Octadecabacter antarcticus 238 whole genome [asmbl_id: NC_000000].5368816, GC%: 55.21%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1203308..1204387) PROPHAGE_Shewan_MR-1: ISSod5, transposase; PP_01410; phage(gi24373965) 9e-15 Click
21204700..1204876 hypothetical; PP_01411 0.0 Click
31204910..1205614 PROPHAGE_Escher_CFT073: transposase; PP_01412; phage(gi26248352) 7e-06 Click
4complement(1205801..1206490) PHAGE_Synech_S_RIP1: hypothetical protein; PP_01413; phage(gi472342936) 2e-05 Click
5complement(1206580..1207284) PHAGE_Synech_S_SKS1: hypothetical protein; PP_01414; phage(gi472340847) 2e-15 Click
6complement(1207488..1207958) PROPHAGE_Escher_CFT073: transposase insF; PP_01415; phage(gi26250329) 2e-30 Click
7complement(1208064..1208342) PROPHAGE_Mesorh_MAFF303099: transposase; PP_01416; phage(gi13475314) 4e-13 Click
81208483..1208638 transposase IS66 [Rhizobium leguminosarum bv. trifolii WSM1325] gi|241113231|ref|YP_002973066.1|; PP_01417 1e-10 Click
91208899..1210026 transposase [Thioflavicoccus mobilis 8321] gi|431932606|ref|YP_007245652.1|; PP_01418 2e-46 Click
10complement(1210127..1210243) hypothetical; PP_01419 0.0 Click
11complement(1210406..1210810) PROPHAGE_Escher_CFT073: transposase; PP_01420; phage(gi26246249) 7e-16 Click

Region 2, total : 32 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11369375..1371765 PHAGE_Pseudo_vB_PaeS_PMG1: tail tape measure protein; PP_01633; phage(gi374531664) 8e-58 Click
21371762..1372361 PHAGE_Yersin_PY54: hypothetical protein PY54p16; PP_01634; phage(gi33770525) 4e-06 Click
31372358..1372918 PHAGE_Yersin_PY54: hypothetical protein PY54p17; PP_01635; phage(gi33770526) 3e-13 Click
41372920..1373042 hypothetical; PP_01636 0.0 Click
51373253..1373660 PHAGE_Yersin_PY54: hypothetical protein PY54p19; PP_01637; phage(gi33770528) 2e-07 Click
61373664..1374206 PHAGE_Entero_mEpX2: tail assembly protein; PP_01638; phage(gi428765633) 1e-08 Click
71374314..1376038 PHAGE_Yersin_PY54: tail protein; PP_01639; phage(gi33770530) 3e-07 Click
8complement(1376043..1376219) hypothetical; PP_01640 0.0 Click
9complement(1376265..1376555) plasmid stabilization system protein [Pseudomonas syringae pv. syringae B728a] gi|66047060|ref|YP_236901.1|; PP_01641 9e-31 Click
10complement(1376545..1376790) PHAGE_Mycoba_Fruitloop: gp42; PP_01642; phage(gi206599922) 7e-05 Click
111376892..1377203 PHAGE_Rhodob_RcapNL: hypothetical protein; PP_01643; phage(gi461474983) 1e-30 Click
121377292..1377519 hypothetical; PP_01644 0.0 Click
131377626..1378558 PHAGE_Salmon_ViI: Gp5-tail associated lysozyme; PP_01645; phage(gi326804576) 5e-22 Click
141378555..1378812 hypothetical; PP_01646 0.0 Click
151378936..1379298 hypothetical; PP_01647 0.0 Click
161379295..1379501 hypothetical; PP_01648 0.0 Click
171379591..1380616 PROPHAGE_Salmon_Ty2: variable tail fiber protein; PP_01649; phage(gi29143754) 3e-35 Click
181380695..1380985 PHAGE_Prochl_P_HM2: baseplate wedge initiator; PP_01650; phage(gi326783066) 2e-07 Click
191380988..1381770 PHAGE_Entero_Phi1: gp38 distal long tail fiber adhesin; PP_01651; phage(gi157311379) 1e-13 Click
201381852..1382277 PHAGE_Microm_MpV1: hypothetical protein; PP_01652; phage(gi313768277) 4e-06 Click
211382274..1382930 hypothetical; PP_01653 0.0 Click
22complement(1382985..1383515) helix-hairpin-helix DNA-binding protein [Thioalkalimicrobium cyclicum ALM1] gi|334143625|ref|YP_004536781.1|; PP_01654 5e-40 Click
23complement(1383515..1383802) hypothetical protein RSKD131_4109 [Rhodobacter sphaeroides KD131] gi|221369946|ref|YP_002521042.1|; PP_01655 7e-15 Click
241383894..1384793 PHAGE_Entero_HK022: IS903 transposase; PP_01656; phage(gi9634149) 7e-39 Click
25complement(1385025..1385144) hypothetical; PP_01657 0.0 Click
26complement(1385186..1385746) PROPHAGE_Escher_CFT073: transposase; PP_01658; phage(gi26246249) 4e-13 Click
27complement(1385750..1386433) PROPHAGE_Escher_CFT073: transposase; PP_01659; phage(gi26246249) 3e-05 Click
28complement(1386511..1386633) hypothetical; PP_01660 0.0 Click
29complement(1386995..1387117) hypothetical; PP_01661 0.0 Click
301387210..1387575 PHAGE_Entero_HK022: IS903 transposase; PP_01662; phage(gi9634149) 9e-16 Click
311387650..1388192 PHAGE_Entero_HK022: IS903 transposase; PP_01663; phage(gi9634149) 6e-14 Click
32complement(1388321..1389469) PROPHAGE_Pseudo_KT2440: transposase, putative; PP_01664; phage(gi26991145) 5e-09 Click

Region 3, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2211317..2212330) PROPHAGE_Lactoc_Il1403: transposase of IS904H; PP_02627; phage(gi15674055) 8e-13 Click
2complement(2212327..2212809) hypothetical protein DAMO_1006 [Candidatus Methylomirabilis oxyfera] gi|392374073|ref|YP_003205906.1|; PP_02628 1e-23 Click
32213070..2213213 hypothetical; PP_02629 0.0 Click
42213474..2214394 PHAGE_Megavi_chiliensis: putative Sel1-like repeat-containing protein; PP_02630; phage(gi363540607) 8e-28 Click
52214560..2215042 hypothetical protein DAMO_1006 [Candidatus Methylomirabilis oxyfera] gi|392374073|ref|YP_003205906.1|; PP_02631 1e-23 Click
62215039..2215602 PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfB; PP_02632; phage(gi24373866) 1e-05 Click
7complement(2215603..2215980) PROPHAGE_Brucel_1330: transposase, putative; PP_02633; phage(gi23502708) 3e-42 Click
8complement(2215985..2216185) PROPHAGE_Brucel_1330: transposase, putative; PP_02634; phage(gi23502708) 8e-20 Click
9complement(2216230..2216790) PROPHAGE_Escher_CFT073: transposase; PP_02635; phage(gi26246249) 4e-13 Click
10complement(2216794..2217477) transposase, mutator type [Leptospirillum ferrooxidans C2-3] gi|383783368|ref|YP_005467934.1|; PP_02636 2e-69 Click
11complement(2217568..2217702) PROPHAGE_Brucel_1330: transposase, putative; PP_02637; phage(gi23502708) 1e-07 Click
122217741..2218025 PHAGE_Ralsto_phiRSA1: transposase IRSO15-like; PP_02638; phage(gi145708108) 7e-07 Click
132218130..2218273 hypothetical; PP_02639 0.0 Click
142218469..2219083 putative response regulator receiver protein [Dinoroseobacter shibae DFL 12] gi|159044443|ref|YP_001533237.1|; PP_02640 2e-58 Click
15complement(2219202..2219333) hypothetical; PP_02641 0.0 Click
162219670..2220128 PHAGE_Cyanop_PSS2: phage tail protein; PP_02642; phage(gi254729476) 1e-07 Click
172220492..2220911 PHAGE_Hypert_2: IS element Dka2 orfA; PP_02643; phage(gi300116744) 5e-15 Click
18complement(2221292..2221534) hypothetical protein Nham_4292 [Nitrobacter hamburgensis X14] gi|92109439|ref|YP_571727.1|; PP_02644 4e-18 Click
192221668..2222150 hypothetical protein DAMO_1006 [Candidatus Methylomirabilis oxyfera] gi|392374073|ref|YP_003205906.1|; PP_02645 3e-23 Click
202222147..2223160 PROPHAGE_Lactoc_Il1403: transposase of IS904H; PP_02646; phage(gi15674055) 3e-13 Click

Region 4, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2326770..2327783) PHAGE_Lactoc_P087: putative cysteine synthase; PP_02786; phage(gi229605000) 5e-05 Click
2complement(2327810..2327926) hypothetical; PP_02787 0.0 Click
32328255..2329502 PROPHAGE_Escher_CFT073: transposase; PP_02788; phage(gi26246249) 2e-24 Click
4complement(2329634..2330044) PHAGE_Entero_HK022: IS903 transposase; PP_02789; phage(gi9634149) 2e-19 Click
5complement(2330168..2330449) PHAGE_Entero_HK022: IS903 transposase; PP_02790; phage(gi9634149) 2e-11 Click
62330726..2330983 PROPHAGE_Brucel_1330: IS5 family transposase orfB; PP_02791; phage(gi23501423) 5e-13 Click
72331113..2332123 PROPHAGE_Mesorh_MAFF303099: transposase; PP_02792; phage(gi13474791) 7e-06 Click
8complement(2332105..2332335) hypothetical; PP_02793 0.0 Click
9complement(2332332..2332814) hypothetical protein DAMO_1006 [Candidatus Methylomirabilis oxyfera] gi|392374073|ref|YP_003205906.1|; PP_02794 3e-23 Click
102333039..2334265 ROK family transcriptional regulator [Sorangium cellulosum So ce56] gi|162455949|ref|YP_001618316.1|; PP_02795 1e-36 Click
112334289..2336124 PHAGE_Lactob_KC5a: putative minor tail protein; PP_02796; phage(gi90592623) 6e-07 Click

Region 5, total : 10 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12780164..2781051 PROPHAGE_Escher_CFT073: transposase; PP_03303; phage(gi26250984) 3e-09 Click
22781400..2782110 PHAGE_Synech_RSM4: structral protein; PP_03304; phage(gi255928960) 6e-11 Click
32782091..2783071 PHAGE_Spirop_R8A2B: putative transposase; PP_03305; phage(gi9626114) 5e-12 Click
42783068..2785536 PHAGE_Prochl_SSM4: YadA domain-containing structural protein; PP_03306; phage(gi61806289) 2e-13 Click
5complement(2785775..2785945) hypothetical; PP_03307 0.0 Click
62785984..2786181 hypothetical; PP_03308 0.0 Click
72786199..2786384 hypothetical; PP_03309 0.0 Click
82786482..2787441 PHAGE_Sinorh_PBC5: hypothetical protein PBC5p66; PP_03310; phage(gi18071235) 4e-07 Click
92787450..2787905 hypothetical protein HELO_1528 [Halomonas elongata DSM 2581] gi|307544117|ref|YP_003896596.1|; PP_03311 7e-34 Click
102787911..2789905 PHAGE_Lactob_Lj771: minor tail protein gp26-like protein; PP_03312; phage(gi163932195) 6e-05 Click

Region 6, total : 29 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13584276..3584788 PROPHAGE_Shewan_MR-1: ISSod10, transposase OrfA; PP_04258; phage(gi24371809) 4e-08 Click
23585016..3585339 transposase [Gluconacetobacter diazotrophicus PAl 5] gi|209545468|ref|YP_002277697.1|; PP_04259 5e-27 Click
33585378..3585851 PHAGE_Strept_6: terminase large subunit; PP_04260; phage(gi93007440) 5e-08 Click
43585879..3586703 PHAGE_Strept_6: terminase large subunit; PP_04261; phage(gi93007440) 2e-48 Click
53586838..3588031 PHAGE_Xantho_OP1: putative head portal protein; PP_04262; phage(gi84662598) 3e-19 Click
63588024..3588242 hypothetical protein KVU_0651 [Ketogulonicigenium vulgare WSH-001] gi|385233144|ref|YP_005794486.1|; PP_04263 4e-16 Click
73588365..3588796 PHAGE_Azospi_Cd: phage head maturation protease; PP_04264; phage(gi168495135) 3e-25 Click
83588835..3588972 hypothetical; PP_04265 0.0 Click
93588969..3589157 HK97 family major capsid protein [Ruegeria pomeroyi DSS-3] gi|56697123|ref|YP_167486.1|; PP_04266 3e-16 Click
103589147..3590019 PHAGE_Azospi_Cd: Phage major capsid protein; PP_04267; phage(gi168495136) 1e-57 Click
113590192..3590791 PHAGE_Rhodob_RcapNL: hypothetical protein; PP_04268; phage(gi461474967) 3e-09 Click
123590791..3591126 head-tail adaptor [Ruegeria pomeroyi DSS-3] gi|56697121|ref|YP_167484.1|; PP_04269 4e-29 Click
133591123..3591536 PHAGE_Strept_phiSASD1: gp33; PP_04270; phage(gi298103498) 1e-05 Click
143591585..3592001 PHAGE_Rhodob_RcapNL: gene transfer aget (GTA) orfg9-like phage major tail protein; PP_04271; phage(gi461474972) 9e-22 Click
153592091..3592339 hypothetical protein Rsph17025_1083 [Rhodobacter sphaeroides ATCC 17025] gi|146277130|ref|YP_001167289.1|; PP_04272 6e-24 Click
163592336..3592563 hypothetical protein RCAP_rcc01693 [Rhodobacter capsulatus SB 1003] gi|294677230|ref|YP_003577845.1|; PP_04273 6e-16 Click
173592556..3593215 PHAGE_Shigel_EP23: phage tail length tape-measure protein 1; PP_04274; phage(gi371496286) 1e-13 Click
183593230..3593862 PHAGE_Roseob_1: putative glycoside hydrolase; PP_04275; phage(gi331028135) 2e-45 Click
193593859..3594743 PHAGE_Roseob_1: gene transfer agent; PP_04276; phage(gi331028136) 1e-55 Click
203594740..3595177 PHAGE_Rhodob_RcapMu: putative tail assembly protein; PP_04277; phage(gi356870891) 7e-05 Click
213595225..3597168 PHAGE_Caulob_CcrSwift: putative tail protein; PP_04278; phage(gi414089681) 1e-21 Click
223597277..3597639 PHAGE_Hypert_2: IS element Dka2 orfA; PP_04279; phage(gi300116744) 9e-10 Click
233597730..3598740 PROPHAGE_Mesorh_MAFF303099: transposase; PP_04280; phage(gi13474791) 1e-05 Click
243598847..3600499 PHAGE_Caulob_CcrColossus: putative tail protein; PP_04281; phage(gi414088178) 5e-14 Click
253600505..3600801 PHAGE_phiJL001: gp86; PP_04282; phage(gi62327193) 2e-07 Click
263600798..3601097 hypothetical protein RCAP_rcc01699 [Rhodobacter capsulatus SB 1003] gi|294677236|ref|YP_003577851.1|; PP_04283 6e-08 Click
273601175..3601984 serine O-acetyltransferase [Rhodobacter sphaeroides ATCC 17025] gi|146277138|ref|YP_001167297.1|; PP_04284 3e-113 Click
28complement(3602140..3603480) dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex [Phaeobacter gallaeciensis 2.10] gi|400754611|ref|YP_006562979.1|; PP_04285 3e-180 Click
29complement(3603493..3604869) PHAGE_Synech_S_SM2: transketolase central region-containing protein; PP_04286; phage(gi326781943) 3e-10 Click

Region 7, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13927771..3927783 attL    GAAACTGCGTTTC 0.0 Click
23931372..3931387 attL    CTGTCTCTCCGCCAAT 0.0 Click
3complement(3935581..3935994) PHAGE_Stx2_c_1717: transposase; PP_04681; phage(gi209447152) 2e-36 Click
4complement(3935991..3936371) transposase IS3/IS911 family protein [Rhodomicrobium vannielii ATCC 17100] gi|312114529|ref|YP_004012125.1|; PP_04682 4e-07 Click
5complement(3936488..3937192) PHAGE_Megavi_chiliensis: putative Sel1-like repeat-containing protein; PP_04683; phage(gi363540607) 6e-16 Click
6complement(3938368..3939777) PHAGE_Vibrio_11895_B1: hypothetical protein; PP_04684; phage(gi472340012) 4e-05 Click
73940912..3941460 PHAGE_Sodali_phiSG1: resolvase; PP_04685; phage(gi89886020) 2e-29 Click
83941480..3941974 PHAGE_Rhodov_RS1: hypothetical protein; PP_04686; phage(gi472342875) 8e-30 Click
9complement(3942334..3943869) PHAGE_Yersin_phiR1_37: exonuclease ABC C subunit; PP_04687; phage(gi358356634) 5e-29 Click
103944274..3944393 hypothetical; PP_04688 0.0 Click
11complement(3944410..3944706) hypothetical; PP_04689 0.0 Click
123946263..3946430 hypothetical; PP_04690 0.0 Click
133946417..3947244 PHAGE_Tricho_2c: hypothetical protein TNAV2c_gp071; PP_04691; phage(gi116326757) 8e-13 Click
14complement(3947739..3947885) hypothetical protein GM21_1257 [Geobacter sp. M21] gi|253699887|ref|YP_003021076.1|; PP_04692 1e-06 Click
15complement(3947907..3948545) hypothetical protein Thivi_1556 [Thiocystis violascens DSM 198] gi|390949913|ref|YP_006413672.1|; PP_04693 1e-35 Click
16complement(3948608..3949000) hypothetical; PP_04694 0.0 Click
17complement(3949401..3950843) PROPHAGE_Shewan_MR-1: protease DegS; PP_04695; phage(gi24375431) 5e-11 Click
18complement(3951024..3951488) hypothetical protein Mchl_3319 [Methylobacterium extorquens CM4] gi|218531266|ref|YP_002422082.1|; PP_04696 1e-11 Click
19complement(3951618..3951908) hypothetical protein Sinme_0135 [Sinorhizobium meliloti AK83] gi|334314902|ref|YP_004547521.1|; PP_04697 3e-08 Click
20complement(3952007..3952201) PHAGE_Entero_P4: transcriptional regulator; PP_04698; phage(gi9627517) 4e-07 Click
21complement(3953100..3954323) PROPHAGE_Escher_CFT073: P4 family integrase; PP_04699; phage(gi26248244) 3e-72 Click
223954444..3954459 attR    CTGTCTCTCCGCCAAT 0.0 Click
233954678..3955097 PHAGE_Clostr_st: putative IS transposase (OrfA); PP_04700; phage(gi80159868) 2e-19 Click
243955162..3955932 hypothetical protein RD1_2485 [Roseobacter denitrificans OCh 114] gi|110679726|ref|YP_682733.1|; PP_04701 8e-81 Click
253955995..3957278 PROPHAGE_Escher_CFT073: transposase; PP_04702; phage(gi26246249) 4e-12 Click
263957381..3957878 PROPHAGE_Escher_Sakai: putative integrase; PP_04703; phage(gi15834496) 3e-07 Click
273966320..3966332 attR    GAAACTGCGTTTC 0.0 Click

Region 8, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14105824..4105835 attL    TTCTGCCATCGC 0.0 Click
24106018..4107124 PHAGE_Pseudo_phi297: integrase; PP_04879; phage(gi374531312) 4e-05 Click
3complement(4107317..4108297) PROPHAGE_Mesorh_MAFF303099: transposase; PP_04880; phage(gi13474791) 1e-05 Click
4complement(4108388..4108741) PROPHAGE_Escher_CFT073: transposase insF; PP_04881; phage(gi26249410) 4e-27 Click
5complement(4108788..4109261) PHAGE_Lactob_phiAT3: putative transposase B; PP_04882; phage(gi48697274) 3e-13 Click
6complement(4109258..4109554) PROPHAGE_Xantho_33913: ISxac3 transposase; PP_04883; phage(gi21231087) 3e-09 Click
74109672..4109878 hypothetical; PP_04884 0.0 Click
8complement(4110194..4110850) hypothetical protein YM304_40240 [Acidimicrobidae bacterium YM16-304] gi|470180232|ref|YP_007566276.1|; PP_04885 1e-74 Click
9complement(4111191..4112234) transposase IS116/IS110/IS902 family protein [Geodermatophilus obscurus DSM 43160] gi|284989025|ref|YP_003407579.1|; PP_04886 9e-84 Click
104112493..4112987 hypothetical protein Rsph17025_0730 [Rhodobacter sphaeroides ATCC 17025] gi|146276782|ref|YP_001166941.1|; PP_04887 1e-59 Click
11complement(4113436..4114449) PROPHAGE_Lactoc_Il1403: transposase of IS904H; PP_04888; phage(gi15674055) 5e-14 Click
12complement(4114446..4114928) hypothetical protein DAMO_1006 [Candidatus Methylomirabilis oxyfera] gi|392374073|ref|YP_003205906.1|; PP_04889 1e-23 Click
134115039..4115158 integrase catalytic subunit [Rhodobacter sphaeroides ATCC 17025] gi|146277474|ref|YP_001167633.1|; PP_04890 2e-05 Click
144115191..4115652 integrase catalytic subunit [Rhodobacter sphaeroides ATCC 17025] gi|146277474|ref|YP_001167633.1|; PP_04891 8e-59 Click
154115755..4115949 hypothetical; PP_04892 0.0 Click
164115942..4116706 hypothetical; PP_04893 0.0 Click
17complement(4116725..4117324) PROPHAGE_Lactoc_Il1403: transposase of IS904H; PP_04894; phage(gi15674055) 1e-10 Click
184117396..4117821 hypothetical protein Rsph17025_0730 [Rhodobacter sphaeroides ATCC 17025] gi|146276782|ref|YP_001166941.1|; PP_04895 5e-47 Click
194118265..4118879 PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfB; PP_04896; phage(gi24373866) 9e-09 Click
204119082..4119378 PROPHAGE_Xantho_33913: ISxac3 transposase; PP_04897; phage(gi21231087) 3e-09 Click
214119375..4120274 PHAGE_Lactob_phiAT3: putative transposase B; PP_04898; phage(gi48697274) 1e-44 Click
224120332..4121165 PROPHAGE_Lactoc_Il1403: transposase of IS904H; PP_04899; phage(gi15674055) 4e-14 Click
234121243..4121368 hypothetical; PP_04900 0.0 Click
244121649..4121843 hypothetical; PP_04901 0.0 Click
254122038..4123909 PHAGE_Bacill_SPBc2: ABC transporter; PP_04902; phage(gi9630145) 2e-21 Click
264128916..4128927 attR    TTCTGCCATCGC 0.0 Click

Region 9, total : 13 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14138049..4138120 attL    GGCTCTTCTCCGCTTTGTTGAGTTATTCTAGGATTTCAAATAGAACATAGATTGATTATCTGGGATGGATGA 0.0 Click
24141793..4142899 PHAGE_Pseudo_phi297: integrase; PP_04919; phage(gi374531312) 4e-05 Click
3complement(4143068..4144444) carbohydrate kinases [Roseobacter denitrificans OCh 114] gi|110680265|ref|YP_683272.1|; PP_04920 4e-154 Click
4complement(4144441..4144758) putative L-rhamnose 1-epimerase [Sinorhizobium fredii HH103] gi|378824884|ref|YP_005187616.1|; PP_04921 3e-38 Click
5complement(4144755..4145780) PHAGE_Lactob_Lj771: minor tail protein gp26-like protein; PP_04922; phage(gi163932195) 5e-07 Click
6complement(4145777..4146757) ribose ABC transporter permease [Roseobacter denitrificans OCh 114] gi|110680268|ref|YP_683275.1|; PP_04923 9e-153 Click
7complement(4146754..4147596) PHAGE_Plankt_PaV_LD: ABC transporter; PP_04924; phage(gi371496158) 1e-12 Click
84147726..4148238 PROPHAGE_Shewan_MR-1: ISSod10, transposase OrfA; PP_04925; phage(gi24371809) 4e-08 Click
94148466..4148789 transposase [Gluconacetobacter diazotrophicus PAl 5] gi|209545468|ref|YP_002277697.1|; PP_04926 5e-27 Click
10complement(4148782..4149201) PHAGE_Plankt_PaV_LD: ABC transporter; PP_04927; phage(gi371496158) 2e-07 Click
11complement(4149265..4150290) PHAGE_Spirop_R8A2B: putative transposase; PP_04928; phage(gi9626114) 1e-12 Click
12complement(4150339..4150476) ribose transport ATP-binding protein [Roseobacter denitrificans OCh 114] gi|110680269|ref|YP_683276.1|; PP_04929 3e-15 Click
134150493..4150654 hypothetical; PP_04930 0.0 Click
144150675..4150746 attR    GGCTCTTCTCCGCTTTGTTGAGTTATTCTAGGATTTCAAATAGAACATAGATTGATTATCTGGGATGGATGA 0.0 Click
15complement(4150702..4151934) PHAGE_Ralsto_phiRSA1: transposase IRSO15-like; PP_04931; phage(gi145708108) 3e-48 Click

Region 10, total : 7 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15363918..5364214 PROPHAGE_Xantho_33913: ISxac3 transposase; PP_06394; phage(gi21231087) 3e-09 Click
25364211..5364795 PROPHAGE_Escher_CFT073: transposase insF; PP_06395; phage(gi26249410) 2e-23 Click
35364835..5364969 hypothetical; PP_06396 0.0 Click
4complement(5364924..5365709) PROPHAGE_Xantho_306: transposase; PP_06397; phage(gi21243165) 8e-65 Click
5complement(5365740..5366885) PROPHAGE_Escher_MG1655: IS30 transposase; PP_06398; phage(gi16132105) 1e-43 Click
6complement(5366937..5367227) PROPHAGE_Escher_CFT073: transposase insI; PP_06399; phage(gi26250328) 1e-19 Click
75367227..5368072 PHAGE_Celeri_P12053L: putative phage tail fiber protein; PP_06400; phage(gi399528893) 3e-06 Click