Lactobacillus gasseri MV-22 .1, whole genome shotgun sequence. [asmbl_id: NC_000000].1929035, GC%: 35.00%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 67 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
167675..67687 attL    TCTTTTTTATGAT 0.0 Click
2complement(71513..72457) PHAGE_Lactob_phiadh: lysin; PP_00098; phage(gi9633062) 2e-109 Click
3complement(72510..72794) PHAGE_Lactob_phiadh: holin; PP_00099; phage(gi9633061) 5e-21 Click
4complement(72778..72900) hypothetical protein [Lactobacillus johnsonii DPC 6026] gi|385825751|ref|YP_005862093.1|; PP_00100 2e-07 Click
5complement(72876..72995) hypothetical; PP_00101 0.0 Click
6complement(73009..73398) PHAGE_Lactob_Lv_1: holin; PP_00102; phage(gi219563212) 8e-18 Click
7complement(73379..73582) PHAGE_Lactob_phiadh: hypothetical protein phiadhp58; PP_00103; phage(gi9633058) 1e-12 Click
8complement(73582..73722) hypothetical; PP_00104 0.0 Click
9complement(73917..74087) PHAGE_Lactob_phiadh: hypothetical protein phiadhp57; PP_00105; phage(gi9633057) 2e-07 Click
10complement(74142..77042) PHAGE_Lactob_phiadh: hypothetical protein phiadhp56; PP_00106; phage(gi9633056) 3e-138 Click
11complement(77026..77235) hypothetical; PP_00107 0.0 Click
12complement(77253..77843) PHAGE_Lactob_phiadh: hypothetical protein phiadhp55; PP_00108; phage(gi9633055) 5e-103 Click
13complement(77852..80050) PHAGE_Lactob_phiadh: hypothetical protein phiadhp55; PP_00109; phage(gi9633055) 0.0 Click
14complement(80047..80604) PHAGE_Lactob_phiadh: hypothetical protein phiadhp53; PP_00110; phage(gi9633053) 3e-106 Click
15complement(80776..82884) PHAGE_Lactob_phiadh: hypothetical protein phiadhp52; PP_00111; phage(gi9633052) 0.0 Click
16complement(83438..85714) PHAGE_Lactob_phiadh: hypothetical protein phiadhp52; PP_00112; phage(gi9633052) 0.0 Click
17complement(85741..85962) PHAGE_Lactob_phiadh: hypothetical protein phiadhp51; PP_00113; phage(gi9633051) 5e-30 Click
18complement(85963..86196) PHAGE_Lactob_phiadh: hypothetical protein phiadhp50; PP_00114; phage(gi9633050) 5e-38 Click
19complement(86174..86725) PHAGE_Lactob_phiadh: hypothetical protein phiadhp49; PP_00115; phage(gi9633049) 1e-88 Click
20complement(86810..87442) PHAGE_Lactob_phiadh: major tail protein; PP_00116; phage(gi9633048) 3e-102 Click
21complement(87557..87817) PHAGE_Lactob_phiadh: hypothetical protein phiadhp47; PP_00117; phage(gi9633047) 2e-39 Click
22complement(87801..88280) PHAGE_Lactob_phiadh: hypothetical protein phiadhp46; PP_00118; phage(gi9633046) 1e-79 Click
23complement(88273..88629) PHAGE_Lactob_phiadh: hypothetical protein phiadhp45; PP_00119; phage(gi9633045) 1e-58 Click
24complement(88586..88966) PHAGE_Lactob_phiadh: hypothetical protein phiadhp44; PP_00120; phage(gi9633044) 9e-62 Click
25complement(88983..89894) PHAGE_Lactob_phiadh: major head protein; PP_00121; phage(gi9633043) 3e-166 Click
26complement(89891..90007) PHAGE_Lactob_phiadh: major head protein; PP_00122; phage(gi9633043) 8e-07 Click
27complement(90031..90168) PHAGE_Lactob_phiadh: major head protein; PP_00123; phage(gi9633043) 3e-16 Click
28complement(90169..90339) PHAGE_Lactob_phiadh: ClpP-like protease; PP_00124; phage(gi9633042) 1e-18 Click
29complement(90339..90884) PHAGE_Lactob_phiadh: ClpP-like protease; PP_00125; phage(gi9633042) 7e-95 Click
30complement(90909..92036) PHAGE_Lactob_phiadh: hypothetical protein phiadhp41; PP_00126; phage(gi9633041) 0.0 Click
31complement(92095..92241) hypothetical; PP_00127 0.0 Click
32complement(92222..94096) PHAGE_Lactob_phiadh: hypothetical protein phiadhp40; PP_00128; phage(gi9633040) 0.0 Click
33complement(94093..94542) PHAGE_Lactob_phiadh: hypothetical protein phiadhp39; PP_00129; phage(gi9633039) 2e-82 Click
34complement(94702..95214) PHAGE_Lactob_phiadh: hypothetical protein phiadhp38; PP_00130; phage(gi9633038) 3e-95 Click
35complement(95522..96001) PHAGE_Lactob_phiadh: hypothetical protein phiadhp37; PP_00131; phage(gi9633037) 7e-72 Click
36complement(96020..96313) PHAGE_Clostr_phiCTP1: hypothetical protein phiCTP1_gp74; PP_00132; phage(gi304360736) 3e-08 Click
37complement(96372..96863) PHAGE_Lactob_phiadh: hypothetical protein phiadhp36; PP_00133; phage(gi9633036) 1e-58 Click
38complement(96847..97101) PHAGE_Lactob_AQ113: phage protein-Restriction nuclease superfamily; PP_00134; phage(gi446730281) 4e-32 Click
39complement(97184..97441) PHAGE_Lactob_phiadh: hypothetical protein phiadhp34; PP_00135; phage(gi9633034) 9e-35 Click
40complement(97422..97715) PHAGE_Lactob_phiadh: hypothetical protein phiadhp33; PP_00136; phage(gi9633033) 2e-14 Click
41complement(97702..97974) PHAGE_Lactob_phiadh: hypothetical protein phiadhp33; PP_00137; phage(gi9633033) 2e-37 Click
42complement(98021..98242) PHAGE_Lactob_phiadh: hypothetical protein phiadhp32; PP_00138; phage(gi9633032) 2e-21 Click
43complement(98312..98668) PHAGE_Lactob_phiadh: hypothetical protein phiadhp30; PP_00139; phage(gi9633030) 1e-59 Click
44complement(98731..98973) PHAGE_Lactob_johnsonii_prophage_Lj771: hypothetical protein LJ771_018; PP_00140; phage(gi163932170) 2e-44 Click
45complement(98970..99410) PHAGE_Lactob_johnsonii_prophage_Lj771: hypothetical protein LJ771_017; PP_00141; phage(gi163932169) 8e-55 Click
46complement(99685..100209) PHAGE_Lactob_AQ113: prophage protein; PP_00142; phage(gi446730271) 3e-12 Click
47complement(100206..100469) hypothetical; PP_00143 0.0 Click
48complement(100470..100811) PHAGE_Lactob_phiadh: hypothetical protein phiadhp25; PP_00144; phage(gi9633025) 8e-20 Click
49complement(100808..100945) PHAGE_Lactob_phiadh: hypothetical protein phiadhp24; PP_00145; phage(gi9633024) 1e-20 Click
50complement(101348..102580) PHAGE_Lactob_phiadh: putative DNA-polymerase or DNA-primase; PP_00146; phage(gi9633023) 2e-122 Click
51complement(102571..103692) PHAGE_Lactob_phiadh: putative DNA-polymerase or DNA-primase; PP_00147; phage(gi9633023) 2e-123 Click
52complement(103705..104337) PHAGE_Lactob_phiadh: hypothetical protein phiadhp21; PP_00148; phage(gi9633021) 2e-20 Click
53complement(104364..104489) PHAGE_Lactob_phiadh: hypothetical protein phiadhp31; PP_00149; phage(gi9633031) 2e-13 Click
54complement(104520..105884) PHAGE_Lactob_phiadh: putative DEAH-family helicase; PP_00150; phage(gi9633020) 0.0 Click
55complement(105884..106555) PHAGE_Lactob_phiadh: NTP-binding motif protein; PP_00151; phage(gi9633018) 4e-123 Click
56complement(106555..106827) PHAGE_Lactob_phiadh: hypothetical protein phiadhp17; PP_00152; phage(gi9633017) 1e-11 Click
57complement(106821..107162) PHAGE_Lactob_phiadh: hypothetical protein phiadhp16; PP_00153; phage(gi9633016) 1e-28 Click
58complement(107442..107591) PHAGE_Lactob_phiadh: hypothetical protein phiadhp14; PP_00154; phage(gi9633014) 8e-15 Click
59complement(107584..107805) PHAGE_Lactob_phiadh: hypothetical protein phiadhp13; PP_00155; phage(gi9633013) 5e-26 Click
60complement(107798..107920) hypothetical; PP_00156 0.0 Click
61complement(107992..108366) PHAGE_Lactob_Lrm1: antirepressor; PP_00157; phage(gi195661228) 3e-40 Click
62complement(108447..108740) PHAGE_Lactob_KC5a: putative anti-repressor; PP_00158; phage(gi90592591) 3e-23 Click
63complement(108770..108973) PHAGE_Lactoc_bIL312: repressor; PP_00159; phage(gi13095896) 3e-08 Click
64109203..109583 PHAGE_Staphy_SA13: putative Cro/CI family transcriptional regulator; PP_00160; phage(gi526244877) 9e-14 Click
65109807..109971 Lj965 prophage repressor [Lactobacillus amylovorus GRL 1112] gi|315038299|ref|YP_004031867.1|; PP_00161 9e-05 Click
66110002..110307 hypothetical; PP_00162 0.0 Click
67110552..111226 PHAGE_Lactob_prophage_Lj928: hypothetical protein Ljo_1459; PP_00163; phage(gi41179294) 4e-10 Click
68111388..112560 PHAGE_Lactob_phiadh: integrase; PP_00164; phage(gi9633001) 8e-148 Click
69122950..122962 attR    TCTTTTTTATGAT 0.0 Click

Region 2, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1840602..840616 attL    TTTTTAATTTCTTCT 0.0 Click
2complement(855014..856408) PROPHAGE_Escher_Sakai: ATP-dependent protease ATP-binding subunit HslU; PP_00943; phage(gi15834112) 7e-117 Click
3complement(856419..856943) PROPHAGE_Escher_Sakai: ATP-dependent protease peptidase subunit; PP_00944; phage(gi15834113) 1e-40 Click
4complement(856948..857409) PHAGE_Mycoba_Butters: integrase; PP_00945; phage(gi479336499) 4e-13 Click
5complement(857466..857870) integrase [Lactobacillus gasseri ATCC 33323] gi|116629573|ref|YP_814745.1|; PP_00946 3e-62 Click
6complement(857873..859189) tRNA (uracil-5-)-methyltransferase Gid [Lactobacillus gasseri ATCC 33323] gi|116629572|ref|YP_814744.1|; PP_00947 0.0 Click
7complement(859287..861368) PHAGE_Acanth_mimivirus: DNA topoisomerase 1; PP_00948; phage(gi311977597) 7e-104 Click
8complement(861434..862279) PHAGE_Phage_OH2: SMF family protein; PP_00949; phage(gi526118339) 6e-30 Click
9complement(862331..863083) PHAGE_Cafete_BV_PW1: putative ribonuclease HII; PP_00950; phage(gi310831397) 1e-27 Click
10complement(863080..863919) GTPase [Lactobacillus gasseri ATCC 33323] gi|116629568|ref|YP_814740.1|; PP_00951 2e-158 Click
11complement(863922..865370) PHAGE_Thermo_THSA_485A: glycoside hydrolase family 25; PP_00952; phage(gi397912616) 4e-07 Click
12867393..867407 attR    TTTTTAATTTCTTCT 0.0 Click

Region 3, total : 185 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11597365..1597377 attL    ATGTTCAATTTTT 0.0 Click
2complement(1609995..1610351) PHAGE_Ectoca_siliculosus_virus_1: EsV-1-186; PP_01741; phage(gi13242656) 2e-12 Click
3complement(1610351..1610890) Signal transduction histidine kinase [Lactobacillus gasseri ATCC 33323] gi|116628743|ref|YP_813915.1|; PP_01742 1e-85 Click
4complement(1610929..1611858) Signal transduction histidine kinase [Lactobacillus gasseri ATCC 33323] gi|116628743|ref|YP_813915.1|; PP_01743 2e-161 Click
5complement(1611890..1612534) PHAGE_Feldma_species_virus: putative sensor histidine kinase; PP_01744; phage(gi197322366) 4e-06 Click
61612723..1612788 tRNA 0.0 Click
71612936..1612955 attL    CAAACGATTTGGTCTCTTAA 0.0 Click
8complement(1613071..1614174) PHAGE_Lactob_KC5a: integrase; PP_01745; phage(gi90592576) 3e-111 Click
9complement(1614176..1614313) hypothetical; PP_01746 0.0 Click
10complement(1614386..1615012) PHAGE_Lactob_KC5a: hypothetical protein; PP_01747; phage(gi90592577) 8e-68 Click
11complement(1615073..1615525) PHAGE_Lactob_KC5a: hypothetical protein; PP_01748; phage(gi90592578) 5e-47 Click
12complement(1615531..1615869) PHAGE_Lactob_KC5a: putative transcriptional regulator; PP_01749; phage(gi90592579) 1e-35 Click
131616023..1616250 PHAGE_Lactob_KC5a: putative CI-like repressor; PP_01750; phage(gi90592580) 2e-33 Click
141616281..1616610 PHAGE_Lactob_KC5a: hypothetical protein; PP_01751; phage(gi90592581) 2e-51 Click
151616613..1616915 PHAGE_Lactob_KC5a: hypothetical protein; PP_01752; phage(gi90592582) 8e-18 Click
161616909..1617118 hypothetical; PP_01753 0.0 Click
171617124..1617135 attL    AGAAATGAAAAA 0.0 Click
181617252..1617404 PHAGE_Lactob_KC5a: putative recombination protein; PP_01754; phage(gi90592583) 4e-18 Click
191617450..1617776 PHAGE_Lactob_KC5a: hypothetical protein; PP_01755; phage(gi90592584) 2e-56 Click
201617776..1618054 PHAGE_Lactob_KC5a: hypothetical protein; PP_01756; phage(gi90592585) 7e-48 Click
211618060..1618884 PHAGE_Lactob_KC5a: hypothetical protein; PP_01757; phage(gi90592586) 3e-140 Click
221618899..1619804 PHAGE_Lactob_prophage_Lj928: hypothetical protein Ljo_1448; PP_01758; phage(gi41179305) 2e-45 Click
231619810..1620115 PHAGE_Lactob_KC5a: putative transcriptional regulator; PP_01759; phage(gi90592588) 3e-19 Click
241620108..1620893 PHAGE_Lactob_KC5a: putative anti-repressor; PP_01760; phage(gi90592591) 1e-126 Click
251620908..1621093 PHAGE_Lactob_KC5a: hypothetical protein; PP_01761; phage(gi90592592) 7e-27 Click
261621103..1621300 PHAGE_Lactob_KC5a: hypothetical protein; PP_01762; phage(gi90592593) 3e-22 Click
271621316..1621654 hypothetical; PP_01763 0.0 Click
281621639..1621752 hypothetical; PP_01764 0.0 Click
291621756..1622019 hypothetical; PP_01765 0.0 Click
301622168..1622482 PHAGE_Lactob_KC5a: putative holiday junction resolvase; PP_01766; phage(gi90592597) 7e-54 Click
311622479..1622628 PHAGE_Lactob_KC5a: putative holiday junction resolvase; PP_01767; phage(gi90592597) 9e-22 Click
321622629..1622889 PHAGE_Lactob_KC5a: hypothetical protein; PP_01768; phage(gi90592598) 4e-22 Click
331623014..1623145 hypothetical protein LGAS_0655 [Lactobacillus gasseri ATCC 33323] gi|116629315|ref|YP_814487.1|; PP_01769 9e-19 Click
341623135..1623389 PHAGE_Lactob_KC5a: hypothetical protein; PP_01770; phage(gi90592599) 1e-38 Click
351623464..1623604 PHAGE_Lactob_KC5a: hypothetical protein; PP_01771; phage(gi90592600) 1e-18 Click
361623642..1623758 PHAGE_Lactob_KC5a: hypothetical protein; PP_01772; phage(gi90592601) 2e-17 Click
371623780..1624319 PHAGE_Lactob_KC5a: hypothetical protein; PP_01773; phage(gi90592602) 1e-96 Click
381625046..1625118 tRNA 0.0 Click
391625174..1625458 PHAGE_Lactob_KC5a: putative transcriptional regulator; PP_01774; phage(gi90592604) 2e-50 Click
401625710..1625791 tRNA 0.0 Click
411625899..1626516 PHAGE_Lactob_KC5a: hypothetical protein; PP_01775; phage(gi90592606) 1e-121 Click
421626554..1626679 PHAGE_Lactob_KC5a: hypothetical protein; PP_01776; phage(gi90592607) 7e-16 Click
431626842..1627354 PHAGE_Lactob_KC5a: putative phage terminase large subunit A; PP_01777; phage(gi90592608) 2e-94 Click
441627415..1627573 PHAGE_Lactob_KC5a: putative phage terminase small subunit; PP_01778; phage(gi90592609) 3e-17 Click
451627581..1627808 PHAGE_Lactob_KC5a: putative phage terminase small subunit; PP_01779; phage(gi90592609) 7e-33 Click
461628412..1628591 homing nuclease [Lactobacillus gasseri ATCC 33323] gi|116629324|ref|YP_814496.1|; PP_01780 2e-24 Click
471628804..1629586 PHAGE_Lactob_KC5a: putative phage terminase large subunit B; PP_01781; phage(gi90592610) 4e-86 Click
481629583..1629759 PHAGE_Lactob_KC5a: putative phage terminase large subunit B; PP_01782; phage(gi90592610) 2e-13 Click
491629765..1629971 PHAGE_Lactob_KC5a: putative phage terminase large subunit B; PP_01783; phage(gi90592610) 7e-09 Click
501629940..1631373 PHAGE_Lactob_KC5a: putative phage portal protein; PP_01784; phage(gi90592611) 0.0 Click
511631363..1631740 PHAGE_Lactob_KC5a: putative phage head protein; PP_01785; phage(gi90592612) 7e-54 Click
521631725..1632516 PHAGE_Lactob_KC5a: putative phage head protein; PP_01786; phage(gi90592612) 4e-156 Click
531632691..1633188 PHAGE_Lactob_KC5a: putative phage minor capsid protein; PP_01787; phage(gi90592613) 2e-89 Click
541633193..1633822 PHAGE_Lactob_KC5a: putative phage major capsid protein; PP_01788; phage(gi90592614) 1e-110 Click
551633849..1634247 PHAGE_Lactob_KC5a: putative phage major capsid protein; PP_01789; phage(gi90592614) 4e-66 Click
561634256..1634645 PHAGE_Lactob_KC5a: hypothetical protein; PP_01790; phage(gi90592615) 7e-33 Click
571634642..1635004 PHAGE_Lactob_KC5a: hypothetical protein; PP_01791; phage(gi90592616) 9e-65 Click
581635001..1635435 PHAGE_Lactob_KC5a: hypothetical protein; PP_01792; phage(gi90592617) 3e-81 Click
591635432..1635839 PHAGE_Lactob_KC5a: hypothetical protein; PP_01793; phage(gi90592618) 9e-73 Click
601635859..1636041 PHAGE_Lactob_KC5a: hypothetical protein; PP_01794; phage(gi90592619) 2e-27 Click
611636041..1637396 PHAGE_Lactob_KC5a: putative phage sheath tail protein; PP_01795; phage(gi90592620) 0.0 Click
621637408..1637878 PHAGE_Lactob_KC5a: putative phage core tail protein; PP_01796; phage(gi90592621) 3e-84 Click
631638192..1638314 PHAGE_Lactob_KC5a: hypothetical protein; PP_01797; phage(gi90592622) 6e-13 Click
641638289..1638498 PHAGE_Strept_EJ_1: hypothetical protein EJ-1p55; PP_01798; phage(gi39653729) 3e-06 Click
651638544..1639026 PHAGE_Lactob_KC5a: putative minor tail protein; PP_01799; phage(gi90592623) 6e-65 Click
661639023..1640252 PHAGE_Lactob_KC5a: putative minor tail protein; PP_01800; phage(gi90592623) 3e-155 Click
671640243..1641703 PHAGE_Lactob_KC5a: putative minor tail protein; PP_01801; phage(gi90592623) 0.0 Click
681641705..1642385 PHAGE_Lactob_KC5a: putative LysM-like protein; PP_01802; phage(gi90592624) 7e-129 Click
691642382..1642636 PHAGE_Lactob_KC5a: hypothetical protein; PP_01803; phage(gi90592625) 2e-35 Click
701642819..1643427 PHAGE_Lactob_KC5a: hypothetical protein; PP_01804; phage(gi90592625) 4e-113 Click
711643430..1643768 PHAGE_Lactob_KC5a: hypothetical protein; PP_01805; phage(gi90592626) 1e-57 Click
721643770..1644141 PHAGE_Lactob_KC5a: hypothetical protein; PP_01806; phage(gi90592627) 5e-63 Click
731644138..1645289 PHAGE_Lactob_KC5a: putative tail protein; PP_01807; phage(gi90592628) 0.0 Click
741645279..1645839 PHAGE_Lactob_KC5a: hypothetical protein; PP_01808; phage(gi90592629) 4e-101 Click
751645852..1646256 PHAGE_Lactob_KC5a: hypothetical protein; PP_01809; phage(gi90592630) 3e-67 Click
761646256..1646405 PHAGE_Lactob_KC5a: hypothetical protein; PP_01810; phage(gi90592630) 1e-11 Click
771646402..1648018 PHAGE_Lactob_KC5a: hypothetical protein; PP_01811; phage(gi90592630) 2e-148 Click
781648058..1648567 PHAGE_Lactob_KC5a: hypothetical protein; PP_01812; phage(gi90592631) 2e-72 Click
791648567..1648761 PHAGE_Lactob_KC5a: hypothetical protein; PP_01813; phage(gi90592632) 1e-28 Click
801648778..1648918 PHAGE_Lactob_KC5a: unknown; PP_01814; phage(gi90592636) 9e-12 Click
811649146..1649424 PHAGE_Lactob_KC5a: hypothetical protein; PP_01815; phage(gi90592633) 1e-43 Click
821649421..1649852 PHAGE_Lactob_KC5a: holin; PP_01816; phage(gi90592634) 2e-41 Click
831649864..1650766 PHAGE_Lactob_KC5a: lysin; PP_01817; phage(gi90592635) 2e-137 Click
841651562..1651897 1-acyl-sn-glycerol-3-phosphate acyltransferase [Lactobacillus gasseri ATCC 33323] gi|116628741|ref|YP_813913.1|; PP_01818 1e-57 Click
85complement(1652337..1653440) PHAGE_Lactob_KC5a: integrase; PP_01819; phage(gi90592576) 3e-111 Click
86complement(1653442..1653579) hypothetical; PP_01820 0.0 Click
87complement(1653652..1654278) PHAGE_Lactob_KC5a: hypothetical protein; PP_01821; phage(gi90592577) 8e-68 Click
88complement(1654339..1654791) PHAGE_Lactob_KC5a: hypothetical protein; PP_01822; phage(gi90592578) 5e-47 Click
89complement(1654784..1655134) PHAGE_Lactob_KC5a: putative transcriptional regulator; PP_01823; phage(gi90592579) 6e-15 Click
901655288..1655515 PHAGE_Lactob_KC5a: putative CI-like repressor; PP_01824; phage(gi90592580) 2e-33 Click
911655546..1655875 PHAGE_Lactob_KC5a: hypothetical protein; PP_01825; phage(gi90592581) 2e-51 Click
921655878..1656180 PHAGE_Lactob_KC5a: hypothetical protein; PP_01826; phage(gi90592582) 8e-18 Click
931656174..1656353 hypothetical; PP_01827 0.0 Click
941656388..1656399 attR    AGAAATGAAAAA 0.0 Click
951656392..1656667 PHAGE_Lactob_KC5a: putative recombination protein; PP_01828; phage(gi90592583) 4e-18 Click
961656713..1657039 PHAGE_Lactob_KC5a: hypothetical protein; PP_01829; phage(gi90592584) 2e-56 Click
971657039..1657317 PHAGE_Lactob_KC5a: hypothetical protein; PP_01830; phage(gi90592585) 7e-48 Click
981657323..1658147 PHAGE_Lactob_KC5a: hypothetical protein; PP_01831; phage(gi90592586) 3e-140 Click
991658162..1658383 PHAGE_Staphy_EW: ORF018; PP_01832; phage(gi66395825) 5e-21 Click
1001658380..1659066 PHAGE_Lactob_KC5a: putative phage replication protein; PP_01833; phage(gi90592587) 4e-16 Click
1011659072..1659377 PHAGE_Lactob_KC5a: putative transcriptional regulator; PP_01834; phage(gi90592588) 3e-19 Click
1021659370..1659828 PHAGE_Lactob_KC5a: putative anti-repressor; PP_01835; phage(gi90592591) 3e-75 Click
1031659900..1659919 attR    CAAACGATTTGGTCTCTTAA 0.0 Click
104complement(1660035..1660376) PHAGE_Lactob_KC5a: integrase; PP_01836; phage(gi90592576) 3e-32 Click
105complement(1660376..1660558) PHAGE_Bacill_BCJA1c: integrase; PP_01837; phage(gi56694872) 6e-07 Click
1061660613..1660624 attL    TTTTATTTCATC 0.0 Click
107complement(1660669..1661136) PHAGE_Lactob_KC5a: integrase; PP_01838; phage(gi90592576) 9e-42 Click
108complement(1661138..1661275) hypothetical; PP_01839 0.0 Click
109complement(1661348..1661926) PHAGE_Lactob_KC5a: hypothetical protein; PP_01840; phage(gi90592577) 4e-59 Click
110complement(1662034..1662486) PHAGE_Lactob_KC5a: hypothetical protein; PP_01841; phage(gi90592578) 5e-47 Click
111complement(1662492..1662830) PHAGE_Lactob_KC5a: putative transcriptional regulator; PP_01842; phage(gi90592579) 1e-35 Click
1121662983..1663171 PHAGE_Lactob_KC5a: putative CI-like repressor; PP_01843; phage(gi90592580) 2e-28 Click
1131663240..1663569 PHAGE_Lactob_KC5a: hypothetical protein; PP_01844; phage(gi90592581) 2e-51 Click
1141663572..1663874 PHAGE_Lactob_KC5a: hypothetical protein; PP_01845; phage(gi90592582) 8e-18 Click
1151663868..1664077 hypothetical; PP_01846 0.0 Click
1161664210..1664362 PHAGE_Lactob_KC5a: putative recombination protein; PP_01847; phage(gi90592583) 4e-18 Click
1171664408..1664734 PHAGE_Lactob_KC5a: hypothetical protein; PP_01848; phage(gi90592584) 2e-56 Click
1181664775..1665011 PHAGE_Lactob_KC5a: hypothetical protein; PP_01849; phage(gi90592585) 8e-36 Click
1191665017..1665331 PHAGE_Lactob_KC5a: hypothetical protein; PP_01850; phage(gi90592586) 8e-50 Click
1201665370..1665675 PHAGE_Lactob_KC5a: hypothetical protein; PP_01851; phage(gi90592586) 2e-39 Click
1211665720..1665839 PHAGE_Lactob_KC5a: hypothetical protein; PP_01852; phage(gi90592586) 3e-08 Click
1221665934..1666074 PHAGE_Staphy_EW: ORF018; PP_01853; phage(gi66395825) 2e-11 Click
1231666071..1666307 hypothetical; PP_01854 0.0 Click
1241666491..1666754 PHAGE_Lactob_KC5a: putative phage replication protein; PP_01855; phage(gi90592587) 3e-15 Click
1251666760..1666924 XRE family transcriptional regulator [Lactobacillus gasseri ATCC 33323] gi|116629306|ref|YP_814478.1|; PP_01856 4e-23 Click
1261666945..1667064 PHAGE_Lactob_KC5a: putative transcriptional regulator; PP_01857; phage(gi90592588) 2e-05 Click
1271667278..1667832 PHAGE_Lactob_KC5a: putative anti-repressor; PP_01858; phage(gi90592591) 9e-86 Click
1281667855..1668040 PHAGE_Lactob_KC5a: hypothetical protein; PP_01859; phage(gi90592592) 7e-27 Click
1291668050..1668259 PHAGE_Lactob_KC5a: hypothetical protein; PP_01860; phage(gi90592593) 1e-32 Click
1301668264..1668563 hypothetical; PP_01861 0.0 Click
1311668586..1668699 hypothetical; PP_01862 0.0 Click
1321668703..1668966 hypothetical; PP_01863 0.0 Click
1331669115..1669549 PHAGE_Lactob_KC5a: putative holiday junction resolvase; PP_01864; phage(gi90592597) 2e-71 Click
1341669576..1669740 PHAGE_Lactob_KC5a: hypothetical protein; PP_01865; phage(gi90592598) 7e-12 Click
1351669960..1670091 hypothetical protein LGAS_0655 [Lactobacillus gasseri ATCC 33323] gi|116629315|ref|YP_814487.1|; PP_01866 9e-19 Click
1361670081..1670335 PHAGE_Lactob_KC5a: hypothetical protein; PP_01867; phage(gi90592599) 1e-38 Click
1371670410..1670550 PHAGE_Lactob_KC5a: hypothetical protein; PP_01868; phage(gi90592600) 1e-18 Click
1381670588..1670704 PHAGE_Lactob_KC5a: hypothetical protein; PP_01869; phage(gi90592601) 2e-17 Click
1391670726..1671256 PHAGE_Lactob_KC5a: hypothetical protein; PP_01870; phage(gi90592602) 2e-97 Click
1401671991..1672063 tRNA 0.0 Click
1411672118..1672279 PHAGE_Lactob_KC5a: putative transcriptional regulator; PP_01871; phage(gi90592604) 2e-21 Click
1421672251..1672403 PHAGE_Lactob_KC5a: putative transcriptional regulator; PP_01872; phage(gi90592604) 2e-23 Click
1431672655..1672736 tRNA 0.0 Click
1441672844..1673407 PHAGE_Lactob_KC5a: hypothetical protein; PP_01873; phage(gi90592606) 5e-110 Click
1451673497..1673622 PHAGE_Lactob_KC5a: hypothetical protein; PP_01874; phage(gi90592607) 7e-16 Click
1461673642..1673914 PHAGE_Lactob_KC5a: putative phage terminase large subunit A; PP_01875; phage(gi90592608) 3e-45 Click
1471674353..1674697 PHAGE_Lactob_KC5a: putative phage terminase small subunit; PP_01876; phage(gi90592609) 1e-47 Click
1481674694..1674930 PHAGE_Lactob_KC5a: putative phage terminase small subunit; PP_01877; phage(gi90592609) 9e-17 Click
1491675351..1675530 homing nuclease [Lactobacillus gasseri ATCC 33323] gi|116629324|ref|YP_814496.1|; PP_01878 2e-24 Click
1501675754..1676296 PHAGE_Lactob_KC5a: putative phage terminase large subunit B; PP_01879; phage(gi90592610) 8e-60 Click
1511676296..1676523 PHAGE_Lactob_KC5a: putative phage terminase large subunit B; PP_01880; phage(gi90592610) 2e-11 Click
1521676520..1676696 PHAGE_Lactob_KC5a: putative phage terminase large subunit B; PP_01881; phage(gi90592610) 2e-13 Click
1531676702..1676908 PHAGE_Lactob_KC5a: putative phage terminase large subunit B; PP_01882; phage(gi90592610) 7e-09 Click
1541676899..1677066 PHAGE_Lactob_KC5a: putative phage portal protein; PP_01883; phage(gi90592611) 8e-23 Click
1551677215..1677910 PHAGE_Lactob_KC5a: putative phage portal protein; PP_01884; phage(gi90592611) 2e-130 Click
1561677891..1678307 PHAGE_Lactob_KC5a: putative phage portal protein; PP_01885; phage(gi90592611) 3e-75 Click
1571678297..1678524 PHAGE_Lactob_KC5a: putative phage head protein; PP_01886; phage(gi90592612) 5e-28 Click
1581678521..1678673 PHAGE_Lactob_KC5a: putative phage head protein; PP_01887; phage(gi90592612) 1e-09 Click
1591678658..1679167 PHAGE_Lactob_KC5a: putative phage head protein; PP_01888; phage(gi90592612) 8e-93 Click
1601679164..1679448 PHAGE_Lactob_KC5a: putative phage head protein; PP_01889; phage(gi90592612) 1e-52 Click
1611679623..1679862 PHAGE_Lactob_KC5a: putative phage minor capsid protein; PP_01890; phage(gi90592613) 1e-35 Click
1621679934..1680098 PHAGE_Lactob_KC5a: putative phage minor capsid protein; PP_01891; phage(gi90592613) 2e-10 Click
1631680123..1680269 PHAGE_Lactob_KC5a: putative phage major capsid protein; PP_01892; phage(gi90592614) 9e-19 Click
1641680416..1680895 PHAGE_Lactob_KC5a: putative phage major capsid protein; PP_01893; phage(gi90592614) 3e-84 Click
1651680969..1681175 PHAGE_Lactob_KC5a: putative phage major capsid protein; PP_01894; phage(gi90592614) 9e-28 Click
1661681184..1681573 PHAGE_Lactob_KC5a: hypothetical protein; PP_01895; phage(gi90592615) 7e-33 Click
1671681570..1681932 PHAGE_Lactob_KC5a: hypothetical protein; PP_01896; phage(gi90592616) 9e-65 Click
1681681929..1682363 PHAGE_Lactob_KC5a: hypothetical protein; PP_01897; phage(gi90592617) 3e-81 Click
1691682360..1682767 PHAGE_Lactob_KC5a: hypothetical protein; PP_01898; phage(gi90592618) 9e-73 Click
1701682787..1682969 PHAGE_Lactob_KC5a: hypothetical protein; PP_01899; phage(gi90592619) 2e-27 Click
1711682969..1684306 PHAGE_Lactob_KC5a: putative phage sheath tail protein; PP_01900; phage(gi90592620) 0.0 Click
1721684335..1684805 PHAGE_Lactob_KC5a: putative phage core tail protein; PP_01901; phage(gi90592621) 3e-84 Click
1731685118..1685234 PHAGE_Lactob_KC5a: hypothetical protein; PP_01902; phage(gi90592622) 1e-13 Click
1741685470..1685952 PHAGE_Lactob_KC5a: putative minor tail protein; PP_01903; phage(gi90592623) 1e-62 Click
1751685949..1686350 PHAGE_Lactob_KC5a: putative minor tail protein; PP_01904; phage(gi90592623) 3e-45 Click
1761686386..1687423 PHAGE_Lactob_KC5a: putative minor tail protein; PP_01905; phage(gi90592623) 5e-149 Click
1771687501..1688628 PHAGE_Lactob_KC5a: putative minor tail protein; PP_01906; phage(gi90592623) 0.0 Click
1781688630..1689310 PHAGE_Lactob_KC5a: putative LysM-like protein; PP_01907; phage(gi90592624) 7e-129 Click
1791689441..1690352 PHAGE_Lactob_KC5a: hypothetical protein; PP_01908; phage(gi90592625) 2e-176 Click
1801690355..1690615 PHAGE_Lactob_KC5a: hypothetical protein; PP_01909; phage(gi90592626) 2e-35 Click
1811690694..1691065 PHAGE_Lactob_KC5a: hypothetical protein; PP_01910; phage(gi90592627) 5e-63 Click
1821691062..1691436 PHAGE_Lactob_KC5a: putative tail protein; PP_01911; phage(gi90592628) 6e-64 Click
1831691433..1692212 PHAGE_Lactob_KC5a: putative tail protein; PP_01912; phage(gi90592628) 2e-143 Click
1841692202..1692762 PHAGE_Lactob_KC5a: hypothetical protein; PP_01913; phage(gi90592629) 4e-101 Click
1851692775..1693179 PHAGE_Lactob_KC5a: hypothetical protein; PP_01914; phage(gi90592630) 3e-67 Click
1861693390..1694205 PHAGE_Lactob_KC5a: hypothetical protein; PP_01915; phage(gi90592630) 4e-87 Click
1871694244..1694939 PHAGE_Lactob_KC5a: hypothetical protein; PP_01916; phage(gi90592630) 4e-55 Click
1881694979..1695494 PHAGE_Lactob_KC5a: hypothetical protein; PP_01917; phage(gi90592631) 3e-70 Click
1891695487..1695681 PHAGE_Lactob_KC5a: hypothetical protein; PP_01918; phage(gi90592632) 1e-28 Click
1901696066..1696194 hypothetical; PP_01919 0.0 Click
1911696312..1696464 hypothetical; PP_01920 0.0 Click
1921696446..1696769 PHAGE_Lactob_KC5a: holin; PP_01921; phage(gi90592634) 3e-35 Click
1931696933..1697682 PHAGE_Lactob_KC5a: lysin; PP_01922; phage(gi90592635) 7e-109 Click
1941698759..1699172 1-acyl-sn-glycerol-3-phosphate acyltransferase [Lactobacillus gasseri ATCC 33323] gi|116628741|ref|YP_813913.1|; PP_01923 1e-76 Click
1951699417..1699992 lipopolysaccharide biosynthesis glycosyltransferase [Lactobacillus gasseri ATCC 33323] gi|116628740|ref|YP_813912.1|; PP_01924 1e-107 Click
1961700025..1700975 PHAGE_Archae_BJ1_virus: hypothetical protein BJ1_gp01; PP_01925; phage(gi119756986) 1e-07 Click
1971715304..1715315 attR    TTTTATTTCATC 0.0 Click
1981715957..1715969 attR    ATGTTCAATTTTT 0.0 Click