Proteus penneri ATCC 35198 .1, whole genome [asmbl_id: NC_000000].3747729, GC%: 37.85%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 52 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1581..593 attL    TTTTATTAAGCTT 0.0 Click
211416..11600 PHAGE_Pectob_ZF40: putative integrase; PROPEN_00021; phage(gi422936668) 3e-15 Click
3complement(11709..11882) hypothetical protein; PROPEN_00022 0.0 Click
412568..12579 attL    TAAGTATTTTGA 0.0 Click
5complement(12607..13146) hypothetical protein; PROPEN_00023 0.0 Click
6complement(13295..14167) PHAGE_Yersin_phiR1_37: hypothetical protein; PROPEN_00024; phage(gi358356579) 3e-05 Click
7complement(14326..14622) hypothetical protein; PROPEN_00025 0.0 Click
8complement(14613..14774) hypothetical protein; PROPEN_00026 0.0 Click
9complement(15005..15487) hypothetical protein; PROPEN_00027 0.0 Click
10complement(15650..15886) hypothetical protein; PROPEN_00028 0.0 Click
11complement(16070..16711) hypothetical protein; PROPEN_00029 0.0 Click
12complement(16708..16971) hypothetical protein; PROPEN_00030 0.0 Click
13complement(16956..17207) hypothetical protein; PROPEN_00031 0.0 Click
14complement(17225..17491) PHAGE_Cronob_ENT39118: phage tail protein; PROPEN_00032; phage(gi431811044) 2e-08 Click
15complement(17469..20045) PHAGE_Yersin_PY54: tail protein; PROPEN_00033; phage(gi33770530) 5e-90 Click
16complement(20053..20988) PHAGE_Yersin_PY54: tail protein; PROPEN_00034; phage(gi33770530) 4e-106 Click
17complement(20973..21371) PHAGE_Yersin_PY54: hypothetical protein PY54p19; PROPEN_00035; phage(gi33770528) 5e-25 Click
18complement(21470..21679) hypothetical protein; PROPEN_00036 0.0 Click
19complement(21651..21959) hypothetical protein; PROPEN_00037 0.0 Click
20complement(22528..23109) PHAGE_Yersin_PY54: hypothetical protein PY54p17; PROPEN_00038; phage(gi33770526) 4e-54 Click
21complement(23109..23705) PHAGE_Yersin_PY54: hypothetical protein PY54p16; PROPEN_00039; phage(gi33770525) 4e-44 Click
22complement(23706..24578) PHAGE_Klebsi_KP36: tail length tape-measure protein; PROPEN_00040; phage(gi429216219) 6e-38 Click
23complement(24635..26275) PHAGE_Escher_HK75: tail length tape measure protein; PROPEN_00041; phage(gi356870691) 6e-29 Click
24complement(26293..26697) PHAGE_Acinet_Bphi_B1251: tail tape measure protein; PROPEN_00042; phage(gi423262023) 5e-43 Click
25complement(26669..26980) PHAGE_Burkho_phiE125: putative tail length tape measure protein; PROPEN_00043; phage(gi17975176) 2e-05 Click
2627107..27304 hypothetical protein; PROPEN_00044 0.0 Click
27complement(27322..27600) hypothetical protein; PROPEN_00045 0.0 Click
28complement(27597..28013) hypothetical protein; PROPEN_00046 0.0 Click
29complement(28078..28749) hypothetical protein; PROPEN_00047 0.0 Click
30complement(28753..29094) hypothetical protein; PROPEN_00048 0.0 Click
31complement(29100..29573) PHAGE_Escher_HK75: hypothetical protein; PROPEN_00049; phage(gi356870685) 9e-18 Click
32complement(29557..29892) PHAGE_Geobac_E2: putative head-tail adaptor; PROPEN_00050; phage(gi148747735) 3e-13 Click
33complement(29892..30191) PHAGE_Escher_HK75: hypothetical protein; PROPEN_00051; phage(gi356870683) 2e-33 Click
34complement(30230..31345) PHAGE_Cronob_ENT39118: major capsid protein; PROPEN_00052; phage(gi431811052) 6e-168 Click
35complement(31401..31889) PHAGE_Escher_HK75: prohead protease; PROPEN_00053; phage(gi356870681) 6e-57 Click
36complement(31879..32070) PHAGE_Escher_HK75: prohead protease; PROPEN_00054; phage(gi356870681) 9e-19 Click
37complement(32088..33356) PHAGE_Escher_HK75: portal protein; PROPEN_00055; phage(gi356870680) 0.0 Click
38complement(33356..35050) PHAGE_Tetras_SI1: terminase; PROPEN_00056; phage(gi472342258) 4e-136 Click
39complement(35043..35510) PHAGE_Entero_mEp235: terminase small subunit; PROPEN_00057; phage(gi428781811) 2e-31 Click
40complement(35635..35847) hypothetical protein; PROPEN_00058 0.0 Click
41complement(35850..36188) PHAGE_Escher_HK75: hypothetical protein; PROPEN_00059; phage(gi356870734) 2e-41 Click
42complement(36319..36501) hypothetical protein; PROPEN_00060 0.0 Click
43complement(36507..36881) hypothetical protein; PROPEN_00061 0.0 Click
44complement(36890..37195) hypothetical protein; PROPEN_00062 0.0 Click
45complement(37465..37803) PHAGE_Sodali_phiSG1: putative phage endopeptidase; PROPEN_00063; phage(gi89885988) 2e-14 Click
46complement(37775..37927) hypothetical protein; PROPEN_00064 0.0 Click
47complement(37930..38088) hypothetical protein; PROPEN_00065 0.0 Click
48complement(38070..38540) PHAGE_Salmon_SE1: Gp19; PROPEN_00066; phage(gi219681236) 8e-45 Click
49complement(38540..38809) PHAGE_Salmon_SPN3UB: hypothetical protein; PROPEN_00067; phage(gi423262443) 5e-05 Click
50complement(38875..39297) PHAGE_Klebsi_phiKO2: Gp62; PROPEN_00068; phage(gi46402148) 2e-21 Click
51complement(39803..41455) PHAGE_Thermu_TMA: hypothetical protein; PROPEN_00069; phage(gi343960457) 7e-07 Click
52complement(41455..42123) hypothetical protein; PROPEN_00070 0.0 Click
53complement(42284..42583) hypothetical protein; PROPEN_00071 0.0 Click
5442699..43082 PHAGE_Strept_1: site-specific recombinase; PROPEN_00072; phage(gi28876169) 1e-06 Click
5543243..43254 attR    TAAGTATTTTGA 0.0 Click
5652030..52042 attR    TTTTATTAAGCTT 0.0 Click

Region 2, total : 70 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1475863..1476393) PHAGE_Ralsto_RSL1: unnamed protein product; PROPEN_01951; phage(gi269838886) 7e-07 Click
21476696..1476716 attL    GTGCAAGATATAAGTTACTGA 0.0 Click
3complement(1476757..1476969) hypothetical protein; PROPEN_01952 0.0 Click
41477114..1477233 PHAGE_Yersin_PY54: hypothetical protein PY54p55; PROPEN_01953; phage(gi33770564) 7e-05 Click
51477258..1477524 hypothetical protein; PROPEN_01954 0.0 Click
61477603..1478340 PHAGE_Acanth_moumouvirus: glycosyltransferase family 10; PROPEN_01955; phage(gi441432618) 3e-12 Click
7complement(1478374..1479372) PHAGE_Lactob_1: putative tape measure protein; PROPEN_01956; phage(gi62327110) 2e-05 Click
8complement(1479396..1479749) PHAGE_Burkho_BcepB1A: gp05 H; PROPEN_01957; phage(gi48697553) 1e-17 Click
9complement(1479755..1480411) PHAGE_Burkho_BcepB1A: gp07; PROPEN_01958; phage(gi48697555) 3e-40 Click
10complement(1480408..1480905) PHAGE_Burkho_BcepB1A: gp08 W; PROPEN_01959; phage(gi48697556) 4e-34 Click
11complement(1480955..1481596) PHAGE_Burkho_BcepB1A: gp08 W; PROPEN_01960; phage(gi48697556) 5e-31 Click
12complement(1481589..1481885) PHAGE_Burkho_BcepB1A: gp09; PROPEN_01961; phage(gi48697557) 2e-05 Click
13complement(1481932..1482624) PHAGE_Burkho_BcepB1A: gp10 V; PROPEN_01962; phage(gi48697558) 2e-35 Click
14complement(1482627..1482896) PHAGE_Burkho_BcepB1A: gp11; PROPEN_01963; phage(gi48697559) 3e-08 Click
15complement(1482887..1483420) PHAGE_Burkho_BcepB1A: gp11; PROPEN_01964; phage(gi48697559) 8e-26 Click
16complement(1483410..1483727) PHAGE_Burkho_BcepB1A: gp12; PROPEN_01965; phage(gi48697560) 1e-09 Click
17complement(1483727..1484296) PHAGE_Burkho_BcepB1A: gp13; PROPEN_01966; phage(gi48697561) 3e-12 Click
18complement(1484259..1484735) PHAGE_Burkho_BcepB1A: gp14 T; PROPEN_01967; phage(gi72257065) 1e-07 Click
19complement(1484722..1484955) hypothetical protein; PROPEN_01968 0.0 Click
20complement(1484952..1486556) PHAGE_Burkho_BcepB1A: gp14 T; PROPEN_01969; phage(gi72257065) 9e-25 Click
21complement(1486642..1487100) PHAGE_Burkho_BcepB1A: gp15 E; PROPEN_01970; phage(gi48697505) 5e-28 Click
22complement(1487141..1487593) PHAGE_Burkho_BcepB1A: gp16; PROPEN_01971; phage(gi48697506) 3e-27 Click
23complement(1487604..1488362) PHAGE_Burkho_BcepF1: hypothetical protein BcepF1.111; PROPEN_01972; phage(gi126011045) 2e-46 Click
24complement(1488442..1489092) PHAGE_Pseudo_F8: hypothetical protein ORF029; PROPEN_01973; phage(gi149408343) 2e-20 Click
25complement(1489101..1489616) PHAGE_Pseudo_KPP12: hypothetical protein; PROPEN_01974; phage(gi431811109) 1e-04 Click
26complement(1489603..1489974) PHAGE_Burkho_BcepB1A: gp19; PROPEN_01975; phage(gi48697509) 5e-08 Click
27complement(1489974..1490252) PHAGE_Pectob_ZF40: hypothetical protein; PROPEN_01976; phage(gi422936689) 7e-05 Click
28complement(1490249..1490431) PHAGE_Burkho_BcepB1A: gp20; PROPEN_01977; phage(gi48697510) 2e-08 Click
29complement(1490431..1490862) PHAGE_Burkho_BcepB1A: gp21; PROPEN_01978; phage(gi48697511) 1e-13 Click
30complement(1490865..1491206) PHAGE_Burkho_BcepB1A: gp22; PROPEN_01979; phage(gi48697512) 5e-11 Click
31complement(1491276..1492343) PHAGE_Burkho_BcepB1A: gp23; PROPEN_01980; phage(gi48697513) 1e-55 Click
32complement(1492343..1492840) PHAGE_Burkho_BcepB1A: gp24; PROPEN_01981; phage(gi48697514) 1e-08 Click
33complement(1492840..1493607) PHAGE_Pseudo_SN: structural protein; PROPEN_01982; phage(gi218457824) 8e-17 Click
34complement(1493640..1494104) PHAGE_Burkho_BcepB1A: gp26; PROPEN_01983; phage(gi48697515) 3e-26 Click
35complement(1494101..1494313) PHAGE_Burkho_BcepB1A: gp27; PROPEN_01984; phage(gi48697516) 2e-13 Click
36complement(1494354..1494815) PHAGE_Burkho_BcepB1A: gp27; PROPEN_01985; phage(gi48697516) 1e-15 Click
37complement(1494853..1496208) PHAGE_Pseudo_NH_4: putative minor head protein; PROPEN_01986; phage(gi418488465) 1e-103 Click
38complement(1496358..1497125) PHAGE_Aeromo_vB_AsaM_56: putative TerL large-subunit terminase; PROPEN_01987; phage(gi422937532) 2e-69 Click
39complement(1497139..1497756) PHAGE_Haemop_Aaphi23: putative terminase large subunit TerL; PROPEN_01988; phage(gi31544028) 1e-44 Click
40complement(1497955..1498974) PHAGE_Burkho_Bcep22: Bcep22gp36; PROPEN_01989; phage(gi158997725) 2e-50 Click
41complement(1499044..1499235) PHAGE_Entero_phiP27: hypothetical protein P27p33; PROPEN_01990; phage(gi18249897) 2e-11 Click
42complement(1499267..1499491) PHAGE_Bacter_2: hypothetical protein APSE214; PROPEN_01991; phage(gi212499719) 4e-15 Click
43complement(1499551..1499811) hypothetical protein; PROPEN_01992 0.0 Click
44complement(1499814..1499972) hypothetical protein; PROPEN_01993 0.0 Click
45complement(1499954..1500124) PHAGE_Escher_D108: Lys; PROPEN_01994; phage(gi281199665) 4e-13 Click
46complement(1500126..1500428) PHAGE_Entero_HK225: lysozyme; PROPEN_01995; phage(gi428782444) 3e-20 Click
47complement(1500428..1500691) hypothetical protein; PROPEN_01996 0.0 Click
481500963..1501169 hypothetical protein; PROPEN_01997 0.0 Click
491501211..1501582 PHAGE_Pectob_ZF40: hypothetical protein; PROPEN_01998; phage(gi422936670) 6e-20 Click
501501982..1502347 PHAGE_Pectob_ZF40: putative integrase; PROPEN_01999; phage(gi422936668) 1e-13 Click
51complement(1502530..1502799) PHAGE_Stx2_c_1717: antiterminator Q protein; PROPEN_02000; phage(gi209447165) 3e-13 Click
52complement(1502774..1503064) PHAGE_Entero_HK629: late gene regulator Q; PROPEN_02001; phage(gi428782072) 4e-17 Click
53complement(1503052..1503363) PHAGE_Burkho_Bcep22: Bcep22gp20; PROPEN_02002; phage(gi38640327) 8e-14 Click
54complement(1503375..1503968) PHAGE_Entero_mEp237: hypothetical protein; PROPEN_02003; phage(gi435439315) 7e-59 Click
55complement(1504046..1504384) PHAGE_Pectob_ZF40: hypothetical protein; PROPEN_02004; phage(gi422936662) 7e-35 Click
56complement(1504424..1504975) PHAGE_Entero_P1: PmgT; PROPEN_02005; phage(gi46401715) 5e-39 Click
57complement(1505004..1505237) PHAGE_Pectob_ZF40: hypothetical protein; PROPEN_02006; phage(gi422936657) 6e-09 Click
58complement(1505240..1505416) hypothetical protein; PROPEN_02007 0.0 Click
59complement(1505413..1506810) PHAGE_Salmon_SPN9CC: replicative DNA helicase; PROPEN_02008; phage(gi389060513) 2e-102 Click
60complement(1506803..1507396) PHAGE_Entero_mEpX1: putative replication protein DnaC; PROPEN_02009; phage(gi428781919) 2e-46 Click
61complement(1507389..1507661) PHAGE_Entero_mEpX1: DNA replication protein O; PROPEN_02010; phage(gi428781918) 5e-06 Click
62complement(1507658..1508257) PHAGE_Entero_phiP27: hypothetical protein P27p17; PROPEN_02011; phage(gi18249881) 7e-46 Click
63complement(1508275..1508484) PHAGE_Pectob_ZF40: hypothetical protein; PROPEN_02012; phage(gi422936653) 3e-11 Click
64complement(1508502..1508957) PHAGE_Pectob_ZF40: putative cII repressor; PROPEN_02013; phage(gi422936652) 7e-32 Click
65complement(1509005..1509253) PHAGE_Gifsy_2: putative bacteriophage regulatory protein; Lambda gpCro analog; PROPEN_02014; phage(gi169257277) 5e-06 Click
661509470..1510114 PHAGE_Entero_HK022: regulatory protein cI; PROPEN_02015; phage(gi19343388) 4e-28 Click
671510844..1511176 PHAGE_Pectob_ZF40: hypothetical protein; PROPEN_02016; phage(gi422936648) 5e-08 Click
681511176..1511403 hypothetical protein; PROPEN_02017 0.0 Click
691511450..1512481 PHAGE_Pectob_ZF40: putative exonuclease; PROPEN_02018; phage(gi422936647) 5e-34 Click
701512495..1513415 PHAGE_Pectob_ZF40: putative exonuclease; PROPEN_02019; phage(gi422936647) 1e-94 Click
711513415..1513762 PHAGE_Pectob_ZF40: hypothetical protein; PROPEN_02020; phage(gi422936646) 6e-28 Click
721516597..1516617 attR    GTGCAAGATATAAGTTACTGA 0.0 Click

Region 3, total : 67 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1775024..1775353) PHAGE_Staphy_PH15: putative cI-like repressor; PROPEN_02367; phage(gi119967867) 3e-05 Click
21776013..1776321 PHAGE_Staphy_PH15: putative cI-like repressor; PROPEN_02368; phage(gi119967867) 1e-05 Click
31776961..1777018 attL    ATTGATTTTAAATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAGG 0.0 Click
41777184..1778191 PHAGE_Erwini_PEp14: putative integrase; PROPEN_02369; phage(gi374531881) 2e-17 Click
51778226..1778363 hypothetical protein; PROPEN_02370 0.0 Click
61778611..1778775 hypothetical protein; PROPEN_02371 0.0 Click
71778796..1778936 PHAGE_Escher_HK639: DNA pol III theta; PROPEN_02372; phage(gi356870660) 1e-05 Click
8complement(1779020..1779418) hypothetical protein; PROPEN_02373 0.0 Click
9complement(1779489..1780523) PHAGE_Entero_phiEco32: putative tail fiber; PROPEN_02374; phage(gi167583569) 2e-59 Click
10complement(1780525..1780833) hypothetical protein; PROPEN_02375 0.0 Click
11complement(1780896..1784252) PHAGE_Yersin_PY54: tail protein; PROPEN_02376; phage(gi33770530) 0.0 Click
12complement(1784253..1784375) hypothetical protein; PROPEN_02377 0.0 Click
13complement(1784416..1784652) PHAGE_Yersin_PY54: hypothetical protein PY54p19; PROPEN_02378; phage(gi33770528) 1e-15 Click
14complement(1784732..1784983) hypothetical protein; PROPEN_02379 0.0 Click
15complement(1784997..1785578) PHAGE_Yersin_PY54: hypothetical protein PY54p17; PROPEN_02380; phage(gi33770526) 3e-51 Click
16complement(1785575..1786030) PHAGE_Yersin_PY54: hypothetical protein PY54p16; PROPEN_02381; phage(gi33770525) 1e-37 Click
17complement(1786175..1788514) PHAGE_Entero_mEp390: tail length tape measure protein; PROPEN_02382; phage(gi428782677) 1e-32 Click
18complement(1788474..1789397) PHAGE_Roseob_1: tail tape measure protein; PROPEN_02383; phage(gi331028134) 4e-24 Click
19complement(1789487..1790092) PHAGE_Klebsi_phiKO2: putative tail assembly chaperone; PROPEN_02384; phage(gi46402100) 2e-32 Click
20complement(1790092..1790565) PHAGE_Klebsi_phiKO2: major tail shaft subunit; PROPEN_02385; phage(gi46402098) 2e-60 Click
21complement(1790577..1790981) PHAGE_Yersin_PY54: hypothetical protein PY54p11; PROPEN_02386; phage(gi33770519) 3e-35 Click
22complement(1790978..1791478) PHAGE_Yersin_PY54: hypothetical protein PY54p10; PROPEN_02387; phage(gi33770518) 7e-32 Click
23complement(1791688..1791990) PHAGE_Entero_SfV: hypothetical protein SfVp06; PROPEN_02388; phage(gi19548996) 5e-17 Click
24complement(1792077..1792319) PHAGE_Entero_SfV: capsid; PROPEN_02389; phage(gi19548995) 3e-32 Click
25complement(1792303..1793313) PHAGE_Entero_SfV: capsid; PROPEN_02390; phage(gi19548995) 3e-108 Click
26complement(1793323..1793928) PHAGE_Entero_SfV: capsid protease; PROPEN_02391; phage(gi19548994) 2e-88 Click
27complement(1793918..1795150) PHAGE_Entero_SfV: portal protein; PROPEN_02392; phage(gi19548993) 0.0 Click
28complement(1795140..1795301) hypothetical protein; PROPEN_02393 0.0 Click
29complement(1795298..1796920) PHAGE_Entero_SfV: large terminase subunit; PROPEN_02394; phage(gi19548992) 0.0 Click
30complement(1797124..1797420) PHAGE_Klebsi_phiKO2: putative small terminase subunit; PROPEN_02395; phage(gi46402087) 2e-11 Click
31complement(1797646..1797993) PHAGE_Entero_SfV: hypothetical protein SfVp53; PROPEN_02396; phage(gi19549040) 6e-46 Click
32complement(1798059..1798181) hypothetical protein; PROPEN_02397 0.0 Click
33complement(1798142..1798462) hypothetical protein; PROPEN_02398 0.0 Click
34complement(1798994..1799209) hypothetical protein; PROPEN_02399 0.0 Click
35complement(1799285..1799470) PHAGE_Salmon_ST64B: lysis protein; PROPEN_02400; phage(gi23505497) 5e-06 Click
36complement(1799751..1799909) hypothetical protein; PROPEN_02401 0.0 Click
37complement(1799891..1800361) PHAGE_Entero_HK225: lysozyme; PROPEN_02402; phage(gi428782444) 5e-44 Click
38complement(1800361..1800624) hypothetical protein; PROPEN_02403 0.0 Click
391800770..1800910 hypothetical protein; PROPEN_02404 0.0 Click
40complement(1801014..1801202) hypothetical protein; PROPEN_02405 0.0 Click
41complement(1801268..1801432) PHAGE_Entero_mEp237: hypothetical protein; PROPEN_02406; phage(gi435439326) 4e-15 Click
42complement(1801545..1801763) hypothetical protein; PROPEN_02407 0.0 Click
43complement(1801923..1802075) hypothetical protein; PROPEN_02408 0.0 Click
441802084..1802425 hypothetical protein; PROPEN_02409 0.0 Click
45complement(1802728..1803507) PHAGE_Cronob_ENT39118: antitermination protein; PROPEN_02410; phage(gi431811056) 2e-69 Click
46complement(1803567..1804559) PHAGE_Entero_SfV: hypothetical protein SfVp45; PROPEN_02411; phage(gi19549032) 2e-58 Click
47complement(1804559..1805266) PHAGE_Cronob_ENT47670: phage antirepressor protein; PROPEN_02412; phage(gi431810509) 3e-59 Click
48complement(1805436..1805666) PHAGE_Entero_SfV: crossover junction endodeoxyribonuclease; PROPEN_02413; phage(gi19549030) 8e-14 Click
49complement(1805740..1806132) hypothetical protein; PROPEN_02414 0.0 Click
50complement(1806129..1806452) PHAGE_Entero_SfV: DNA adenine methylase; PROPEN_02415; phage(gi19549028) 2e-38 Click
51complement(1806765..1807271) PHAGE_Entero_mEp237: DNA replication protein O; PROPEN_02416; phage(gi435439307) 2e-25 Click
52complement(1807255..1807887) PHAGE_Entero_mEp390: hypothetical protein; PROPEN_02417; phage(gi428782706) 2e-54 Click
53complement(1807897..1808076) hypothetical protein; PROPEN_02418 0.0 Click
54complement(1808066..1808197) hypothetical protein; PROPEN_02419 0.0 Click
55complement(1808334..1808792) PHAGE_Entero_mEp390: hypothetical protein; PROPEN_02420; phage(gi428782704) 1e-27 Click
56complement(1808844..1809077) PHAGE_Salmon_SPN3UB: putative Cro; PROPEN_02421; phage(gi423262425) 2e-10 Click
571809152..1809871 PHAGE_Salmon_ST160: C2; PROPEN_02422; phage(gi318065925) 1e-28 Click
581809997..1810200 hypothetical protein; PROPEN_02423 0.0 Click
591810537..1810911 PHAGE_Entero_SfV: hypothetical protein SfVp32; PROPEN_02424; phage(gi19549019) 5e-33 Click
601810977..1811804 PHAGE_Entero_SfV: hypothetical protein SfVp31; PROPEN_02425; phage(gi19549018) 7e-81 Click
611811863..1812360 PHAGE_Salmon_epsilon34: SSB; Single-strand binding protein; PROPEN_02426; phage(gi221328653) 1e-52 Click
621812376..1812639 hypothetical protein; PROPEN_02427 0.0 Click
631812642..1812923 hypothetical protein; PROPEN_02428 0.0 Click
641812965..1813291 hypothetical protein; PROPEN_02429 0.0 Click
651813328..1813609 hypothetical protein; PROPEN_02430 0.0 Click
661813609..1814061 PHAGE_Salmon_SPN1S: hypothetical protein; PROPEN_02431; phage(gi374531240) 2e-11 Click
671814064..1814285 hypothetical protein; PROPEN_02432 0.0 Click
681814305..1814745 PHAGE_Pectob_ZF40: putative methylase; PROPEN_02433; phage(gi422936660) 9e-50 Click
691815060..1815117 attR    ATTGATTTTAAATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAGG 0.0 Click

Region 4, total : 60 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12886915..2886926 attL    TATAATTCATAA 0.0 Click
22888641..2889003 PHAGE_Lactoc_949: putative ribonucleotide diphosphate reductase alpha subunit; PROPEN_03879; phage(gi327197952) 1e-08 Click
32888975..2889364 hypothetical protein; PROPEN_03880 0.0 Click
4complement(2889496..2890002) PHAGE_Aeromo_phiO18P: putative integrase; PROPEN_03881; phage(gi148727179) 3e-36 Click
5complement(2890049..2890486) PHAGE_Salmon_RE_2010: integrase; PROPEN_03882; phage(gi418489683) 8e-19 Click
6complement(2890553..2890852) PHAGE_Entero_P2: gpC; PROPEN_03883; phage(gi9630358) 7e-18 Click
72890954..2891214 PHAGE_Entero_P2: Cox; PROPEN_03884; phage(gi9630359) 1e-21 Click
82891211..2891411 hypothetical protein; PROPEN_03885 0.0 Click
92891398..2891580 hypothetical protein; PROPEN_03886 0.0 Click
10complement(2891677..2891847) hypothetical protein; PROPEN_03887 0.0 Click
112892006..2892018 attL    TTGTTATTGTTTC 0.0 Click
122892052..2892447 PHAGE_Salmon_RE_2010: hypothetical protein; PROPEN_03888; phage(gi418489688) 5e-06 Click
132892465..2892722 hypothetical protein; PROPEN_03889 0.0 Click
142892715..2892936 PHAGE_Erwini_ENT90: hypothetical protein; PROPEN_03890; phage(gi431810989) 3e-13 Click
152892938..2893765 PHAGE_Salmon_RE_2010: DNA adenine methyltransferase; PROPEN_03891; phage(gi418489691) 5e-60 Click
162893765..2894088 hypothetical protein; PROPEN_03892 0.0 Click
172894088..2895149 PHAGE_Yersin_413C: gpA; PROPEN_03893; phage(gi30065742) 5e-68 Click
182895121..2896065 PHAGE_Entero_P2: gpA; PROPEN_03894; phage(gi9630366) 7e-90 Click
192896188..2896469 hypothetical protein; PROPEN_03895 0.0 Click
202896588..2897259 hypothetical protein; PROPEN_03896 0.0 Click
21complement(2897336..2897686) hypothetical protein; PROPEN_03897 0.0 Click
22complement(2898230..2899258) PHAGE_Salmon_RE_2010: capsid packaging protein; PROPEN_03898; phage(gi418489696) 2e-136 Click
23complement(2899258..2901012) PHAGE_Salmon_RE_2010: terminase ATPase subunit; PROPEN_03899; phage(gi418489697) 0.0 Click
242901187..2901996 PHAGE_Salmon_RE_2010: capsid scaffolding protein; PROPEN_03900; phage(gi418489698) 3e-62 Click
252902049..2903803 PHAGE_Salmon_RE_2010: major capsid protein; PROPEN_03901; phage(gi418489699) 2e-120 Click
262903878..2904333 PHAGE_Salmon_RE_2010: head completion-stabilization protein; PROPEN_03902; phage(gi418489701) 4e-32 Click
272904333..2904539 PHAGE_Burkho_phiE202: gp46, phage Tail Protein X; PROPEN_03903; phage(gi134288782) 2e-16 Click
282904559..2904873 PHAGE_Cronob_ENT47670: phage holin; PROPEN_03904; phage(gi431810538) 2e-18 Click
292904987..2905271 PHAGE_Cronob_vB_CsaM_GAP161: putative endolysin; PROPEN_03905; phage(gi414086235) 2e-26 Click
302905268..2905420 hypothetical protein; PROPEN_03906 0.0 Click
312905368..2905667 hypothetical protein; PROPEN_03907 0.0 Click
322905746..2906186 PHAGE_Salmon_RE_2010: tail protein; PROPEN_03908; phage(gi418489706) 9e-34 Click
332906173..2906451 PHAGE_Burkho_phiE202: gp39, phage virion morphogenesis protein; PROPEN_03909; phage(gi134288746) 6e-09 Click
342906572..2906733 PHAGE_Pseudo_phiCTX: predicted tail completion; PROPEN_03910; phage(gi17313233) 2e-05 Click
352906875..2907501 PHAGE_Erwini_ENT90: baseplate assembly protein; PROPEN_03911; phage(gi431810950) 2e-50 Click
362907498..2907836 PHAGE_Erwini_ENT90: baseplate assembly protein; PROPEN_03912; phage(gi431810974) 3e-27 Click
372907838..2908746 PHAGE_Salmon_RE_2010: baseplate assembly protein J; PROPEN_03913; phage(gi418489711) 2e-106 Click
382908739..2909350 PHAGE_Salmon_RE_2010: tail protein I; PROPEN_03914; phage(gi418489712) 4e-69 Click
392909340..2910971 PHAGE_Salmon_RE_2010: tail fiber protein; PROPEN_03915; phage(gi418489713) 2e-60 Click
402911068..2912240 PHAGE_Salmon_RE_2010: major tail sheath protein; PROPEN_03916; phage(gi418489720) 9e-165 Click
412912244..2912759 PHAGE_Salmon_RE_2010: major tail tube protein; PROPEN_03917; phage(gi418489721) 4e-55 Click
422912764..2913126 PHAGE_Salmon_RE_2010: tail protein E; PROPEN_03918; phage(gi418489722) 2e-22 Click
432913133..2913261 PHAGE_Salmon_RE_2010: tail protein E'; PROPEN_03919; phage(gi418489723) 7e-05 Click
442913254..2913955 PHAGE_Salmon_RE_2010: tail tape measure protein; PROPEN_03920; phage(gi418489724) 2e-45 Click
452913963..2914205 PHAGE_Vibrio_vB_VpaM_MAR: tail length tape-measure protein; PROPEN_03921; phage(gi428782750) 8e-14 Click
462914249..2916117 PHAGE_Vibrio_vB_VpaM_MAR: tail length tape-measure protein; PROPEN_03922; phage(gi428782750) 3e-49 Click
472916117..2916581 PHAGE_Salmon_RE_2010: tail protein; PROPEN_03923; phage(gi418489725) 3e-46 Click
482916581..2917678 PHAGE_Salmon_RE_2010: gene D protein; PROPEN_03924; phage(gi418489726) 4e-119 Click
492917731..2917949 PHAGE_Salmon_RE_2010: OGR regulator of late gene transcription; PROPEN_03925; phage(gi418489727) 5e-21 Click
502918142..2918363 hypothetical protein; PROPEN_03926 0.0 Click
512918336..2918863 hypothetical protein; PROPEN_03927 0.0 Click
522918941..2919207 PHAGE_Clostr_st: putative IS transposase (OrfA); PROPEN_03928; phage(gi80159862) 4e-05 Click
532919238..2920215 PHAGE_Klebsi_KP27: cytosine-specific methyltransferase; PROPEN_03929; phage(gi448260666) 1e-28 Click
542920512..2920838 hypothetical protein; PROPEN_03930 0.0 Click
55complement(2921111..2921752) hypothetical protein; PROPEN_03931 0.0 Click
562921957..2922487 hypothetical protein; PROPEN_03932 0.0 Click
572922521..2923021 hypothetical protein; PROPEN_03933 0.0 Click
582923214..2924122 hypothetical protein; PROPEN_03934 0.0 Click
592924239..2924427 hypothetical protein; PROPEN_03935 0.0 Click
602924415..2925572 PHAGE_Sweet_virus: coat protein; PROPEN_03936; phage(gi326537260) 6e-05 Click
612925639..2927090 hypothetical protein; PROPEN_03937 0.0 Click
62complement(2927201..2927632) PROPHAGE_Pseudo_PAO1: bacteriophage integrase; PROPEN_03938; phage(gi15595925) 6e-06 Click
632930063..2930075 attR    TTGTTATTGTTTC 0.0 Click
642930217..2930228 attR    TATAATTCATAA 0.0 Click