Citrobacter youngae ATCC 29220 .1, whole genome [asmbl_id: NC_000000].5150259, GC%: 52.69%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1514701..514715 attL    CGCCTTTGCTGCATA 0.0 Click
2528897..530843 PHAGE_Plankt_PaV_LD: ABC transporter; CIT292_06427; phage(gi371496158) 4e-43 Click
3complement(530918..531142) PHAGE_Lactoc_bIL312: Csp; CIT292_06428; phage(gi13095918) 3e-14 Click
4531466..531786 PHAGE_Cronob_vB_CsaM_GAP32: ATP-dependent Clp protease; CIT292_06429; phage(gi414087232) 2e-05 Click
5531817..534093 PROPHAGE_Escher_EDL933: ATP-dependent Clp protease ATP-binding subunit; CIT292_06430; phage(gi15800640) 0.0 Click
6534167..534499 conserved hypothetical protein; CIT292_06431 0.0 Click
7complement(534730..534861) PHAGE_Yersin_413C: Int; CIT292_06432; phage(gi30065733) 1e-05 Click
8535008..535676 PHAGE_Yersin_413C: gpA; CIT292_06433; phage(gi30065742) 2e-79 Click
9complement(535951..538044) conserved hypothetical protein; CIT292_06434 0.0 Click
10complement(538435..538839) PHAGE_Yersin_413C: gpQ; CIT292_06435; phage(gi30065705) 2e-55 Click
11complement(538902..539228) PHAGE_Yersin_413C: gpQ; CIT292_06436; phage(gi30065705) 4e-41 Click
12complement(539448..539714) PHAGE_Yersin_413C: gpP; CIT292_06437; phage(gi30065706) 8e-33 Click
13complement(539736..540056) PHAGE_Yersin_413C: gpP; CIT292_06438; phage(gi30065706) 2e-47 Click
14540119..540310 PHAGE_Entero_PsP3: gp26; CIT292_06439; phage(gi41057378) 8e-09 Click
15540316..540534 PHAGE_Entero_PsP3: gp26; CIT292_06440; phage(gi41057378) 1e-05 Click
16545729..545743 attR    CGCCTTTGCTGCATA 0.0 Click

Region 2, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14387774..4387785 attL    TTAAAATAATTA 0.0 Click
24387880..4389064 PROPHAGE_Escher_CFT073: putative prophage integrase; CIT292_10460; phage(gi26250313) 2e-157 Click
34389134..4389145 attR    TTAAAATAATTA 0.0 Click
44389163..4390908 putative phage head-tail adaptor; CIT292_10461 0.0 Click
54390892..4392616 conserved hypothetical protein; CIT292_10462 0.0 Click
6complement(4392701..4393495) PROPHAGE_Xantho_33913: ISxcC1 transposase; CIT292_10463; phage(gi21231060) 8e-86 Click
7complement(4393546..4393833) PROPHAGE_Salmon_LT2: transposase; CIT292_10464; phage(gi16766077) 2e-39 Click
84393964..4394386 conserved hypothetical protein; CIT292_10465 0.0 Click
9complement(4394606..4396345) PHAGE_Entero_P2: Old; CIT292_10466; phage(gi9630369) 2e-14 Click
104396576..4396851 phage immunity repressor protein; CIT292_10467 0.0 Click
114396877..4397011 conserved hypothetical protein; CIT292_10468 0.0 Click
12complement(4397012..4397257) endothelin-1; CIT292_10469 0.0 Click
13complement(4397244..4398290) PHAGE_Rhizob_3: p101; CIT292_10470; phage(gi195546631) 5e-29 Click
14complement(4398302..4399276) PHAGE_Entero_P4: DNA primase; CIT292_10471; phage(gi9627512) 5e-41 Click
15complement(4399273..4399587) PHAGE_Entero_P4: transcriptional regulator; CIT292_10472; phage(gi9627517) 4e-06 Click
16complement(4399568..4400425) PROPHAGE_Salmon_LT2: integrase; CIT292_10473; phage(gi16766072) 7e-83 Click

Region 3, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14883523..4883535 attL    TATTGTTTTTTTC 0.0 Click
2complement(4887975..4888199) PROPHAGE_Escher_CFT073: prophage P4 integrase; CIT292_10986; phage(gi26251024) 7e-18 Click
34888275..4888307 attL    AGATACGCACTGAGACAGTTTTTTACGCTAACT 0.0 Click
4complement(4888302..4888445) conserved hypothetical protein; CIT292_10987 0.0 Click
5complement(4888464..4888628) conserved hypothetical protein; CIT292_10988 0.0 Click
64888748..4888954 PROPHAGE_Escher_EDL933: putative transposase; CIT292_10989; phage(gi15803522) 7e-27 Click
7complement(4889555..4890555) PHAGE_Equid__9: envelope glycoprotein J; CIT292_10990; phage(gi216905924) 2e-09 Click
8complement(4890556..4891198) PHAGE_Equid_8: envelope glycoprotein J; CIT292_10991; phage(gi386522795) 1e-11 Click
9complement(4891199..4893179) PHAGE_Equid__9: envelope glycoprotein J; CIT292_10992; phage(gi216905924) 9e-17 Click
10complement(4893235..4893450) conserved hypothetical protein; CIT292_10993 0.0 Click
114893727..4893918 insertion sequence protein; CIT292_10994 0.0 Click
12complement(4893965..4894105) conserved hypothetical protein; CIT292_10996 0.0 Click
134894104..4894490 PHAGE_Entero_4795: putative transposase OrfB protein of IS629; CIT292_10995; phage(gi157166067) 2e-17 Click
144894491..4894697 conserved hypothetical protein; CIT292_10997 0.0 Click
15complement(4894957..4895169) conserved hypothetical protein; CIT292_10998 0.0 Click
164895188..4895401 conserved hypothetical protein; CIT292_10999 0.0 Click
174895592..4895856 PROPHAGE_Salmon_LT2: integrase; CIT292_11000; phage(gi16766072) 6e-18 Click
184895857..4896711 PROPHAGE_Salmon_LT2: integrase; CIT292_11001; phage(gi16766072) 8e-93 Click
194901235..4901267 attR    AGATACGCACTGAGACAGTTTTTTACGCTAACT 0.0 Click
204909404..4909416 attR    TATTGTTTTTTTC 0.0 Click

Region 4, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(5128094..5128699) PHAGE_Gifsy_1: leucine-rich repeat protein; CIT292_11276; phage(gi169257209) 7e-60 Click
2complement(5128711..5128887) putative cell surface protein; CIT292_11277 0.0 Click
35129429..5129839 conserved hypothetical protein; CIT292_11278 0.0 Click
4complement(5130275..5130790) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp23; CIT292_11279; phage(gi148609405) 7e-11 Click
5complement(5131080..5131475) PROPHAGE_Escher_MG1655: IS1 transposase B; CIT292_11280; phage(gi16131317) 1e-28 Click
6complement(5131502..5131774) PHAGE_Entero_P1: InsA; CIT292_11281; phage(gi46401643) 1e-15 Click
75132049..5133086 invasin; CIT292_11282 0.0 Click
85133083..5134255 PHAGE_Equid_8: envelope glycoprotein J; CIT292_11283; phage(gi386522795) 5e-14 Click
9complement(5134491..5135042) PROPHAGE_Escher_EDL933: putative transposase; CIT292_11284; phage(gi15803522) 9e-68 Click
105135463..5135597 conserved hypothetical protein; CIT292_11285 0.0 Click
115135747..5136205 PHAGE_Hypert_2: IS element Dka2 orfA; CIT292_11286; phage(gi300116744) 4e-15 Click

Region 5, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(5140875..5141110) PROPHAGE_Escher_EDL933: putative transposase; CIT292_11291; phage(gi15803522) 3e-13 Click
25141111..5141277 PROPHAGE_Escher_EDL933: putative transposase; CIT292_11292; phage(gi15803522) 6e-22 Click
3complement(5141413..5141565) modification methylase EcoRI; CIT292_11293 0.0 Click
45141793..5142152 PHAGE_Entero_lambda: Superinfection exclusion protein B; CIT292_11294; phage(gi19263394) 9e-64 Click
5complement(5142277..5142417) PHAGE_Entero_lambda: early gene regulator; CIT292_11295; phage(gi9626289) 1e-21 Click
6complement(5142418..5143066) modification methylase EcoRI; CIT292_11296 0.0 Click
7complement(5143096..5143282) type II restriction enzyme EcoRI; CIT292_11297 0.0 Click
8complement(5143922..5144200) PHAGE_Entero_lambda: exclusion protein; CIT292_11298; phage(gi9626290) 7e-45 Click
9complement(5144372..5145211) PHAGE_Entero_lambda: exclusion protein; CIT292_11299; phage(gi9626291) 1e-157 Click
10complement(5145324..5146037) PHAGE_Entero_lambda: repressor; CIT292_11300; phage(gi9626292) 2e-133 Click
115146138..5146569 PHAGE_Entero_lambda: DNA replication protein; CIT292_11301; phage(gi9626295) 1e-66 Click
125146642..5147832 PHAGE_Helico_2: membrane transporter; CIT292_11302; phage(gi370702969) 2e-07 Click
135147736..5148074 conserved hypothetical protein; CIT292_11303 0.0 Click
14complement(5148071..5148439) conserved hypothetical protein; CIT292_11305 0.0 Click
155148438..5148662 rop protein; CIT292_11304 0.0 Click
16complement(5148805..5149673) PHAGE_Equid__4: envelope glycoprotein J; CIT292_11306; phage(gi9629801) 3e-17 Click
17complement(5149674..5150259) PHAGE_Equid__4: envelope glycoprotein J; CIT292_11307; phage(gi9629801) 6e-12 Click