Enterobacter cancerogenus ATCC 35316 .1, [asmbl_id: NC_000000].4633453, GC%: 55.87%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 32 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11353541..1353553 attL    TATTTTTTACTGA 0.0 Click
2complement(1367748..1367969) PHAGE_Yersin_413C: Ogr; ENTCAN_06383; phage(gi30065732) 2e-25 Click
3complement(1368046..1369215) PHAGE_Yersin_413C: gpD; ENTCAN_06384; phage(gi30065731) 4e-157 Click
4complement(1369212..1369676) PHAGE_Yersin_413C: gpU; ENTCAN_06385; phage(gi30065730) 7e-51 Click
5complement(1369690..1372137) PHAGE_Yersin_413C: gpT; ENTCAN_06386; phage(gi30065729) 0.0 Click
6complement(1372127..1372249) PHAGE_Yersin_413C: gpE+E'; ENTCAN_06387; phage(gi30065728) 7e-13 Click
7complement(1372282..1372575) PHAGE_Yersin_413C: gpE; ENTCAN_06388; phage(gi30065727) 2e-29 Click
8complement(1372632..1373150) PHAGE_Yersin_413C: FII; ENTCAN_06389; phage(gi30065726) 1e-63 Click
9complement(1373163..1374389) PHAGE_Yersin_413C: gpFI; ENTCAN_06390; phage(gi30065725) 0.0 Click
10complement(1374479..1374925) PHAGE_Entero_SfV: tail fibre assembly protein; ENTCAN_06391; phage(gi19549010) 7e-27 Click
11complement(1374909..1377068) PHAGE_Yersin_413C: gpH; ENTCAN_06392; phage(gi30065722) 4e-89 Click
12complement(1377080..1377610) PHAGE_Yersin_413C: gpI; ENTCAN_06393; phage(gi30065721) 3e-88 Click
13complement(1377603..1378511) PHAGE_Yersin_413C: gpJ; ENTCAN_06394; phage(gi30065720) 1e-136 Click
14complement(1378517..1378867) PHAGE_Yersin_413C: gpW; ENTCAN_06395; phage(gi30065719) 7e-35 Click
15complement(1378864..1379505) PHAGE_Yersin_413C: gpV; ENTCAN_06396; phage(gi30065718) 1e-84 Click
16complement(1379691..1380407) hypothetical protein; ENTCAN_06397 0.0 Click
17complement(1380856..1381308) PHAGE_Yersin_413C: gpS; ENTCAN_06398; phage(gi30065717) 8e-33 Click
18complement(1381301..1381768) PHAGE_Yersin_413C: gpR; ENTCAN_06399; phage(gi30065716) 9e-55 Click
19complement(1381731..1381889) PHAGE_Erwini_ENT90: putative host lysis-related protein; ENTCAN_06400; phage(gi431810968) 7e-07 Click
20complement(1381864..1382289) PHAGE_Yersin_413C: LysB; ENTCAN_06401; phage(gi30065715) 2e-32 Click
21complement(1382286..1382768) PHAGE_Entero_2: endolysin; ENTCAN_06402; phage(gi169936041) 1e-52 Click
22complement(1382779..1383000) prophage Hp1 family Holin; ENTCAN_06403 0.0 Click
23complement(1382991..1383194) PHAGE_Yersin_413C: gpX; ENTCAN_06404; phage(gi30065711) 4e-26 Click
24complement(1383194..1383700) PHAGE_Yersin_413C: gpL; ENTCAN_06405; phage(gi30065710) 1e-63 Click
25complement(1383800..1384531) PHAGE_Yersin_413C: gpM; ENTCAN_06406; phage(gi30065709) 2e-77 Click
26complement(1384559..1385626) PHAGE_Yersin_413C: gpN; ENTCAN_06407; phage(gi30065708) 7e-158 Click
27complement(1385682..1386536) PHAGE_Yersin_413C: gpO; ENTCAN_06408; phage(gi30065707) 3e-112 Click
281386703..1388472 PHAGE_Yersin_413C: gpP; ENTCAN_06409; phage(gi30065706) 0.0 Click
291388474..1389499 PHAGE_Yersin_413C: gpQ; ENTCAN_06410; phage(gi30065705) 1e-159 Click
301389889..1391085 PHAGE_Marseillevirus: putative nuclease; ENTCAN_06411; phage(gi284504209) 2e-06 Click
311391088..1391741 conserved hypothetical protein; ENTCAN_06412 0.0 Click
32complement(1391756..1391881) hypothetical protein; ENTCAN_06413 0.0 Click
331391972..1392697 PHAGE_Yersin_413C: Int; ENTCAN_06414; phage(gi30065733) 2e-42 Click
341403535..1403547 attR    TATTTTTTACTGA 0.0 Click

Region 2, total : 69 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11631007..1631018 attL    CACCATCGAGCG 0.0 Click
2complement(1639661..1641529) PHAGE_Salmon_E1: maturation/adhesion protein; ENTCAN_06668; phage(gi170676316) 1e-35 Click
3complement(1641586..1644063) PHAGE_Salmon_E1: hypothetical protein VIP0038; ENTCAN_06669; phage(gi170676314) 0.0 Click
4complement(1644050..1644406) PHAGE_Salmon_E1: possible tail assembly protein; ENTCAN_06670; phage(gi170676313) 7e-23 Click
5complement(1644429..1644899) PHAGE_Salmon_E1: hypothetical protein VIP0036; ENTCAN_06671; phage(gi170676312) 7e-39 Click
6complement(1644899..1645396) PHAGE_Salmon_E1: hypothetical protein VIP0035; ENTCAN_06672; phage(gi170676311) 2e-55 Click
7complement(1645396..1647717) PHAGE_Salmon_E1: putative tail protein (tape measure); ENTCAN_06673; phage(gi170676309) 3e-134 Click
8complement(1647756..1648049) conserved hypothetical protein; ENTCAN_06674 0.0 Click
9complement(1648125..1648877) PHAGE_Salmon_E1: hypothetical protein VIP0032; ENTCAN_06675; phage(gi170676308) 3e-36 Click
10complement(1648916..1649671) PHAGE_Salmon_E1: major tail subunit; ENTCAN_06676; phage(gi170676305) 3e-37 Click
11complement(1649731..1650114) PHAGE_Salmon_E1: hypothetical protein VIP0027; ENTCAN_06677; phage(gi170676303) 6e-12 Click
12complement(1650111..1650479) PHAGE_Salmon_E1: hypothetical protein VIP0026; ENTCAN_06678; phage(gi170676302) 1e-19 Click
13complement(1650482..1650832) PHAGE_Salmon_E1: hypothetical protein VIP0025; ENTCAN_06679; phage(gi170676301) 2e-22 Click
14complement(1650829..1651062) ArsC family protein; ENTCAN_06680 0.0 Click
15complement(1651055..1651228) PHAGE_Salmon_SPN3UB: hypothetical protein; ENTCAN_06681; phage(gi423262387) 6e-14 Click
16complement(1651228..1651608) PHAGE_Salmon_E1: hypothetical protein VIP0024; ENTCAN_06682; phage(gi170676300) 2e-11 Click
17complement(1651611..1651976) conserved hypothetical protein; ENTCAN_06683 0.0 Click
18complement(1651986..1653083) PHAGE_Pseudo_phi297: putative coat protein; ENTCAN_06684; phage(gi374531291) 9e-24 Click
19complement(1653093..1653527) PHAGE_Salmon_E1: putative capsid decoration protein; ENTCAN_06685; phage(gi170676292) 9e-05 Click
20complement(1653531..1654919) PHAGE_Salmon_E1: hypothetical protein VIP0015; ENTCAN_06686; phage(gi170676291) 3e-68 Click
21complement(1654988..1655491) hypothetical protein; ENTCAN_06687 0.0 Click
22complement(1655529..1656419) PHAGE_Salmon_E1: putative head assembly protein; ENTCAN_06688; phage(gi170676281) 2e-51 Click
23complement(1656457..1657917) PHAGE_Salmon_E1: putative portal protein; ENTCAN_06689; phage(gi170676280) 5e-95 Click
24complement(1657929..1659401) PHAGE_Cronob_phiES15: terminase large subunit; ENTCAN_06690; phage(gi401817592) 0.0 Click
25complement(1659401..1660003) PHAGE_Escher_HK639: terminase small subunit; ENTCAN_06691; phage(gi356870601) 4e-81 Click
26complement(1660007..1660225) conserved hypothetical protein; ENTCAN_06692 0.0 Click
271660439..1660723 conserved hypothetical protein; ENTCAN_06693 0.0 Click
28complement(1661159..1661278) hypothetical protein; ENTCAN_06694 0.0 Click
29complement(1661283..1661744) PHAGE_Entero_HK630: cell lysis protein Rz; ENTCAN_06695; phage(gi428782852) 2e-49 Click
30complement(1661741..1662043) conserved hypothetical protein; ENTCAN_06696 0.0 Click
31complement(1662040..1662534) PHAGE_Salmon_vB_SemP_Emek: lysin; ENTCAN_06697; phage(gi399498856) 4e-55 Click
32complement(1662512..1662736) PHAGE_Stx2_c_1717: holin protein S-like protein; ENTCAN_06698; phage(gi209447171) 6e-14 Click
33complement(1663224..1663913) PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ENTCAN_06699; phage(gi169257244) 1e-73 Click
34complement(1664023..1664658) PHAGE_Salmon_ST160: NinG; ENTCAN_06700; phage(gi318065938) 4e-44 Click
35complement(1664651..1664821) PHAGE_Entero_HK225: NinE protein; ENTCAN_06701; phage(gi428782437) 2e-22 Click
36complement(1664821..1665276) PHAGE_Cronob_phiES15: hypothetical protein; ENTCAN_06702; phage(gi401817579) 2e-60 Click
37complement(1665464..1665730) conserved hypothetical protein; ENTCAN_06703 0.0 Click
38complement(1665860..1666582) PHAGE_Salmon_ST64B: hypothetical protein sb31; ENTCAN_06704; phage(gi23505475) 5e-15 Click
39complement(1666567..1666875) PHAGE_Entero_N15: gp44; ENTCAN_06705; phage(gi9630510) 9e-51 Click
40complement(1666878..1667336) hypothetical protein; ENTCAN_06706 0.0 Click
41complement(1667333..1667563) PHAGE_Escher_HK639: hypothetical protein; ENTCAN_06707; phage(gi356870658) 4e-32 Click
42complement(1667560..1668066) PHAGE_Salmon_E1: hypothetical protein VIP0050; ENTCAN_06708; phage(gi170676325) 3e-08 Click
43complement(1668063..1668641) PHAGE_Escher_HK639: putative ren-like protein; ENTCAN_06709; phage(gi356870656) 1e-14 Click
44complement(1668638..1669510) PHAGE_Entero_mEpX1: putative replication protein DnaC; ENTCAN_06710; phage(gi428781919) 8e-106 Click
45complement(1669495..1670364) PHAGE_Entero_mEpX1: DNA replication protein O; ENTCAN_06711; phage(gi428781918) 1e-74 Click
46complement(1670450..1670944) PHAGE_Entero_mEp237: CII protein; ENTCAN_06712; phage(gi435439306) 3e-54 Click
47complement(1670996..1671196) PHAGE_Escher_TL_2011c: hypothetical protein; ENTCAN_06713; phage(gi418487091) 2e-08 Click
481671304..1672020 PHAGE_Entero_mEpX2: prophage repressor; ENTCAN_06714; phage(gi428765656) 4e-102 Click
49complement(1672051..1672437) PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; ENTCAN_06715; phage(gi399498805) 3e-29 Click
501673390..1673578 conserved hypothetical protein; ENTCAN_06716 0.0 Click
511673575..1673739 PHAGE_Escher_HK639: hypothetical protein; ENTCAN_06717; phage(gi356870642) 5e-16 Click
521673736..1673945 PHAGE_Cronob_phiES15: prophage Kil protein; ENTCAN_06718; phage(gi401817572) 1e-09 Click
531674256..1674390 PHAGE_Erwini_vB_EamP_S6: gp055; ENTCAN_06719; phage(gi422935894) 3e-10 Click
541674461..1675432 PHAGE_Entero_c_1: hypothetical protein; ENTCAN_06720; phage(gi428781776) 8e-68 Click
551675441..1675638 thioredoxin reductase; ENTCAN_06721 0.0 Click
561675635..1675793 PHAGE_Salmon_vB_SosS_Oslo: Arf protein; ENTCAN_06722; phage(gi399528801) 1e-07 Click
571675790..1676416 PHAGE_Mycoba_Porky: gp68; ENTCAN_06723; phage(gi194303364) 4e-15 Click
581676417..1676860 PHAGE_Aeromo_vB_AsaM_56: putative single-strand DNA binding protein; ENTCAN_06724; phage(gi422937500) 3e-33 Click
591676886..1677107 conserved hypothetical protein; ENTCAN_06725 0.0 Click
601677107..1677259 PHAGE_Salmon_SPN1S: hypothetical protein; ENTCAN_06726; phage(gi374531225) 1e-06 Click
611677256..1678386 PHAGE_Mycoba_Porky: gp98; ENTCAN_06727; phage(gi194303394) 3e-53 Click
621678383..1678601 conserved hypothetical protein; ENTCAN_06728 0.0 Click
631678598..1679134 PHAGE_Salmon_SSU5: hypothetical protein; ENTCAN_06729; phage(gi410491510) 8e-72 Click
641679131..1679322 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp50; ENTCAN_06730; phage(gi116222042) 8e-15 Click
651679319..1679549 PHAGE_Salmon_E1: hypothetical protein VIP0020; ENTCAN_06731; phage(gi170676296) 4e-06 Click
661679638..1679784 conserved hypothetical protein; ENTCAN_06732 0.0 Click
671679788..1680003 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip097; ENTCAN_06733; phage(gi20065892) 4e-18 Click
681680003..1680191 conserved hypothetical protein; ENTCAN_06734 0.0 Click
691680300..1680545 PHAGE_Entero_phiP27: putative excisionase; ENTCAN_06735; phage(gi18249866) 6e-28 Click
701680380..1680391 attR    CACCATCGAGCG 0.0 Click
711680591..1681886 PHAGE_Entero_phiP27: putative integrase; ENTCAN_06736; phage(gi18249865) 0.0 Click

Region 3, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2961508..2961855) PHAGE_Burkho_BcepMu: gp01; ENTCAN_08015; phage(gi48696911) 2e-24 Click
22962360..2962647 PHAGE_Burkho_BcepMu: gp21; ENTCAN_08016; phage(gi48696931) 8e-22 Click
32962572..2963258 PHAGE_Burkho_BcepMu: gp22; ENTCAN_08017; phage(gi48696932) 5e-52 Click
42963271..2963585 PHAGE_Burkho_BcepMu: gp25; ENTCAN_08018; phage(gi48696935) 7e-21 Click
52963802..2964170 PHAGE_Burkho_BcepMu: gp37; ENTCAN_08019; phage(gi48696947) 5e-11 Click
62964167..2964364 PHAGE_Burkho_BcepMu: gp38; ENTCAN_08020; phage(gi48696948) 1e-08 Click
72964354..2965787 PHAGE_Burkho_BcepMu: gp39; ENTCAN_08021; phage(gi48696949) 0.0 Click
82965787..2966311 PHAGE_Burkho_BcepMu: gp40; ENTCAN_08022; phage(gi48696950) 3e-68 Click
92966342..2966680 PHAGE_Burkho_BcepMu: gp41; ENTCAN_08023; phage(gi48696951) 1e-09 Click
102966868..2969126 PHAGE_Burkho_BcepMu: gp44; ENTCAN_08024; phage(gi48696954) 1e-63 Click
112969126..2970079 PHAGE_Burkho_BcepMu: gp45; ENTCAN_08025; phage(gi48696955) 2e-44 Click
122970079..2970288 PHAGE_Burkho_BcepMu: gp46; ENTCAN_08026; phage(gi48696956) 1e-17 Click
132970276..2971316 PHAGE_Burkho_BcepMu: gp47; ENTCAN_08027; phage(gi48696957) 2e-78 Click
142971326..2972030 PHAGE_Burkho_BcepMu: gp48; ENTCAN_08028; phage(gi48696958) 3e-39 Click
152972131..2972490 PHAGE_Burkho_BcepMu: gp49; ENTCAN_08029; phage(gi48696959) 5e-36 Click
162972481..2973596 PHAGE_Burkho_BcepMu: gp50; ENTCAN_08030; phage(gi48696960) 2e-103 Click
172973589..2974221 PHAGE_Burkho_BcepMu: gp51; ENTCAN_08031; phage(gi48696961) 2e-25 Click
182974224..2975681 PHAGE_Entero_vB_EcoM_VR7: gp37 long tail fiber distal subunit; ENTCAN_08032; phage(gi314121827) 1e-67 Click
192975876..2976385 PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; ENTCAN_08033; phage(gi16129505) 2e-12 Click
202976580..2976837 PHAGE_Haemop_SuMu: enoyl-CoA hydratase/carnithine racemase-like protein; ENTCAN_08034; phage(gi418489075) 9e-11 Click
21complement(2976873..2977745) ribosomal large subunit pseudouridine synthase F; ENTCAN_08035 0.0 Click
22complement(2977775..2977897) hypothetical protein; ENTCAN_08036 0.0 Click
23complement(2977958..2979589) PHAGE_Lactob_Lj771: minor tail protein gp26-like protein; ENTCAN_08037; phage(gi163932195) 8e-05 Click

Region 4, total : 37 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3983909..3984769) PROPHAGE_Escher_MG1655: glycation-binding protein, predicted protease/chaperone; essential for genome maintenance; ENTCAN_09052; phage(gi16130960) 4e-152 Click
23984770..3985108 conserved hypothetical protein; ENTCAN_09053 0.0 Click
33985159..3985374 ribosomal protein S21; ENTCAN_09054 0.0 Click
43985489..3987234 PHAGE_Helico_phiHP33: DNA primase; ENTCAN_09055; phage(gi371671350) 1e-45 Click
53987380..3987499 sigma D factor of RNA polymerase; ENTCAN_09056 0.0 Click
63987516..3989360 PHAGE_Synech_S_CBS1: group2 RNA polymerase sigma factor; ENTCAN_09057; phage(gi356870821) 4e-36 Click
7complement(3989450..3989977) G/U mismatch-specific DNA glycosylase; ENTCAN_09058 0.0 Click
83990082..3990157 tRNA 0.0 Click
9complement(3990508..3991662) PHAGE_Entero_PsP3: gp26; ENTCAN_09060; phage(gi41057378) 1e-134 Click
10complement(3991659..3992123) PHAGE_Entero_PsP3: gp25; ENTCAN_09061; phage(gi41057377) 6e-56 Click
11complement(3992135..3994582) PHAGE_Entero_PsP3: gp24; ENTCAN_09062; phage(gi41057376) 0.0 Click
12complement(3994575..3994694) PHAGE_Entero_PsP3: gp23.5; ENTCAN_09063; phage(gi41057394) 2e-14 Click
13complement(3994727..3995020) PHAGE_Entero_PsP3: gp23; ENTCAN_09064; phage(gi41057375) 1e-26 Click
14complement(3995076..3995594) PHAGE_Entero_PsP3: gp22; ENTCAN_09065; phage(gi41057374) 6e-79 Click
15complement(3995606..3996799) PHAGE_Entero_PsP3: gp21; ENTCAN_09066; phage(gi41057373) 0.0 Click
16complement(3997072..3997503) PHAGE_Bacter_2: tail fiber; ENTCAN_09067; phage(gi212499733) 7e-20 Click
17complement(3997505..3999517) PHAGE_Entero_PsP3: gp19; ENTCAN_09068; phage(gi41057371) 3e-131 Click
18complement(3999529..4000059) PHAGE_Entero_PsP3: gp18; ENTCAN_09069; phage(gi41057370) 8e-88 Click
19complement(4000052..4000960) PHAGE_Entero_PsP3: gp17; ENTCAN_09070; phage(gi41057369) 1e-134 Click
20complement(4000966..4001316) PHAGE_Entero_PsP3: gp16; ENTCAN_09071; phage(gi41057368) 2e-39 Click
21complement(4001313..4001954) PHAGE_Entero_PsP3: gp15; ENTCAN_09072; phage(gi41057367) 3e-93 Click
22complement(4002057..4002524) PHAGE_Entero_PsP3: gp13; ENTCAN_09073; phage(gi41057365) 3e-49 Click
23complement(4002487..4002645) PHAGE_Entero_PsP3: gp12; ENTCAN_09074; phage(gi41057364) 3e-15 Click
24complement(4002620..4003045) PHAGE_Entero_PsP3: gp11; ENTCAN_09075; phage(gi41057363) 9e-39 Click
25complement(4003045..4003515) PHAGE_Entero_2: endolysin; ENTCAN_09076; phage(gi169936041) 7e-54 Click
26complement(4003535..4003756) PHAGE_Erwini_ENT90: hypothetical protein; ENTCAN_09077; phage(gi431810988) 2e-05 Click
27complement(4003747..4004076) PHAGE_Entero_PsP3: gp8; ENTCAN_09078; phage(gi41057360) 2e-24 Click
28complement(4004129..4004569) PHAGE_Entero_PsP3: TumB; ENTCAN_09079; phage(gi41057390) 1e-13 Click
29complement(4004679..4006838) PHAGE_Entero_PsP3: gp36; ENTCAN_09080; phage(gi41057388) 0.0 Click
30complement(4006870..4007091) PHAGE_Entero_PsP3: gp34; ENTCAN_09081; phage(gi41057386) 5e-28 Click
31complement(4007091..4007318) PHAGE_Entero_PsP3: gp33; ENTCAN_09082; phage(gi41057385) 2e-14 Click
32complement(4007386..4007724) PHAGE_Salmon_RE_2010: hypothetical protein; ENTCAN_09083; phage(gi418489688) 2e-33 Click
334007919..4008527 PHAGE_Entero_PsP3: CI; ENTCAN_09084; phage(gi41057393) 8e-16 Click
34complement(4008634..4008765) conserved hypothetical protein; ENTCAN_09085 0.0 Click
354009315..4010484 PHAGE_Bathyc_BpV1: hypothetical protein; ENTCAN_09086; phage(gi313768111) 2e-05 Click
36complement(4010485..4011249) iron-chelator utilization protein; ENTCAN_09087 0.0 Click
374011395..4011886 putative transcriptional regulator; ENTCAN_09088 0.0 Click
38complement(4011883..4013442) PHAGE_Vibrio_VBP32: hypothetical protein; ENTCAN_09089; phage(gi472343054) 7e-07 Click

Region 5, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14212776..4212801 attL    TCGGCATGGGGAAGCGCCTTTTTTAT 0.0 Click
24212907..4213671 abortive phage resistance protein; ENTCAN_09294 0.0 Click
34213684..4213965 conserved hypothetical protein; ENTCAN_09295 0.0 Click
4complement(4213929..4214072) conserved hypothetical protein; ENTCAN_09296 0.0 Click
5complement(4214418..4214756) hypothetical protein; ENTCAN_09297 0.0 Click
6complement(4214765..4215379) PHAGE_Entero_mEp234: tail assembly protein I; ENTCAN_09298; phage(gi428782273) 1e-69 Click
7complement(4215393..4217054) PHAGE_Geobac_E2: putative terminase large subunit; ENTCAN_09299; phage(gi148747729) 4e-85 Click
8complement(4217038..4217394) PHAGE_Entero_phiP27: hypothetical protein P27p35; ENTCAN_09300; phage(gi18249899) 7e-11 Click
9complement(4217525..4217689) conserved hypothetical protein; ENTCAN_09301 0.0 Click
10complement(4217670..4217843) putative holin protein of prophage protein; ENTCAN_09302 0.0 Click
11complement(4218113..4218406) PHAGE_Entero_phiP27: hypothetical protein P27p41; ENTCAN_09303; phage(gi18249905) 4e-05 Click
12complement(4218399..4218737) PHAGE_Escher_HK75: head-tail adaptor protein; ENTCAN_09304; phage(gi356870684) 1e-16 Click
13complement(4218734..4219969) PHAGE_Entero_phiP27: putative portal protein; ENTCAN_09305; phage(gi18249902) 8e-48 Click
14complement(4219971..4220531) PHAGE_Clostr_phi3626: putative prohead protease; ENTCAN_09306; phage(gi20065968) 2e-26 Click
15complement(4220583..4221749) PHAGE_Entero_phiP27: putative major capsid protein; ENTCAN_09307; phage(gi18249904) 5e-54 Click
164221980..4223224 hypothetical protein; ENTCAN_09308 0.0 Click
17complement(4223262..4223501) hypothetical bacteriophage protein; ENTCAN_09309 0.0 Click
18complement(4223716..4225080) PHAGE_Rhizob_3: p101; ENTCAN_09310; phage(gi195546631) 9e-29 Click
19complement(4225077..4225445) hypothetical protein; ENTCAN_09311 0.0 Click
20complement(4225442..4225663) aminotransferase YbdL; ENTCAN_09312 0.0 Click
21complement(4225656..4225868) conserved hypothetical protein; ENTCAN_09313 0.0 Click
22complement(4225834..4226817) conserved hypothetical protein; ENTCAN_09314 0.0 Click
234226835..4226963 conserved hypothetical protein; ENTCAN_09315 0.0 Click
24complement(4227069..4227869) conserved hypothetical protein; ENTCAN_09316 0.0 Click
25complement(4227866..4229089) PHAGE_Entero_mEpX1: integrase; ENTCAN_09317; phage(gi428781899) 6e-53 Click
264229319..4229344 attR    TCGGCATGGGGAAGCGCCTTTTTTAT 0.0 Click

Region 6, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4623948..4625138) PHAGE_Helico_2: membrane transporter; ENTCAN_09738; phage(gi370702969) 2e-07 Click
2complement(4625211..4625642) PHAGE_Entero_lambda: DNA replication protein; ENTCAN_09739; phage(gi9626295) 1e-66 Click
34625743..4626456 PHAGE_Entero_lambda: repressor; ENTCAN_09740; phage(gi9626292) 2e-133 Click
44626569..4627378 PHAGE_Entero_lambda: exclusion protein; ENTCAN_09741; phage(gi9626291) 5e-152 Click
54627379..4627806 PHAGE_Entero_lambda: exclusion protein; ENTCAN_09742; phage(gi9626290) 2e-74 Click
64628193..4628594 PHAGE_Entero_lambda: early gene regulator; ENTCAN_09743; phage(gi9626289) 1e-73 Click
7complement(4628595..4628934) PHAGE_Entero_lambda: Superinfection exclusion protein B; ENTCAN_09744; phage(gi19263394) 1e-59 Click
84629260..4630240 modification methylase EcoRI; ENTCAN_09745 0.0 Click
94630389..4632398 PHAGE_Synech_S_CBS4: tail fiber protein; ENTCAN_09746; phage(gi374531790) 7e-20 Click
10complement(4632399..4632949) PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; ENTCAN_09747; phage(gi16131377) 1e-103 Click
114632950..4633294 PROPHAGE_Escher_MG1655: IS186 transposase; ENTCAN_09748; phage(gi90111427) 6e-65 Click