Acinetobacter baumannii AB900 , whole genome shotgun [asmbl_id: NC_000000].3910877, GC%: 38.92%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 59 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11840635..1840646 attL    TTTATTGCGTTT 0.0 Click
2complement(1853043..1854080) PHAGE_Acinet_Bphi_B1251: tail tape measure protein; PP_01725; phage(gi423262023) 1e-135 Click
3complement(1854452..1854973) hypothetical protein Dole_2949 [Desulfococcus oleovorans Hxd3] gi|158522959|ref|YP_001530829.1|; PP_01726 3e-17 Click
4complement(1855060..1855296) hypothetical protein M3Q_1173 [Acinetobacter baumannii TYTH-1] gi|407931853|ref|YP_006847496.1|; PP_01727 7e-20 Click
51855505..1856374 PHAGE_Escher_TL_2011c: hypothetical protein; PP_01728; phage(gi418487090) 4e-32 Click
6complement(1856542..1856946) PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_01729; phage(gi399498807) 3e-22 Click
7complement(1856961..1857410) PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_01730; phage(gi399498806) 2e-36 Click
8complement(1857921..1858445) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_01731; phage(gi423262018) 2e-46 Click
9complement(1858493..1859434) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_01732; phage(gi423262017) 7e-101 Click
10complement(1859509..1860045) PHAGE_Escher_P13374: regulatory protein; PP_01733; phage(gi410491650) 7e-28 Click
11complement(1860206..1860601) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_01734; phage(gi423262013) 2e-37 Click
12complement(1860603..1861058) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_01735; phage(gi423262012) 3e-16 Click
13complement(1861063..1861455) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_01736; phage(gi423262010) 9e-26 Click
14complement(1861459..1861845) hypothetical protein PFLU2875 [Pseudomonas fluorescens SBW25] gi|229590335|ref|YP_002872454.1|; PP_01737 3e-24 Click
15complement(1861902..1862087) hypothetical; PP_01738 0.0 Click
16complement(1862099..1863115) PHAGE_Salmon_vB_SenS_Ent1: putative major coat protein; PP_01739; phage(gi423261856) 4e-50 Click
17complement(1863133..1863858) PHAGE_Cronob_phiES15: hypothetical protein; PP_01740; phage(gi401817595) 3e-40 Click
18complement(1864080..1865165) PHAGE_Acinet_Bphi_B1251: phage putative head morphogenesis protein; PP_01741; phage(gi423262002) 3e-97 Click
19complement(1865182..1866588) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_01742; phage(gi423262001) 5e-78 Click
20complement(1866588..1867871) PHAGE_Pseudo_H105/1: phage terminase large subunit; PP_01743; phage(gi327198525) 1e-108 Click
21complement(1867831..1868235) PHAGE_Acinet_AP22: putative phage terminase small subunit; PP_01744; phage(gi388570782) 3e-26 Click
22complement(1868382..1868570) hypothetical; PP_01745 0.0 Click
23complement(1868627..1869109) PHAGE_Psychr_pOW20_A: hypothetical protein; PP_01746; phage(gi472339815) 4e-21 Click
24complement(1869144..1869329) hypothetical; PP_01747 0.0 Click
25complement(1869761..1870006) hypothetical; PP_01748 0.0 Click
261869959..1870102 hypothetical; PP_01749 0.0 Click
27complement(1870053..1870129) tRNA 0.0 Click
28complement(1870520..1871035) hypothetical protein ACIAD2184 [Acinetobacter sp. ADP1] gi|50085295|ref|YP_046805.1|; PP_01750 1e-30 Click
29complement(1871045..1871338) hypothetical; PP_01751 0.0 Click
30complement(1871338..1871790) PHAGE_Marino_P12026: hypothetical protein; PP_01752; phage(gi399528341) 4e-13 Click
31complement(1871802..1872170) hypothetical; PP_01753 0.0 Click
32complement(1872167..1872637) hypothetical protein M3Q_1420 [Acinetobacter baumannii TYTH-1] gi|407932100|ref|YP_006847743.1|; PP_01754 2e-17 Click
33complement(1872639..1873022) hypothetical; PP_01755 0.0 Click
34complement(1873015..1873275) hypothetical; PP_01756 0.0 Click
35complement(1873275..1873637) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_01757; phage(gi423261991) 6e-06 Click
36complement(1873807..1874058) hypothetical; PP_01758 0.0 Click
37complement(1874055..1875371) PHAGE_Acinet_AP22: putative replicative DNA helicase; PP_01759; phage(gi388570844) 1e-61 Click
38complement(1875371..1876063) PHAGE_Vibrio_VvAW1: hypothetical protein; PP_01760; phage(gi460042921) 8e-15 Click
39complement(1876162..1876320) hypothetical; PP_01761 0.0 Click
40complement(1876362..1876736) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_01762; phage(gi423261985) 1e-28 Click
41complement(1876747..1876995) PHAGE_Entero_c_1: prophage antirepressor; PP_01763; phage(gi428781783) 2e-07 Click
421877112..1877810 PHAGE_Entero_cdtI: Repressor; PP_01764; phage(gi148609423) 1e-14 Click
431878319..1878486 hypothetical; PP_01765 0.0 Click
441878616..1880952 PHAGE_Acinet_Bphi_B1251: putative restriction-modification protein; PP_01766; phage(gi423261981) 0.0 Click
451881069..1881446 PHAGE_Acinet_AP22: hypothetical protein; PP_01767; phage(gi388570833) 2e-14 Click
461881466..1881732 hypothetical; PP_01768 0.0 Click
471881732..1881959 PHAGE_Acinet_AP22: hypothetical protein; PP_01769; phage(gi388570838) 8e-23 Click
481881969..1882826 PHAGE_Entero_HK630: Bet protein; PP_01770; phage(gi428782823) 1e-58 Click
491882807..1883415 PHAGE_Tetras_TJE1: putative exonuclease; PP_01771; phage(gi431810888) 1e-23 Click
501883666..1884034 PHAGE_Burkho_Bcep22: Bcep22gp02; PP_01772; phage(gi38640311) 3e-09 Click
511884039..1884470 hypothetical protein M3Q_1114 [Acinetobacter baumannii TYTH-1] gi|407931794|ref|YP_006847437.1|; PP_01773 3e-37 Click
521884467..1884676 PHAGE_Acinet_AP22: hypothetical protein; PP_01774; phage(gi388570775) 7e-31 Click
531884673..1884885 hypothetical; PP_01775 0.0 Click
541884882..1885199 PHAGE_Xantho_CP2: hypothetical protein; PP_01776; phage(gi448245209) 9e-24 Click
551885201..1885470 hypothetical protein [Acinetobacter baumannii MDR-ZJ06] gi|384143892|ref|YP_005526602.1|; PP_01777 1e-44 Click
561885475..1886134 PHAGE_Acinet_AP22: putative DNA-binding protein; PP_01778; phage(gi388570841) 2e-28 Click
571886131..1886400 hypothetical; PP_01779 0.0 Click
58complement(1886397..1887383) PHAGE_Mannhe_phiMHaA1: integrase; PP_01780; phage(gi109289985) 2e-57 Click
591887681..1888616 PHAGE_Amsact_: putative ATP-binding cassette transporter; PP_01781; phage(gi9964444) 6e-18 Click
601888613..1889386 multidrug ABC transporter permease [Acinetobacter baumannii TYTH-1] gi|407933455|ref|YP_006849098.1|; PP_01782 1e-143 Click
611889383..1890195 PHAGE_Vibrio_KVP40: GTP cyclohydrolase I family protein; PP_01783; phage(gi34419358) 2e-39 Click
621894313..1894324 attR    TTTATTGCGTTT 0.0 Click

Region 2, total : 83 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2085209..2085994) PHAGE_Tricho_2c: hypothetical protein TNAV2c_gp071; PP_01953; phage(gi116326757) 4e-13 Click
2complement(2086007..2087257) putative carboxymethylenebutenolidase(Dienelactonehydrolase) (DLH) [Acinetobacter oleivorans DR1] gi|299770238|ref|YP_003732264.1|; PP_01954 0.0 Click
32087586..2088929 PHAGE_Burkho_phi1026b: gp59; PP_01955; phage(gi38707949) 2e-08 Click
42089460..2090098 PHAGE_Salmon_SSU5: putative ParB-like nuclease domain-containing protein; PP_01956; phage(gi410491535) 4e-35 Click
52090127..2090729 PHAGE_Bacill_SPP1: hypothetical protein SPP1p009; PP_01957; phage(gi22855054) 9e-06 Click
62090726..2091376 PHAGE_Salmon_SSU5: putative ParB-like nuclease domain-containing protein; PP_01958; phage(gi410491536) 7e-34 Click
72091376..2092032 PHAGE_Salmon_SSU5: putative ABC transporter ATP-binding protein; PP_01959; phage(gi410491537) 3e-60 Click
82092029..2092451 trxC [Mycobacterium tuberculosis UT205] gi|392388507|ref|YP_005310136.1|; PP_01960 1e-05 Click
92092490..2093443 PHAGE_Salmon_SSU5: putative ABC transporter ATP-binding protein; PP_01961; phage(gi410491539) 1e-46 Click
102093825..2094220 PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_01962; phage(gi423262011) 5e-06 Click
112094332..2094733 hypothetical; PP_01963 0.0 Click
122094738..2094761 attL    AATTATTAATAAGCGCTTATTATT 0.0 Click
132094886..2095491 PHAGE_Salmon_SSU5: putative DNA-binding protein; PP_01964; phage(gi410491411) 8e-24 Click
142095699..2096745 PHAGE_Salmon_SSU5: putative terminase large subunit; PP_01965; phage(gi410491412) 2e-129 Click
152096791..2098461 PHAGE_Salmon_SSU5: hypothetical protein; PP_01966; phage(gi410491413) 3e-149 Click
162098505..2099383 PHAGE_Salmon_SSU5: hypothetical protein; PP_01967; phage(gi410491414) 1e-48 Click
172099519..2100421 PHAGE_Salmon_SSU5: putative major capsid protein; PP_01968; phage(gi410491415) 2e-90 Click
182100560..2101054 PHAGE_Salmon_SSU5: hypothetical protein; PP_01969; phage(gi410491417) 2e-08 Click
192101061..2101831 PHAGE_Salmon_SSU5: hypothetical protein; PP_01970; phage(gi410491418) 8e-11 Click
202101905..2102528 hypothetical; PP_01971 0.0 Click
212102623..2102865 PHAGE_Salmon_SSU5: hypothetical protein; PP_01972; phage(gi410491419) 5e-09 Click
222102862..2103248 PHAGE_Salmon_SSU5: hypothetical protein; PP_01973; phage(gi410491421) 6e-15 Click
232103248..2103745 hypothetical; PP_01974 0.0 Click
242103830..2104375 PHAGE_Salmon_SSU5: putative Ig-like domain-containing protein; PP_01975; phage(gi410491422) 2e-35 Click
252104470..2104823 hypothetical; PP_01976 0.0 Click
262104829..2105176 hypothetical; PP_01977 0.0 Click
272105179..2110767 PHAGE_Entero_mEp390: tail length tape measure protein; PP_01978; phage(gi428782677) 2e-22 Click
282110864..2111166 PHAGE_Salmon_SSU5: putative minor tail protein M; PP_01979; phage(gi410491426) 2e-11 Click
292111166..2111861 PHAGE_Salmon_SSU5: putative minor tail protein L; PP_01980; phage(gi410491427) 1e-59 Click
302111858..2112607 PHAGE_Salmon_SSU5: putative phage tail protein; PP_01981; phage(gi410491428) 3e-47 Click
312112601..2113179 PHAGE_Salmon_SSU5: putative phage tail protein; PP_01982; phage(gi410491429) 2e-27 Click
322113203..2124386 PHAGE_Salmon_SSU5: putative phage tail protein; PP_01983; phage(gi410491430) 5e-167 Click
332124715..2125449 hypothetical; PP_01984 0.0 Click
342125459..2125710 hypothetical; PP_01985 0.0 Click
35complement(2125843..2126046) hypothetical; PP_01986 0.0 Click
362126170..2126562 PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_01987; phage(gi423262030) 2e-43 Click
372126562..2127200 PHAGE_Acinet_ZZ1: putative ysozyme; PP_01988; phage(gi392973021) 5e-42 Click
382127197..2127313 hypothetical; PP_01989 0.0 Click
392128204..2129325 PHAGE_Burkho_KS14: gp37; PP_01990; phage(gi327198306) 4e-18 Click
402129442..2130173 PHAGE_Salmon_SSU5: hypothetical protein; PP_01991; phage(gi410491448) 4e-09 Click
412130261..2130692 hypothetical; PP_01992 0.0 Click
422130729..2132132 PHAGE_Salmon_SSU5: putative DNA helicase; PP_01993; phage(gi410491449) 3e-82 Click
432132220..2133314 PHAGE_Salmon_SSU5: putative DNA primase; PP_01994; phage(gi410491450) 6e-68 Click
442133378..2133932 hypothetical; PP_01995 0.0 Click
452133971..2134423 hypothetical; PP_01996 0.0 Click
462134417..2135025 hypothetical; PP_01997 0.0 Click
472135022..2135531 hypothetical; PP_01998 0.0 Click
482135544..2137247 PHAGE_Deftia_14: gp30 DNA ligase; PP_01999; phage(gi282599138) 6e-54 Click
492137287..2137859 PHAGE_Abalon_Victoria/AUS/2009: putative guanylate kinase; PP_02000; phage(gi410493565) 4e-11 Click
502137932..2138552 hypothetical; PP_02001 0.0 Click
51complement(2138540..2138968) hypothetical; PP_02002 0.0 Click
52complement(2138965..2139642) PHAGE_Salmon_SSU5: putative ParA family protein; PP_02003; phage(gi410491443) 3e-14 Click
532139845..2140252 hypothetical; PP_02004 0.0 Click
54complement(2140257..2140841) PHAGE_Clostr_phiMMP04: integrase; PP_02005; phage(gi414090489) 2e-08 Click
552141040..2141183 hypothetical; PP_02006 0.0 Click
56complement(2141180..2141599) hypothetical protein YPN_MT0064 [Yersinia pestis Nepal516] gi|108793796|ref|YP_636637.1|; PP_02007 8e-06 Click
572142021..2142215 hypothetical; PP_02008 0.0 Click
582142456..2144378 PHAGE_Salmon_SSU5: putative porphyrin biosynthetic protein; PP_02009; phage(gi410491459) 3e-44 Click
592144523..2145767 PHAGE_Salmon_SSU5: putative porphyrin biosynthetic protein; PP_02010; phage(gi410491460) 1e-81 Click
602145792..2146457 hypothetical; PP_02011 0.0 Click
612146508..2147053 hypothetical; PP_02012 0.0 Click
622147070..2147189 hypothetical; PP_02013 0.0 Click
632147235..2149592 PHAGE_Salmon_SSU5: DNA polymerase III alpha subunit; PP_02014; phage(gi410491462) 3e-165 Click
642149641..2150216 PHAGE_Mycoba_Ramsey: gp33; PP_02015; phage(gi206600214) 5e-27 Click
652150213..2151478 PHAGE_Salmon_SSU5: DNA polymerase III alpha subunit; PP_02016; phage(gi410491462) 2e-52 Click
662151568..2152656 PHAGE_Salmon_SSU5: hypothetical protein; PP_02017; phage(gi410491466) 7e-10 Click
672152799..2153659 PHAGE_Salmon_SSU5: hypothetical protein; PP_02018; phage(gi410491467) 1e-13 Click
682153722..2154759 PHAGE_Salmon_SSU5: DNA polymerase I; PP_02019; phage(gi410491468) 3e-51 Click
692154756..2156960 PHAGE_Salmon_SSU5: putative RecA-like recombinase; PP_02020; phage(gi410491470) 4e-54 Click
702157048..2157407 PHAGE_Salmon_SSU5: hypothetical protein; PP_02021; phage(gi410491480) 2e-07 Click
712157404..2157865 hypothetical; PP_02022 0.0 Click
722158553..2158576 attR    AATTATTAATAAGCGCTTATTATT 0.0 Click
732158705..2159703 PHAGE_Salmon_SSU5: putative exonuclease subunit 1; PP_02023; phage(gi410491483) 3e-37 Click
742159703..2161643 PHAGE_Salmon_SSU5: putative exonuclease subunit 2; PP_02024; phage(gi410491485) 2e-118 Click
752161736..2162572 hypothetical; PP_02025 0.0 Click
762162704..2163306 PHAGE_Salmon_SSU5: putative ribonuclease H-like domain-containing protein; PP_02026; phage(gi410491487) 3e-34 Click
772163380..2163760 hypothetical; PP_02027 0.0 Click
782163782..2166154 PHAGE_Microm_MpV1: hypothetical protein; PP_02028; phage(gi313768342) 6e-119 Click
792166312..2167241 PHAGE_Microc_LMM01: ribonucleoside-diphosphate reductase beta subunit; PP_02029; phage(gi117530173) 1e-37 Click
802167254..2168165 PHAGE_Entero_N4: gp30; PP_02030; phage(gi119952207) 2e-58 Click
812168169..2168453 hypothetical; PP_02031 0.0 Click
822168453..2168680 hypothetical; PP_02032 0.0 Click
832168711..2168968 PHAGE_Xantho_phiL7: P20; PP_02033; phage(gi238695607) 4e-06 Click
842168961..2169326 PHAGE_Synech_S_CAM1: MazG; PP_02034; phage(gi472339534) 6e-14 Click
85complement(2169518..2170222) PROPHAGE_Brucel_1330: transposase, putative; PP_02035; phage(gi23502708) 5e-41 Click

Region 3, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12854184..2854197 attL    TAAAACAAAACCCC 0.0 Click
22854310..2855662 PHAGE_Pseudo_vB_PaeS_PMG1: integrase; PP_02695; phage(gi374531680) 5e-05 Click
32855963..2856352 hypothetical protein NMA1838 [Neisseria meningitidis Z2491] gi|218768611|ref|YP_002343123.1|; PP_02696 5e-27 Click
42856336..2856815 hypothetical protein NMA1837 [Neisseria meningitidis Z2491] gi|218768610|ref|YP_002343122.1|; PP_02697 1e-26 Click
52857019..2857132 hypothetical; PP_02698 0.0 Click
6complement(2857838..2858863) PHAGE_Synech_PM2: virion structural protein; PP_02699; phage(gi58532987) 4e-06 Click
7complement(2858854..2861244) outer membrane usher protein [Acinetobacter oleivorans DR1] gi|299769584|ref|YP_003731610.1|; PP_02700 0.0 Click
8complement(2861317..2862024) fimbrial chaperone protein [Acinetobacter calcoaceticus PHEA-2] gi|375135130|ref|YP_004995780.1|; PP_02701 1e-107 Click
9complement(2862108..2862638) protein U [Acinetobacter oleivorans DR1] gi|299769648|ref|YP_003731674.1|; PP_02702 8e-86 Click
10complement(2863312..2863857) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_02703; phage(gi423262031) 1e-88 Click
11complement(2863900..2864289) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_02704; phage(gi423262030) 1e-69 Click
12complement(2864355..2864915) hypothetical protein Emin_0939 [Elusimicrobium minutum Pei191] gi|187251347|ref|YP_001875829.1|; PP_02705 2e-13 Click
13complement(2864912..2869312) PHAGE_Burkho_KS9: tail tip fiber protein gp19; PP_02706; phage(gi255033750) 0.0 Click
14complement(2869369..2870037) PHAGE_Cronob_ENT39118: tail assembly protein; PP_02707; phage(gi431811064) 2e-38 Click
15complement(2870021..2870776) PHAGE_Burkho_phiE125: putative tail component protein; PP_02708; phage(gi17975180) 2e-42 Click
16complement(2870783..2871589) PHAGE_Entero_HK140: minor tail protein L; PP_02709; phage(gi428781956) 2e-53 Click
17complement(2871576..2872409) PHAGE_Acinet_Bphi_B1251: putative tail fiber; PP_02710; phage(gi423262016) 9e-44 Click
18complement(2872462..2872806) PHAGE_Escher_HK75: minor tail protein; PP_02711; phage(gi356870692) 2e-13 Click
19complement(2872793..2873113) hypothetical; PP_02712 0.0 Click
20complement(2873168..2873494) hypothetical; PP_02713 0.0 Click
212873507..2873520 attR    TAAAACAAAACCCC 0.0 Click
22complement(2873912..2876779) PHAGE_Acinet_Bphi_B1251: tail tape measure protein; PP_02714; phage(gi423262023) 0.0 Click

Region 4, total : 39 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3687613..3687960) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03477; phage(gi423262010) 4e-50 Click
2complement(3687960..3688340) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03478; phage(gi423262009) 8e-17 Click
3complement(3688344..3688679) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03479; phage(gi423262008) 5e-13 Click
4complement(3688724..3689674) PHAGE_Entero_phiFL3A: coat protein; PP_03480; phage(gi281416261) 3e-100 Click
5complement(3689688..3690479) PHAGE_Xantho_Xp15: putative phage structural protein; PP_03481; phage(gi66392059) 6e-20 Click
6complement(3690546..3690668) hypothetical; PP_03482 0.0 Click
7complement(3690665..3691771) PHAGE_Acinet_Bphi_B1251: phage putative head morphogenesis protein; PP_03483; phage(gi423262002) 8e-174 Click
8complement(3691781..3693121) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03484; phage(gi423262001) 2e-40 Click
9complement(3693161..3694402) PHAGE_Pseudo_H105/1: phage terminase large subunit; PP_03485; phage(gi327198525) 8e-103 Click
10complement(3694413..3694934) PHAGE_Acinet_Bphi_B1251: phage protein; PP_03486; phage(gi423261999) 2e-31 Click
11complement(3694993..3695634) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03487; phage(gi423261998) 7e-124 Click
12complement(3695603..3696070) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03488; phage(gi423261997) 6e-40 Click
13complement(3696131..3696586) hypothetical protein [Acinetobacter baumannii MDR-ZJ06] gi|384143614|ref|YP_005526324.1|; PP_03489 1e-82 Click
14complement(3697247..3697483) hypothetical protein [Acinetobacter baumannii MDR-ZJ06] gi|384143615|ref|YP_005526325.1|; PP_03490 2e-36 Click
15complement(3697692..3698036) hypothetical protein ABTJ_02746 [Acinetobacter baumannii MDR-TJ] gi|387124750|ref|YP_006290632.1|; PP_03491 3e-58 Click
16complement(3698303..3698521) hypothetical protein [Acinetobacter baumannii MDR-ZJ06] gi|384143617|ref|YP_005526327.1|; PP_03492 2e-33 Click
17complement(3699007..3699261) hypothetical protein M3Q_1359 [Acinetobacter baumannii TYTH-1] gi|407932039|ref|YP_006847682.1|; PP_03493 8e-40 Click
18complement(3699233..3699709) hypothetical protein M3Q_1358 [Acinetobacter baumannii TYTH-1] gi|407932038|ref|YP_006847681.1|; PP_03494 8e-86 Click
19complement(3699706..3700107) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03495; phage(gi423261993) 5e-46 Click
20complement(3700107..3700373) PHAGE_Acinet_AP22: hypothetical protein; PP_03496; phage(gi388570793) 2e-07 Click
21complement(3700366..3700764) PHAGE_Entero_Phi1: hypothetical protein phi1p212; PP_03497; phage(gi157311513) 1e-27 Click
22complement(3700761..3701168) PHAGE_Burkho_Bcep22: Bcep22gp02; PP_03498; phage(gi38640311) 8e-07 Click
23complement(3701165..3701965) hypothetical protein [Acinetobacter baumannii 1656-2] gi|384131480|ref|YP_005514092.1|; PP_03499 3e-149 Click
24complement(3701968..3702849) PHAGE_Cronob_phiES15: putative replication protein O; PP_03500; phage(gi401817576) 3e-12 Click
25complement(3702842..3703141) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03501; phage(gi423261987) 3e-25 Click
26complement(3703138..3703413) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03502; phage(gi423261986) 1e-36 Click
27complement(3703469..3703768) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03503; phage(gi423261985) 7e-50 Click
28complement(3703835..3704020) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03504; phage(gi423261984) 7e-29 Click
293704116..3704862 PHAGE_Acinet_Bphi_B1251: putative repressor protein; PP_03505; phage(gi423261983) 2e-142 Click
303704877..3705092 PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03506; phage(gi423261982) 3e-32 Click
313705143..3705661 hypothetical protein [Desulfovibrio africanus str. Walvis Bay] gi|374300951|ref|YP_005052590.1|; PP_03507 1e-06 Click
32complement(3705658..3705852) hypothetical; PP_03508 0.0 Click
333706095..3706490 hypothetical protein [Acinetobacter baumannii MDR-ZJ06] gi|384143635|ref|YP_005526345.1|; PP_03509 2e-67 Click
343706493..3706816 PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03510; phage(gi423262041) 1e-54 Click
353706828..3707595 PHAGE_Azospi_Cd: hypothetical protein APCd_gp85; PP_03511; phage(gi168495188) 3e-14 Click
363707610..3708647 PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03512; phage(gi423262039) 2e-88 Click
373708647..3708946 hypothetical protein [Acinetobacter baumannii 1656-2] gi|384131465|ref|YP_005514077.1|; PP_03513 6e-30 Click
383708943..3709125 hypothetical; PP_03514 0.0 Click
393709126..3709389 PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03515; phage(gi423262035) 3e-07 Click

Region 5, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3856732..3857709) PHAGE_Acinet_Bphi_B1251: tail tape measure protein; PP_03674; phage(gi423262023) 5e-136 Click
2complement(3857768..3858151) PHAGE_Acinet_Bphi_B1251: putative lipoprotein; PP_03675; phage(gi423262022) 6e-14 Click
3complement(3858181..3858714) lipoprotein [Methylococcus capsulatus str. Bath] gi|53802478|ref|YP_112888.1|; PP_03676 1e-19 Click
4complement(3858748..3859071) PHAGE_Clostr_st: hypothetical protein CST198; PP_03677; phage(gi80159884) 4e-11 Click
5complement(3859355..3859759) PHAGE_Haemop_HP2: hypothetical protein HP2p14; PP_03678; phage(gi17981828) 2e-30 Click
6complement(3859824..3859982) PHAGE_Haemop_HP2: hypothetical protein HP2p13; PP_03679; phage(gi19289355) 1e-14 Click
7complement(3860075..3860224) hypothetical protein [Acinetobacter baumannii MDR-ZJ06] gi|384142449|ref|YP_005525159.1|; PP_03680 8e-08 Click
8complement(3860338..3860871) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03681; phage(gi423262018) 6e-48 Click
9complement(3860916..3861845) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03682; phage(gi423262017) 1e-37 Click
10complement(3861953..3862165) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03683; phage(gi423262014) 6e-23 Click
11complement(3862167..3862565) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03684; phage(gi423262013) 1e-58 Click
12complement(3862567..3862935) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03685; phage(gi423262012) 1e-48 Click
13complement(3862901..3863230) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03686; phage(gi423262011) 2e-48 Click
14complement(3863382..3864044) hypothetical; PP_03687 0.0 Click
153864145..3864705 beta-ketoadipyl CoA thiolase [Acinetobacter baumannii TYTH-1] gi|407932987|ref|YP_006848630.1|; PP_03688 9e-97 Click
163864716..3865495 PHAGE_Mycoba_D29: gp59.2; PP_03689; phage(gi9630445) 3e-07 Click

Region 6, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3903775..3904965) PHAGE_Cafete_BV_PW1: putative eIF-2gamma; PP_03722; phage(gi310831469) 7e-19 Click
2complement(3904958..3906124) NADP-dependent fatty aldehyde dehydrogenase [Acinetobacter baumannii AB307-0294] gi|215483357|ref|YP_002325568.1|; PP_03723 0.0 Click
33906140..3906514 3-oxoadipate CoA-transferase subunit B (beta-ketoadipate:succinyl-CoA transferase subunit B) [Acinetobacter calcoaceticus PHEA-2] gi|375134945|ref|YP_004995595.1|; PP_03724 1e-65 Click
43906527..3907003 beta-ketoadipyl CoA thiolase [Acinetobacter calcoaceticus PHEA-2] gi|375134987|ref|YP_004995637.1|; PP_03725 3e-70 Click
5complement(3907153..3907662) PROPHAGE_Escher_MG1655: IS150 transposase A; PP_03726; phage(gi16131428) 1e-17 Click
6complement(3907772..3908464) PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfB; PP_03727; phage(gi24373866) 1e-24 Click
7complement(3908510..3909115) PROPHAGE_Ralsto_GMI1000: isrso11-transposase orfb protein; PP_03728; phage(gi17546155) 9e-68 Click
8complement(3909132..3909809) PHAGE_Clostr_phiCD38_2: tail fiber protein; PP_03729; phage(gi333798127) 2e-05 Click
9complement(3909775..3910341) PHAGE_Cyprin_2: membrane protein ORF25D; PP_03730; phage(gi422933804) 9e-05 Click