Mycobacterium tuberculosis T92 .1, whole genome shotgun [asmbl_id: NC_000000].4260358, GC%: 65.13%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1479054..1479827) PHAGE_Ectoca_1: EsV-1-65; PP_01609; phage(gi13242537) 1e-06 Click
2complement(1480009..1480500) transposase [Mycobacterium tuberculosis KZN 605] gi|392433377|ref|YP_006474421.1|; PP_01610 1e-92 Click
3complement(1480466..1481152) PHAGE_Burkho_KS9: tail length tape measure protein gp13; PP_01611; phage(gi255033744) 1e-05 Click
4complement(1481186..1481509) unnamed protein product [Mycobacterium tuberculosis UT205] gi|392385744|ref|YP_005307373.1|; PP_01612 2e-56 Click
5complement(1481635..1481919) ESAT-6 like protein ESXV [Mycobacterium tuberculosis RGTB423] gi|386006435|ref|YP_005924714.1|; PP_01613 1e-47 Click
6complement(1481946..1482200) esxJ [Mycobacterium tuberculosis UT205] gi|392385746|ref|YP_005307375.1|; PP_01614 4e-41 Click
7complement(1482388..1483521) PHAGE_Pectob_My1: YadA domain-containing protein; PP_01615; phage(gi410491156) 2e-08 Click
8complement(1483640..1484467) PHAGE_Cronob_vB_CsaP_GAP52: hypothetical protein; PP_01616; phage(gi414087485) 5e-07 Click
91485028..1485276 hypothetical protein MRGA423_06495 [Mycobacterium tuberculosis RGTB423] gi|386004041|ref|YP_005922320.1|; PP_01617 1e-43 Click
10complement(1485255..1485494) hypothetical protein K60_011160 [Mycobacterium bovis BCG str. Korea 1168P] gi|449063091|ref|YP_007430174.1|; PP_01618 4e-41 Click
11complement(1485663..1486100) PROPHAGE_Brucel_1330: ISBm1, transposase orfB; PP_01619; phage(gi23501425) 5e-11 Click
12complement(1486183..1486581) PROPHAGE_Shewan_MR-1: ISSod6, transposase; PP_01620; phage(gi24374783) 1e-16 Click

Region 2, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12319272..2320717 PHAGE_Lactob_Lj771: minor tail protein gp26-like protein; PP_02496; phage(gi163932195) 6e-05 Click
22320878..2322452 PHAGE_Emilia_86: hypothetical protein EhV204; PP_02497; phage(gi73852674) 2e-12 Click
32322449..2323669 hypothetical protein MRGA423_11260 [Mycobacterium tuberculosis RGTB423] gi|386004757|ref|YP_005923036.1|; PP_02498 0.0 Click
42323666..2325498 PHAGE_Acanth_moumouvirus: stage V sporulation protein K; PP_02499; phage(gi441432154) 7e-14 Click
5complement(2325828..2326712) PHAGE_Burkho_phiE125: ISBt3 transposase subunit protein; PP_02500; phage(gi17975200) 8e-85 Click
6complement(2326763..2327089) PHAGE_Entero_4795: putative transposase OrfA protein of IS629; PP_02501; phage(gi157166066) 8e-20 Click
72327435..2327626 lppT [Mycobacterium tuberculosis UT205] gi|392386457|ref|YP_005308086.1|; PP_02502 9e-28 Click
82327729..2329696 PHAGE_Cercop_2: transcriptional regulator ICP4; PP_02503; phage(gi56694796) 5e-05 Click
92330277..2331530 PHAGE_Roseob_SIO1: gp7; PP_02504; phage(gi9964615) 2e-05 Click
102331527..2332432 PHAGE_Erwini_PEp14: hypothetical protein; PP_02505; phage(gi374531873) 7e-05 Click
11complement(2332429..2334456) PHAGE_Human__2: EBNA-1; PP_02506; phage(gi139424506) 6e-64 Click
12complement(2334604..2334930) PHAGE_Mycoba_Ramsey: gp56; PP_02507; phage(gi206600237) 3e-05 Click
132335300..2335422 hypothetical; PP_02508 0.0 Click
142335731..2336705 PHAGE_Gifsy_2: bacteriophage side tail fiber protein; Lambda gpStf (gpN) homolog; PP_02509; phage(gi169257320) 5e-06 Click
15complement(2336828..2336947) hypothetical; PP_02510 0.0 Click
162337071..2338258 PHAGE_Celeri_P12053L: putative phage tail fiber protein; PP_02511; phage(gi399528893) 1e-05 Click
172338390..2338776 PE20 [Mycobacterium tuberculosis UT205] gi|392386464|ref|YP_005308093.1|; PP_02512 5e-34 Click
182338791..2340068 PHAGE_Roseob_SIO1: gp7; PP_02513; phage(gi9964615) 1e-06 Click
192340035..2341195 PHAGE_Celeri_P12053L: putative phage tail fiber protein; PP_02514; phage(gi399528893) 1e-05 Click
202341327..2342739 PHAGE_Pseudo_MP38: putative tail component protein; PP_02515; phage(gi215479964) 1e-06 Click
212343032..2343346 PHAGE_Mycoba_Ramsey: gp56; PP_02516; phage(gi206600237) 3e-10 Click

Region 3, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13228210..3228221 attL    ACGCTCTCCCAC 0.0 Click
23228539..3229123 PHAGE_Mycoba_BPs: integrase; PP_03514; phage(gi189043119) 2e-47 Click
33229137..3229583 PHAGE_Staphy_EW: ORF013; PP_03515; phage(gi66395820) 5e-11 Click
4complement(3230005..3230613) PHAGE_Rhodoc_REQ1: putative capsid protein; PP_03516; phage(gi372450101) 2e-29 Click
5complement(3231087..3231614) phiRv1 phage protein, partial [Mycobacterium tuberculosis RGTB327] gi|383307428|ref|YP_005360239.1|; PP_03517 1e-80 Click
6complement(3231621..3232133) PHAGE_Rhodoc_RRH1: caudovirus prohead protease family protein; PP_03518; phage(gi372449807) 1e-07 Click
73232260..3232315 attL    GCGGATGCCGAGATGCCAAACTCGATTGTATCACACACAAAAGGTCATCACCGGTC 0.0 Click
8complement(3232307..3232777) PHAGE_Nocard_NBR1: terminase small subunit; PP_03519; phage(gi372217587) 4e-24 Click
9complement(3232858..3233172) phiRv1 phage protein [Mycobacterium tuberculosis RGTB423] gi|386004557|ref|YP_005922836.1|; PP_03520 9e-55 Click
10complement(3233169..3233441) phiRv1 phage protein [Mycobacterium tuberculosis RGTB423] gi|386004558|ref|YP_005922837.1|; PP_03521 1e-47 Click
11complement(3233455..3233850) Probable PhiRv1 phage protein [Mycobacterium tuberculosis H37Rv] gi|15608719|ref|NP_216097.1|; PP_03522 2e-72 Click
12complement(3234046..3235464) PHAGE_Mycoba_CrimD: gp71; PP_03523; phage(gi304360923) 1e-63 Click
13complement(3235461..3235745) phiRv1 phage protein [Mycobacterium tuberculosis RGTB423] gi|386004560|ref|YP_005922839.1|; PP_03524 5e-51 Click
14complement(3236026..3236247) hypothetical protein MT3573.1 [Mycobacterium tuberculosis CDC1551] gi|15843064|ref|NP_338101.1|; PP_03525 4e-33 Click
15complement(3236303..3236818) phiRv1 prophage protein [Mycobacterium tuberculosis RGTB423] gi|386004562|ref|YP_005922841.1|; PP_03526 1e-100 Click
16complement(3236815..3238206) PHAGE_Strept_R4: recombinase, serine integrase type; PP_03527; phage(gi414090037) 2e-41 Click
173252403..3252458 attR    GCGGATGCCGAGATGCCAAACTCGATTGTATCACACACAAAAGGTCATCACCGGTC 0.0 Click
183253026..3253037 attR    ACGCTCTCCCAC 0.0 Click