727062) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800903|ref|YP_207615.1|; PP_00855 1e-94 Click
6complement(727131..727346) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801945|ref|YP_208657.1|; PP_00856 1e-32 Click
7727867..728085 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801486|ref|YP_208198.1|; PP_00857 1e-31 Click
8complement(728102..728461) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801485|ref|YP_208197.1|; PP_00858 2e-67 Click
9complement(728462..729001) PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_00859; phage(gi399498806) 3e-33 Click
10complement(729161..729877) PHAGE_Pseudo_F116: transcriptional regulator; PP_00860; phage(gi56692918) 6e-26 Click
11complement(730053..730190) hypothetical; PP_00861 0.0 Click
12complement(730159..730719) PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PP_00862; phage(gi374531698) 9e-18 Click
13complement(730716..730898) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801947|ref|YP_208659.1|; PP_00863 3e-27 Click
14complement(731038..731718) PHAGE_Salini_CW02: hypothetical protein; PP_00864; phage(gi423261934) 7e-06 Click
15complement(731793..731954) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801949|ref|YP_208661.1|; PP_00865 1e-23 Click
16complement(731951..732226) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801950|ref|YP_208662.1|; PP_00866 1e-44 Click
17complement(732379..732711) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801490|ref|YP_208202.1|; PP_00867 3e-58 Click
18complement(732708..732971) PHAGE_Rhodob_RcapNL: hypothetical protein; PP_00868; phage(gi461475003) 4e-10 Click
19complement(732989..733465) PHAGE_Iodoba_phiPLPE: hypothetical protein phiPLPE_84; PP_00869; phage(gi197085698) 4e-26 Click
20complement(733498..733698) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801487|ref|YP_208199.1|; PP_00870 1e-29 Click
21complement(734306..734767) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800915|ref|YP_207627.1|; PP_00871 1e-75 Click
22complement(734784..735221) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800916|ref|YP_207628.1|; PP_00872 2e-79 Click
23complement(735334..735996) PHAGE_Salmon_ST160: C2; PP_00873; phage(gi318065925) 6e-20 Click
24736332..736448 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801476|ref|YP_208188.1|; PP_00874 4e-06 Click
25736487..736981 PHAGE_Synech_S_CBS4: hypothetical protein; PP_00875; phage(gi374531810) 2e-05 Click
26complement(737056..737169) hypothetical; PP_00876 0.0 Click
27complement(738634..739623) hypothetical protein NMBM01240355_2042 [Neisseria meningitidis M01-240355] gi|385856112|ref|YP_005902625.1|; PP_00877 2e-114 Click
28complement(739663..740625) MafA adhesin [Neisseria lactamica 020-06] gi|313667567|ref|YP_004047851.1|; PP_00878 0.0 Click
29740640..741113 PROPHAGE_Ralsto_GMI1000: ISRSO11-transposase ORFA protein; PP_00879; phage(gi17546156) 4e-16 Click
30741118..741696 PROPHAGE_Ralsto_GMI1000: isrso11-transposase orfb protein; PP_00880; phage(gi17546155) 6e-57 Click
31741660..741938 PROPHAGE_Ralsto_GMI1000: isrso11-transposase orfb protein; PP_00881; phage(gi17546155) 9e-27 Click
32742068..742202 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801479|ref|YP_208191.1|; PP_00882 4e-18 Click
33742199..742336 hypothetical; PP_00883 0.0 Click
34742323..743384 PHAGE_Haemop_Aaphi23: putative DNA replication protein O; PP_00884; phage(gi31544014) 7e-36 Click
35743381..744742 PHAGE_Marino_P12026: replicative DNA helicase; PP_00885; phage(gi399528354) 3e-61 Click
36744759..745004 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801476|ref|YP_208188.1|; PP_00886 7e-28 Click
37744997..745302 PHAGE_Pseudo_F116: hypothetical protein F116p35; PP_00887; phage(gi56692951) 4e-15 Click
38745299..745682 PHAGE_Pseudo_PAJU2: putative NinB; PP_00888; phage(gi209552487) 5e-21 Click
39745673..746191 PHAGE_Xantho_OP1: HNH endonuclease family protein; PP_00889; phage(gi84662624) 2e-32 Click
40complement(746166..746309) hypothetical; PP_00890 0.0 Click
41746322..746678 PHAGE_Pseudo_F116: hypothetical protein F116p37; PP_00891; phage(gi56692953) 1e-13 Click
42746645..747217 PHAGE_Escher_HK639: terminase small subunit; PP_00892; phage(gi356870601) 8e-09 Click
43747198..748472 PHAGE_Bdello_phi1422: putative TerL large-subunit terminase; PP_00893; phage(gi422936857) 3e-55 Click
44748469..750724 PHAGE_Pseudo_F116: portal protein; PP_00894; phage(gi56692922) 0.0 Click
45complement(750676..750789) hypothetical; PP_00896 0.0 Click
46750961..752157 PHAGE_Pseudo_F116: hypothetical protein F116p58; PP_00895; phage(gi56692969) 1e-05 Click
47complement(752118..752234) hypothetical; PP_00897 0.0 Click
48752208..759461 PHAGE_Pseudo_F116: hypothetical protein F116p60; PP_00898; phage(gi56692971) 1e-39 Click
49759554..760066 PHAGE_Pseudo_F116: hypothetical protein F116p42; PP_00899; phage(gi56692955) 6e-20 Click
50760087..761382 PHAGE_Pseudo_F116: virion structural protein; PP_00900; phage(gi56692923) 5e-136 Click
51761455..761913 PHAGE_Pseudo_F116: virion structural protein; PP_00901; phage(gi56692924) 1e-28 Click
52761919..762404 PHAGE_Pseudo_F116: hypothetical protein F116p45; PP_00902; phage(gi56692956) 2e-10 Click
53762401..763075 PHAGE_Pseudo_F116: hypothetical protein F116p46; PP_00903; phage(gi56692957) 4e-47 Click
54763072..763227 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801453|ref|YP_208165.1|; PP_00904 2e-18 Click
55complement(763264..764115) PHAGE_Haemop_Aaphi23: putative antirepressor protein Ant; PP_00905; phage(gi31544021) 1e-39 Click
56765063..765117 attR    CCGTTTCCGCCGCAAAGCAAAACCGCCCTGATTCAGGGCGGTTCTTTTTTGTTCA 0.0 Click

Region 2, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1119011..1120069) PHAGE_Salmon_vB_SosS_Oslo: error-prone lesion bypass DNA polymerase V; PP_01344; phage(gi399528790) 1e-16 Click
21120168..1120377 putative hemagglutinin [Neisseria meningitidis alpha710] gi|385329026|ref|YP_005883329.1|; PP_01345 1e-21 Click
31120381..1120677 hypothetical protein NGO0736 [Neisseria gonorrhoeae FA 1090] gi|59801154|ref|YP_207866.1|; PP_01346 9e-50 Click
41120969..1121748 oxidoreductase [Neisseria gonorrhoeae FA 1090] gi|59801152|ref|YP_207864.1|; PP_01347 2e-147 Click
51121568..1121580 attL    CTTAAAAAACAAC 0.0 Click
61121957..1123027 PROPHAGE_Escher_CFT073: prophage P4 integrase; PP_01348; phage(gi26249391) 5e-43 Click
71122988..1123236 putative phage integrase [Neisseria meningitidis alpha710] gi|385328705|ref|YP_005883008.1|; PP_01349 8e-40 Click
81123256..1123519 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801151|ref|YP_207863.1|; PP_01350 3e-41 Click
91123556..1124158 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801150|ref|YP_207862.1|; PP_01351 1e-47 Click
101124554..1124748 PHAGE_Escher_D108: baseplate assembly protein; PP_01352; phage(gi281199690) 9e-05 Click
111124745..1125071 PHAGE_Pseudo_phiCTX: predicted baseplate; PP_01353; phage(gi17313236) 9e-18 Click
121125092..1125592 PROPHAGE_Salmon_Ty2: phage baseplate assembly protein; PP_01354; phage(gi29143752) 1e-34 Click
131125568..1125885 PHAGE_Burkho_BcepMu: gp50; PP_01355; phage(gi48696960) 1e-05 Click
141125975..1126538 PHAGE_Burkho_phiE255: gp25, tail fiber; PP_01356; phage(gi134288819) 1e-26 Click
151126578..1127147 PHAGE_Haemop_HP2: tail fibers; PP_01357; phage(gi17981847) 1e-17 Click
161127579..1128829 PHAGE_Haemop_HP2: tail fibers; PP_01358; phage(gi17981847) 9e-60 Click
171128941..1129270 phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59801145|ref|YP_207857.1|; PP_01359 6e-49 Click
18complement(1129286..1129597) PHAGE_Yersin_phiR1_37: putative plasmid maintenance system antidote protein; PP_01360; phage(gi358356792) 1e-08 Click
19complement(1129594..1129887) Plasmid maintenance system killer protein; Toxin higB-1 [Neisseria meningitidis alpha710] gi|385328333|ref|YP_005882636.1|; PP_01361 3e-32 Click
201129969..1130406 PHAGE_Aggreg_S1249: putative tail fiber assembly protein; PP_01362; phage(gi273809545) 1e-15 Click
211130409..1130582 hypothetical protein NMBB_1245 [Neisseria meningitidis alpha710] gi|385328414|ref|YP_005882717.1|; PP_01363 3e-18 Click
22complement(1130674..1130997) hypothetical protein NMBB_2286 [Neisseria meningitidis alpha710] gi|385329238|ref|YP_005883541.1|; PP_01364 4e-12 Click
23complement(1131045..1131428) PHAGE_Haemop_HP2: hypothetical protein HP2p14; PP_01365; phage(gi17981828) 2e-14 Click
24complement(1131533..1131673) hypothetical protein NMCC_1301 [Neisseria meningitidis 053442] gi|161870260|ref|YP_001599430.1|; PP_01366 3e-20 Click
25complement(1131718..1132731) PHAGE_Pseudo_LBL3: putative structural protein; PP_01367; phage(gi197261393) 4e-05 Click
261142748..1142760 attR    CTTAAAAAACAAC 0.0 Click

Region 3, total : 13 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1349225..1350361) PHAGE_Prochl_P_SSM2: phosphoribosylaminoimidazole synthetase; PP_01608; phage(gi61806048) 1e-68 Click
21350500..1350688 hypothetical protein NGO0525 [Neisseria gonorrhoeae FA 1090] gi|59800963|ref|YP_207675.1|; PP_01609 9e-29 Click
31350688..1350699 attL    AAAAGCCGCCCG 0.0 Click
41350948..1351937 PHAGE_Mannhe_phiMHaA1: integrase; PP_01610; phage(gi109289985) 2e-79 Click
51352234..1352746 hypothetical protein NMBM01240149_1189 [Neisseria meningitidis M01-240149] gi|385342107|ref|YP_005895978.1|; PP_01611 5e-90 Click
6complement(1352806..1355850) PHAGE_Pseudo_73: hypothetical protein ORF020; PP_01612; phage(gi148912848) 4e-61 Click
7complement(1355880..1356029) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800959|ref|YP_207671.1|; PP_01613 3e-20 Click
8complement(1356007..1356171) hypothetical; PP_01615 0.0 Click
9complement(1356171..1356299) hypothetical; PP_01614 0.0 Click
10complement(1356341..1356514) hypothetical protein NMAA_1638 [Neisseria meningitidis WUE 2594] gi|385338760|ref|YP_005892633.1|; PP_01616 2e-23 Click
11complement(1356498..1356842) PHAGE_Entero_vB_KleM_RaK2: hypothetical protein; PP_01617; phage(gi422936900) 1e-06 Click
12complement(1356843..1357382) PHAGE_Pseudo_73: hypothetical protein ORF003; PP_01618; phage(gi148912831) 2e-51 Click
131357589..1357825 pemI-like protein (PemI), phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800955|ref|YP_207667.1|; PP_01619 3e-37 Click
141357825..1358172 PHAGE_Strept_1: transcriptional regulator; PP_01620; phage(gi39653708) 5e-08 Click
151366923..1366934 attR    AAAAGCCGCCCG 0.0 Click

Region 4, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1360847..1364992) PHAGE_Burkho_KL1: tail protein; PP_01630; phage(gi399528737) 2e-12 Click
21365064..1365510 PHAGE_Pseudo_phiKZ: ORF114; PP_01631; phage(gi29135050) 6e-13 Click
3complement(1365538..1365888) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800946|ref|YP_207658.1|; PP_01632 1e-63 Click
4complement(1365971..1366825) PHAGE_Caulob_CcrMagneto: putative tail protein; PP_01633; phage(gi414088603) 3e-18 Click
5complement(1366822..1367421) PHAGE_Caulob_CcrRogue: hypothetical protein; PP_01634; phage(gi414088956) 6e-05 Click
6complement(1367421..1367687) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800943|ref|YP_207655.1|; PP_01635 8e-45 Click
7complement(1367699..1368028) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800942|ref|YP_207654.1|; PP_01636 3e-54 Click
8complement(1368089..1368862) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800941|ref|YP_207653.1|; PP_01637 6e-144 Click
9complement(1368888..1369316) phage associated protein [Neisseria gonorrhoeae FA 1090] gi|59800940|ref|YP_207652.1|; PP_01638 4e-78 Click
10complement(1369313..1369795) hypothetical protein NMAA_1620 [Neisseria meningitidis WUE 2594] gi|385338742|ref|YP_005892615.1|; PP_01639 1e-72 Click
11complement(1369795..1370325) PHAGE_Strept_phiSASD1: gp29; PP_01640; phage(gi298103494) 1e-06 Click
12complement(1370328..1370690) PHAGE_Saimir_2: unnamed protein product; PP_01641; phage(gi9626029) 4e-05 Click
13complement(1370697..1372196) PHAGE_Thermo_THSA_485A: hypothetical protein; PP_01642; phage(gi397912636) 1e-32 Click
14complement(1372237..1373394) PHAGE_Thermo_THSA_485A: hypothetical protein; PP_01643; phage(gi397912637) 1e-21 Click
15complement(1373462..1375609) PHAGE_Thermo_THSA_485A: hypothetical protein; PP_01644; phage(gi397912638) 1e-53 Click
16complement(1375606..1377027) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_01645; phage(gi423262000) 3e-156 Click
17complement(1377089..1377538) PHAGE_Entero_Sf6: gene 1 protein; PP_01646; phage(gi41057279) 1e-29 Click
18complement(1377831..1378658) PHAGE_Salmon_vB_SemP_Emek: antirepressor; PP_01647; phage(gi399498814) 6e-34 Click