Streptomyces roseosporus NRRL 11379 .1, whole genome shotgun [asmbl_id: NC_000000].7763119, GC%: 71.42%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 66 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12223781..2223824 attL    CTTCTAAGCGCTTGGCCGCAGGTTCGAGTCCTGCCGGGGGCGCA 0.0 Click
22223852..2224910 PHAGE_Thermu_26: phage XerD-like integrase; PP_02085; phage(gi157265417) 2e-12 Click
3complement(2224941..2225078) hypothetical; PP_02086 0.0 Click
4complement(2225311..2225616) hypothetical; PP_02087 0.0 Click
5complement(2225907..2226194) hypothetical; PP_02094 0.0 Click
62226228..2226533 PHAGE_Mycoba_Porky: gp52; PP_02088; phage(gi194303348) 9e-08 Click
72226661..2227068 hypothetical; PP_02089 0.0 Click
82227065..2227445 hypothetical; PP_02090 0.0 Click
92227438..2227845 hypothetical; PP_02091 0.0 Click
102227842..2228591 PHAGE_Strept_VWB: hypothetical protein VWBp05; PP_02092; phage(gi41057221) 4e-19 Click
112228588..2228908 hypothetical; PP_02093 0.0 Click
122228905..2229738 PHAGE_Strept_VWB: hypothetical protein VWBp08; PP_02095; phage(gi41057224) 1e-103 Click
132229740..2230804 PHAGE_Strept_VWB: hypothetical protein VWBp09; PP_02096; phage(gi41057225) 3e-126 Click
142230902..2231351 PHAGE_Strept_VWB: hypothetical protein VWBp11; PP_02097; phage(gi41057227) 3e-23 Click
152231348..2231599 hypothetical; PP_02098 0.0 Click
162231596..2232213 PHAGE_Strept_VWB: hypothetical protein VWBp12; PP_02099; phage(gi41057228) 1e-73 Click
172232210..2233076 PHAGE_Pseudo_F116: DNA adenine methyltransferase; PP_02100; phage(gi56692911) 3e-46 Click
182233073..2233258 hypothetical; PP_02101 0.0 Click
192233258..2233530 hypothetical; PP_02102 0.0 Click
202233527..2233982 PHAGE_Strept_VWB: hypothetical protein VWBp14; PP_02103; phage(gi41057230) 8e-44 Click
212234128..2235066 PHAGE_Strept_VWB: hypothetical protein VWBp15; PP_02104; phage(gi41057231) 1e-60 Click
222235063..2235554 PHAGE_Strept_SV1: hypothetical protein; PP_02105; phage(gi410491759) 5e-08 Click
232235551..2236324 PHAGE_Caulob_CcrKarma: DUF1643 protein; PP_02106; phage(gi414089384) 1e-22 Click
242236321..2236494 hypothetical; PP_02107 0.0 Click
252236491..2237093 hypothetical; PP_02108 0.0 Click
262237114..2237554 hypothetical protein nfa15010 [Nocardia farcinica IFM 10152] gi|54023468|ref|YP_117710.1|; PP_02109 5e-08 Click
272237642..2238574 PHAGE_Strept_VWB: hypothetical protein VWBp19; PP_02110; phage(gi41057235) 8e-73 Click
28complement(2238577..2238777) PHAGE_Strept_VWB: hypothetical protein VWBp20; PP_02111; phage(gi41057236) 7e-11 Click
29complement(2238896..2239111) hypothetical protein O3I_033440 [Nocardia brasiliensis ATCC 700358] gi|407647852|ref|YP_006811611.1|; PP_02112 4e-18 Click
302239278..2239514 hypothetical; PP_02113 0.0 Click
312239694..2240041 hypothetical; PP_02114 0.0 Click
322240041..2240214 hypothetical; PP_02115 0.0 Click
332240280..2241470 PHAGE_Strept_VWB: hypothetical protein VWBp24; PP_02116; phage(gi41057240) 1e-111 Click
342241923..2242336 hypothetical; PP_02117 0.0 Click
352242348..2242806 alkyl hydroperoxide reductase [Achromobacter xylosoxidans A8] gi|311106226|ref|YP_003979079.1|; PP_02118 4e-05 Click
362242803..2243468 PHAGE_Strept_VWB: hypothetical protein VWBp26; PP_02119; phage(gi41057242) 2e-09 Click
372243698..2243817 hypothetical; PP_02120 0.0 Click
382244420..2244800 hypothetical; PP_02121 0.0 Click
392244883..2245149 PHAGE_Strept_VWB: hypothetical protein VWBp29; PP_02122; phage(gi41057245) 1e-10 Click
402245146..2245448 PHAGE_Strept_phiHau3: putative HNH endonuclease; PP_02123; phage(gi410490959) 4e-17 Click
412245736..2246323 PHAGE_Strept_VWB: hypothetical protein VWBp30; PP_02124; phage(gi41057246) 2e-80 Click
422246372..2247169 PHAGE_Strept_VWB: hypothetical protein VWBp31; PP_02125; phage(gi41057247) 2e-24 Click
432247169..2247657 PHAGE_Strept_VWB: hypothetical protein VWBp32; PP_02126; phage(gi41057248) 9e-79 Click
442247667..2249343 PHAGE_Strept_VWB: hypothetical protein VWBp33; PP_02127; phage(gi41057249) 0.0 Click
452249371..2250807 PHAGE_Strept_VWB: hypothetical protein VWBp34; PP_02128; phage(gi41057250) 0.0 Click
462250800..2251603 PHAGE_Strept_VWB: ORF1; PP_02129; phage(gi41057251) 4e-122 Click
47complement(2251622..2252065) hypothetical; PP_02130 0.0 Click
482252154..2252870 PHAGE_Strept_VWB: ORF2; PP_02131; phage(gi41057252) 2e-48 Click
492252892..2253281 PHAGE_Strept_VWB: ORFp14; PP_02132; phage(gi41057253) 4e-58 Click
502253297..2254343 PHAGE_Strept_VWB: ORFp38; PP_02133; phage(gi41057254) 2e-165 Click
512254364..2254669 hypothetical; PP_02134 0.0 Click
522254675..2255091 PHAGE_Strept_VWB: ORF3; PP_02135; phage(gi41057255) 5e-47 Click
532255088..2255441 PHAGE_Strept_VWB: ORF4; PP_02136; phage(gi41057256) 5e-52 Click
542255452..2255697 PHAGE_Strept_VWB: ORF5; PP_02137; phage(gi41057257) 8e-15 Click
552255697..2256098 PHAGE_Strept_VWB: ORF6; PP_02138; phage(gi41057258) 4e-31 Click
562256172..2256822 PHAGE_Gordon_GTE5: main tail protein; PP_02139; phage(gi359802292) 2e-17 Click
572256924..2257247 hypothetical protein SCAB_65001 [Streptomyces scabiei 87.22] gi|290960861|ref|YP_003492043.1|; PP_02140 7e-18 Click
582257292..2257717 hypothetical protein SCAB_65011 [Streptomyces scabiei 87.22] gi|290960862|ref|YP_003492044.1|; PP_02141 4e-25 Click
592257723..2261271 PHAGE_Strept_VWB: ORF9; PP_02142; phage(gi41057276) 0.0 Click
602261271..2262266 PHAGE_Strept_R4: hypothetical protein; PP_02143; phage(gi414090003) 4e-07 Click
612262269..2263426 PHAGE_Strept_R4: hypothetical protein; PP_02144; phage(gi414090004) 3e-25 Click
622263431..2264375 PHAGE_Strept_R4: hypothetical protein; PP_02145; phage(gi414090008) 3e-15 Click
632264375..2266177 PHAGE_Salmon_PhiSH19: tail spike protein 2; PP_02146; phage(gi422937915) 4e-06 Click
642266251..2266514 hypothetical; PP_02147 0.0 Click
652266511..2267443 PHAGE_Strept_SV1: putative endolysin; PP_02148; phage(gi410491741) 4e-24 Click
662267500..2267820 hypothetical protein SCAB_65091 [Streptomyces scabiei 87.22] gi|290960870|ref|YP_003492052.1|; PP_02149 2e-15 Click
672267817..2268260 PHAGE_Strept_VWB: hypothetical protein VWBp53; PP_02150; phage(gi41057267) 2e-12 Click
682272178..2272221 attR    CTTCTAAGCGCTTGGCCGCAGGTTCGAGTCCTGCCGGGGGCGCA 0.0 Click