Escherichia coli O157:H7 str. TW14588 , whole [asmbl_id: NC_000000].5670297, GC%: 50.46%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 45 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
141537..42289 PHAGE_Emilia_86: hypothetical protein EhV364; ESCCO14588_2570; phage(gi73852838) 1e-09 Click
2complement(42414..42683) PHAGE_Stx2_c_II: putative tail fiber protein; ESCCO14588_2569; phage(gi302393091) 2e-43 Click
3complement(42685..42963) PHAGE_Escher_TL_2011c: putative tail fiber protein; ESCCO14588_2568; phage(gi418487108) 2e-47 Click
442915..43775 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip024; ESCCO14588_2567; phage(gi20065820) 8e-29 Click
543934..44062 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; ESCCO14588_2566; phage(gi157166059) 8e-19 Click
6complement(44063..44662) PHAGE_Stx2_c_1717: outer membrane protein Lom precursor; ESCCO14588_2565; phage(gi209447197) 9e-113 Click
7complement(44730..48203) PHAGE_Entero_HK630: tail fiber J; ESCCO14588_2564; phage(gi428782808) 0.0 Click
848154..48864 PHAGE_Salmon_1: hypothetical bacteriophage protein; ESCCO14588_2563; phage(gi169257202) 3e-60 Click
9complement(49055..49636) PHAGE_Stx2_c_1717: putative tail component; ESCCO14588_2562; phage(gi209447195) 8e-106 Click
10complement(49633..50376) PHAGE_Entero_4795: putative tail fiber component; ESCCO14588_2561; phage(gi157166055) 2e-144 Click
11complement(50387..51085) PHAGE_Entero_HK630: minor tail protein L; ESCCO14588_2560; phage(gi428782805) 3e-103 Click
12complement(51085..51414) PHAGE_Entero_HK630: minor tail protein M; ESCCO14588_2559; phage(gi428782804) 4e-48 Click
13complement(51411..53990) PHAGE_Entero_HK630: tail length tape measure protein H; ESCCO14588_2558; phage(gi428782803) 0.0 Click
14complement(53971..54360) PHAGE_Entero_HK630: tail assembly protein GT; ESCCO14588_2557; phage(gi428782802) 4e-43 Click
15complement(54411..54842) PHAGE_Entero_HK630: minor tail protein G; ESCCO14588_2556; phage(gi428782801) 5e-45 Click
16complement(54856..55518) PHAGE_Entero_HK630: major tail protein V; ESCCO14588_2555; phage(gi428782800) 5e-97 Click
17complement(55578..55844) PHAGE_Entero_HK630: major head subunit E; ESCCO14588_2554; phage(gi428782795) 2e-20 Click
18complement(55902..56249) PHAGE_Entero_HK630: head decoration protein D; ESCCO14588_2553; phage(gi428782794) 6e-25 Click
19complement(56286..57791) PHAGE_Entero_HK630: head maturation protease C; ESCCO14588_2552; phage(gi428782792) 4e-108 Click
20complement(57781..59373) PHAGE_Entero_HK630: portal protein B; ESCCO14588_2551; phage(gi428782791) 0.0 Click
21complement(59370..59576) PHAGE_Entero_HK630: head-tail connector W; ESCCO14588_2550; phage(gi428782790) 1e-11 Click
22complement(59560..61488) PHAGE_Entero_HK630: terminase large subunit A; ESCCO14588_2549; phage(gi428782789) 0.0 Click
23complement(61460..61603) PHAGE_Entero_mEp237: terminase small subunit nu1; ESCCO14588_2548; phage(gi435439266) 9e-05 Click
2461602..61718 hypothetical protein; ESCCO14588_2547 0.0 Click
25complement(61752..63290) PHAGE_Stx2_c_1717: transposase; ESCCO14588_2546; phage(gi209447153) 0.0 Click
26complement(63340..63687) PHAGE_Stx2_c_1717: transposase; ESCCO14588_2545; phage(gi209447152) 2e-62 Click
27complement(64140..64415) conserved hypothetical protein; ESCCO14588_2544 0.0 Click
28complement(64997..65158) conserved hypothetical protein; ESCCO14588_2543 0.0 Click
2965166..65372 PHAGE_Stx2_c_1717: holin protein S-like protein; ESCCO14588_2542; phage(gi209447171) 3e-31 Click
30complement(65628..65942) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp06; ESCCO14588_2541; phage(gi116221998) 4e-18 Click
3166060..66593 PHAGE_Entero_2008: putative endolysin; ESCCO14588_2540; phage(gi209427769) 2e-99 Click
3266814..66927 hypothetical protein; ESCCO14588_2539 0.0 Click
3366929..67396 PHAGE_Entero_4795: putative endopeptidase Rz; ESCCO14588_2538; phage(gi157166036) 1e-73 Click
3467479..67619 conserved hypothetical protein; ESCCO14588_2537 0.0 Click
35complement(67732..67860) conserved hypothetical protein; ESCCO14588_2536 0.0 Click
36complement(68382..69035) PHAGE_Stx2_c_1717: transposase; ESCCO14588_2535; phage(gi209447179) 1e-62 Click
37complement(69032..69358) PHAGE_Stx2_c_II: putative transposase; ESCCO14588_2534; phage(gi302393161) 1e-58 Click
38complement(69534..71384) PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ESCCO14588_2533; phage(gi209427766) 0.0 Click
39complement(71873..71951) tRNA 0.0 Click
40complement(71963..72041) tRNA 0.0 Click
41complement(72048..72123) tRNA 0.0 Click
42complement(72152..72541) putative envelope protein encoded within prophage CP-933N; ESCCO14588_2529 0.0 Click
4372668..72781 hypothetical protein; ESCCO14588_2528 0.0 Click
4472756..72896 hypothetical protein; ESCCO14588_2527 0.0 Click
45complement(73486..74304) abortive infection protein; ESCCO14588_2525 0.0 Click
46complement(74456..74827) PHAGE_Entero_2008: antitermination protein Q; ESCCO14588_2524; phage(gi209427762) 4e-54 Click
47complement(74817..75188) PHAGE_Escher_HK75: RusA-like protein; ESCCO14588_2523; phage(gi356870726) 1e-36 Click
48complement(75201..76250) PHAGE_Entero_mEp460: hypothetical protein; ESCCO14588_2522; phage(gi428782365) 8e-112 Click

Region 2, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1194621..194634 attL    GCATTTTATCTGCC 0.0 Click
2complement(198284..199207) PHAGE_Entero_4795: putative major head protein/prohead protease; ESCCO14588_2407; phage(gi157166041) 1e-14 Click
3complement(199197..199358) gp80; ESCCO14588_2406 0.0 Click
4complement(199370..199858) PHAGE_Stx2_c_1717: phage terminase, small subunit; ESCCO14588_2405; phage(gi209447178) 9e-34 Click
5complement(199988..200149) putative transcription antitermination protein NusG; ESCCO14588_2404 0.0 Click
6complement(200153..200347) hypothetical protein; ESCCO14588_2403 0.0 Click
7complement(200478..200729) conserved hypothetical protein; ESCCO14588_2402 0.0 Click
8complement(201016..202770) PHAGE_Entero_P4: DNA primase; ESCCO14588_2401; phage(gi9627512) 5e-93 Click
9complement(202767..203066) conserved hypothetical protein; ESCCO14588_2400 0.0 Click
10complement(203072..203314) conserved hypothetical protein; ESCCO14588_2399 0.0 Click
11complement(203304..203495) PHAGE_Salmon_1: hypothetical protein STM0898.6n.Fels1; ESCCO14588_2398; phage(gi169257169) 3e-08 Click
12complement(203499..203684) conserved hypothetical protein; ESCCO14588_2397 0.0 Click
13complement(203677..203880) conserved hypothetical protein; ESCCO14588_2396 0.0 Click
14204026..204208 conserved hypothetical protein; ESCCO14588_2395 0.0 Click
15complement(204347..204571) PHAGE_Entero_P4: transcriptional regulator; ESCCO14588_2394; phage(gi9627517) 2e-08 Click
16complement(204663..205436) hypothetical protein; ESCCO14588_2393 0.0 Click
17complement(205433..206656) PHAGE_Salmon_vB_SosS_Oslo: integrase; ESCCO14588_2392; phage(gi399528791) 1e-49 Click
18207061..207285 PHAGE_Lactoc_bIL312: Csp; ESCCO14588_2391; phage(gi13095918) 3e-14 Click
19complement(207358..209304) PHAGE_Plankt_PaV_LD: ABC transporter; ESCCO14588_2390; phage(gi371496158) 4e-40 Click
20214309..214322 attR    GCATTTTATCTGCC 0.0 Click

Region 3, total : 42 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1321339..321350 attL    AGGCGAAGTCAT 0.0 Click
2complement(332364..333245) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp23; ESCCO14588_2268; phage(gi148609405) 7e-156 Click
3complement(334073..335065) non-LEE encoded type III effector C; ESCCO14588_2267 0.0 Click
4complement(335126..336106) PHAGE_Salmon_ST64B: hypothetical protein sb26; ESCCO14588_2266; phage(gi23505470) 3e-90 Click
5complement(336283..336552) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp22; ESCCO14588_2265; phage(gi148609404) 1e-46 Click
6complement(336554..337870) PHAGE_Entero_cdtI: putative tail fiber protein; ESCCO14588_2264; phage(gi148609402) 0.0 Click
7complement(337930..338529) PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; ESCCO14588_2263; phage(gi148609401) 3e-104 Click
8complement(338600..342013) PHAGE_Entero_cdtI: putative tail tip assembly protein; ESCCO14588_2262; phage(gi148609400) 0.0 Click
9complement(342074..342586) PHAGE_Entero_cdtI: putative tail component; ESCCO14588_2261; phage(gi148609399) 7e-86 Click
10complement(342619..343362) PHAGE_Entero_cdtI: putative tail protein; ESCCO14588_2260; phage(gi148609398) 3e-142 Click
11complement(343368..344066) PHAGE_Entero_cdtI: putative minor tail protein; ESCCO14588_2259; phage(gi148609397) 9e-136 Click
12complement(344076..344405) PHAGE_Entero_cdtI: putative minor tail protein; ESCCO14588_2258; phage(gi148609396) 2e-61 Click
13complement(344405..347470) PHAGE_Entero_cdtI: putative tail protein; ESCCO14588_2257; phage(gi148609395) 0.0 Click
14complement(347442..347759) PHAGE_Entero_cdtI: putative minor tail protein; ESCCO14588_2256; phage(gi148609394) 1e-56 Click
15complement(347780..348166) PHAGE_Entero_cdtI: putative tail component; ESCCO14588_2255; phage(gi148609393) 5e-65 Click
16complement(348227..348970) PHAGE_Entero_cdtI: putative major tail subunit; ESCCO14588_2254; phage(gi148609392) 4e-137 Click
17complement(348981..349382) PHAGE_Entero_cdtI: putative tail component; ESCCO14588_2253; phage(gi148609391) 8e-73 Click
18complement(349379..349957) PHAGE_Entero_cdtI: putative tail component; ESCCO14588_2252; phage(gi148609390) 2e-103 Click
19complement(349969..350244) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp07; ESCCO14588_2251; phage(gi148609389) 6e-39 Click
20complement(350237..350560) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp06; ESCCO14588_2250; phage(gi148609388) 2e-54 Click
21complement(350647..352605) PHAGE_Entero_cdtI: putative protease/scaffold protein; ESCCO14588_2249; phage(gi148609387) 0.0 Click
22complement(352619..352981) PHAGE_Entero_cdtI: putative portal protein; ESCCO14588_2248; phage(gi148609386) 3e-66 Click
23complement(353076..354128) PHAGE_Entero_cdtI: putative portal protein; ESCCO14588_2247; phage(gi148609386) 0.0 Click
24complement(354128..354340) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp03; ESCCO14588_2246; phage(gi148609385) 8e-35 Click
25complement(354337..356439) PHAGE_Entero_cdtI: putative large terminase subunit; ESCCO14588_2245; phage(gi148609384) 0.0 Click
26complement(356439..356930) PHAGE_Entero_mEp460: terminase small subunit; terminase,; phage small subunit; ESCCO14588_2244(gi428782317) 5e-74 Click
27complement(357605..357757) PHAGE_Entero_mEp460: hypothetical protein; ESCCO14588_2243; phage(gi428782374) 1e-21 Click
28complement(357745..358212) PHAGE_Salmon_SPN9CC: endopeptidase; ESCCO14588_2242; phage(gi389060532) 2e-78 Click
29complement(358209..358706) PHAGE_Entero_cdtI: lysin; ESCCO14588_2241; phage(gi148609440) 1e-91 Click
30complement(358706..358921) PHAGE_Stx2_c_1717: holin protein S-like protein; ESCCO14588_2240; phage(gi209447171) 7e-35 Click
31complement(359543..359701) PHAGE_Entero_P1: TciB; ESCCO14588_2239; phage(gi46401695) 3e-06 Click
32complement(359787..360503) conserved hypothetical protein; ESCCO14588_2238 0.0 Click
33complement(360714..361403) PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ESCCO14588_2237; phage(gi169257244) 3e-81 Click
34361878..362837 putative outer membrane protein; ESCCO14588_2236 0.0 Click
35complement(363049..363714) PHAGE_Stx2_c_1717: NinI protein; ESCCO14588_2235; phage(gi209447164) 3e-130 Click
36complement(363711..364334) PHAGE_Entero_Sf6: gene 54 protein; ESCCO14588_2234; phage(gi41057342) 2e-114 Click
37364727..365374 PHAGE_Stx2_c_I: Bet protein; ESCCO14588_2233; phage(gi20065900) 1e-125 Click
38365371..366051 PHAGE_Stx2_c_1717: exonuclease; ESCCO14588_2232; phage(gi209447136) 4e-132 Click
39366281..366394 PHAGE_Entero_HK630: hypothetical protein; ESCCO14588_2231; phage(gi428782820) 2e-12 Click
40366471..366686 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; ESCCO14588_2230; phage(gi20065893) 3e-34 Click
41complement(367217..367819) conserved hypothetical protein; ESCCO14588_2229 0.0 Click
42complement(368047..368217) hypothetical protein; ESCCO14588_2228 0.0 Click
43368474..368485 attR    AGGCGAAGTCAT 0.0 Click
44368761..369531 PHAGE_Entero_HK106: integrase; ESCCO14588_2227; phage(gi428783305) 9e-143 Click

Region 4, total : 55 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1822648..824738 PROPHAGE_Escher_Sakai: phage transposase; ESCCO14588_1785; phage(gi15834199) 0.0 Click
2824809..825741 PHAGE_Entero_Mu: DNA transposition protein; ESCCO14588_1784; phage(gi9633513) 1e-72 Click
3825744..825965 conserved hypothetical protein; ESCCO14588_1783 0.0 Click
4825978..826232 conserved hypothetical protein; ESCCO14588_1782 0.0 Click
5826234..826515 PHAGE_Pseudo_MP38: host nuclease inhibitor protein; ESCCO14588_1781; phage(gi215479937) 7e-11 Click
6826647..826784 conserved hypothetical protein; ESCCO14588_1780 0.0 Click
7826789..827082 conserved hypothetical protein; ESCCO14588_1779 0.0 Click
8827094..827624 PHAGE_Entero_Mu: Gam; ESCCO14588_1778; phage(gi9633500) 4e-52 Click
9827722..828264 conserved hypothetical protein; ESCCO14588_1777 0.0 Click
10828268..828801 PHAGE_Entero_Mu: hypothetical protein Mup11; ESCCO14588_1776; phage(gi9633501) 4e-68 Click
11828801..829316 PHAGE_Entero_Mu: hypothetical protein Mup12; ESCCO14588_1775; phage(gi9633502) 2e-45 Click
12829320..829871 conserved hypothetical protein; ESCCO14588_1774 0.0 Click
13829868..830053 conserved hypothetical protein; ESCCO14588_1773 0.0 Click
14830050..830424 conserved hypothetical protein; ESCCO14588_1772 0.0 Click
15830604..830900 conserved hypothetical protein; ESCCO14588_1771 0.0 Click
16830897..831406 PHAGE_Entero_Mu: hypothetical protein Mup16; ESCCO14588_1770; phage(gi9633506) 4e-29 Click
17831476..831901 PHAGE_Entero_Mu: putative transcription regulator; ESCCO14588_1769; phage(gi9633511) 2e-22 Click
18831973..832473 PHAGE_Xantho_CP1: hypothetical protein; ESCCO14588_1768; phage(gi431811023) 5e-28 Click
19832538..832936 PHAGE_Bacter_2: hypothetical protein APSE213; ESCCO14588_1767; phage(gi212499718) 1e-05 Click
20832920..833138 PHAGE_Entero_SfV: putative Rz1 lytic protein; ESCCO14588_1766; phage(gi19549039) 2e-08 Click
21833148..833375 PHAGE_Vibrio_VP882: conjugative transfer protein; ESCCO14588_1765; phage(gi126010902) 2e-05 Click
22833356..833664 PHAGE_Entero_Mu: hypothetical protein Mup25; ESCCO14588_1764; phage(gi9633516) 1e-09 Click
23833661..833951 PHAGE_Entero_Mu: hypothetical protein Mup26; ESCCO14588_1763; phage(gi9633517) 3e-26 Click
24833954..834535 PHAGE_Entero_Mu: hypothetical protein Mup27; ESCCO14588_1762; phage(gi9633518) 6e-55 Click
25834535..836199 PHAGE_Entero_Mu: putative portal protein; ESCCO14588_1761; phage(gi9633519) 0.0 Click
26836199..837788 PHAGE_Entero_Mu: hypothetical protein Mup29; ESCCO14588_1760; phage(gi9633520) 2e-170 Click
27837772..839097 PHAGE_Entero_Mu: virion morphogenesis late F orf; ESCCO14588_1759; phage(gi9633521) 1e-156 Click
28839216..839689 PHAGE_Entero_Mu: putative virion morphogenesis protein; ESCCO14588_1758; phage(gi9633522) 4e-40 Click
29839866..840990 PHAGE_Entero_Mu: putative protease protein; ESCCO14588_1757; phage(gi9633523) 3e-81 Click
30840990..841937 PHAGE_Entero_Mu: major head subunit; ESCCO14588_1756; phage(gi9633525) 5e-123 Click
31841981..842409 PHAGE_Entero_Mu: hypothetical protein Mup35; ESCCO14588_1755; phage(gi9633526) 4e-07 Click
32842406..842825 PHAGE_Entero_Mu: hypothetical protein Mup36; ESCCO14588_1754; phage(gi9633527) 2e-28 Click
33842822..843382 PHAGE_Entero_Mu: hypothetical protein Mup37; ESCCO14588_1753; phage(gi9633528) 4e-34 Click
34843383..843628 PHAGE_Entero_Mu: hypothetical protein Mup38; ESCCO14588_1752; phage(gi9633529) 3e-09 Click
35843625..845127 PHAGE_Entero_Mu: major tail subunit; ESCCO14588_1751; phage(gi9633530) 7e-139 Click
36845136..845501 PHAGE_Entero_Mu: hypothetical protein Mup40; ESCCO14588_1750; phage(gi9633531) 4e-27 Click
37845516..845992 PHAGE_Entero_Mu: hypothetical protein Mup41; ESCCO14588_1749; phage(gi9633532) 3e-24 Click
38846119..848194 PHAGE_Entero_Mu: putative tape measure protein; ESCCO14588_1748; phage(gi9633533) 7e-103 Click
39848181..849530 PHAGE_Entero_Mu: putative DNA circulation protein; ESCCO14588_1747; phage(gi9633534) 2e-71 Click
40849514..850638 PHAGE_Entero_Mu: putative tail protein; ESCCO14588_1746; phage(gi9633535) 2e-92 Click
41850628..851242 PHAGE_Entero_Mu: putative baseplate assembly protein; ESCCO14588_1745; phage(gi9633536) 6e-54 Click
42851235..851672 PHAGE_Entero_Mu: hypothetical protein Mup46; ESCCO14588_1744; phage(gi9633537) 1e-40 Click
43851669..852754 PHAGE_Entero_Mu: hypothetical protein Mup47; ESCCO14588_1743; phage(gi9633538) 2e-100 Click
44852745..853305 PHAGE_Entero_Mu: hypothetical protein Mup48; ESCCO14588_1742; phage(gi9633539) 1e-44 Click
45853305..854216 PHAGE_Entero_Mu: tail fiber; ESCCO14588_1741; phage(gi9633540) 2e-39 Click
46complement(854251..854883) PHAGE_Entero_Mu: tail fiber assembly protein; ESCCO14588_1740; phage(gi19584573) 7e-18 Click
47complement(854852..854998) PROPHAGE_Escher_Sakai: putative tail fiber protein; ESCCO14588_1739; phage(gi15834245) 1e-22 Click
48855278..855838 PHAGE_Entero_Mu: Gin; ESCCO14588_1738; phage(gi9633542) 8e-78 Click
49856133..857977 PHAGE_Entero_4795: hypothetical protein YjhS; ESCCO14588_1737; phage(gi157166028) 0.0 Click
50858124..858306 PHAGE_Escher_P13374: hypothetical protein; ESCCO14588_1736; phage(gi410491643) 2e-12 Click
51858342..858587 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_1735; phage(gi418487098) 3e-07 Click
52859359..860096 PHAGE_Entero_Mu: Mom; ESCCO14588_1734; phage(gi9633544) 9e-106 Click
53860190..861062 PHAGE_Plankt_PaV_LD: ABC transporter; ESCCO14588_1733; phage(gi371496158) 2e-16 Click
54861222..861497 conserved hypothetical protein; ESCCO14588_1732 0.0 Click
55861532..862641 PHAGE_Synech_S_SM2: zinc-containing alcohol dehydrogenase superfamily protein; ESCCO14588_1731; phage(gi326781942) 5e-33 Click

Region 5, total : 33 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(973344..974081) PHAGE_Tricho_2c: hypothetical protein TNAV2c_gp071; ESCCO14588_1623; phage(gi116326757) 9e-07 Click
2974165..975064 PHAGE_Burkho_phi1026b: gp58; ESCCO14588_1622; phage(gi38707948) 6e-19 Click
3975181..975196 attL    TTGATTTAAATGGTGC 0.0 Click
4975614..975625 attL    TGCGATTTTGTT 0.0 Click
5975740..976696 conserved hypothetical protein; ESCCO14588_1621 0.0 Click
6complement(976829..979162) PHAGE_Entero_P4: DNA primase; ESCCO14588_1620; phage(gi9627512) 0.0 Click
7complement(979176..979499) PHAGE_Entero_P4: hypothetical protein P4p07; ESCCO14588_1619; phage(gi9627513) 1e-35 Click
8complement(979499..979720) conserved hypothetical protein; ESCCO14588_1618 0.0 Click
9complement(979717..980049) PHAGE_Entero_P4: putative CI repressor; ESCCO14588_1617; phage(gi9627516) 1e-34 Click
10complement(980271..980531) PHAGE_Entero_P4: transcriptional regulator; ESCCO14588_1616; phage(gi9627517) 8e-25 Click
11981465..982217 PHAGE_Entero_P4: head size determination protein sid; ESCCO14588_1615; phage(gi9627518) 2e-09 Click
12982214..982765 PHAGE_Entero_P4: amber mutation-suppressing protein; ESCCO14588_1614; phage(gi9627520) 1e-11 Click
13982771..983043 PHAGE_Yersin_413C: Ogr; ESCCO14588_1613; phage(gi30065732) 1e-08 Click
14complement(983453..984019) conserved hypothetical protein; ESCCO14588_1612 0.0 Click
15complement(984019..984609) conserved hypothetical protein; ESCCO14588_1611 0.0 Click
16984890..985216 PHAGE_Stx2_c_II: putative transposase; ESCCO14588_1610; phage(gi302393161) 1e-58 Click
17985213..986103 PROPHAGE_Escher_Sakai: putative transposase; ESCCO14588_1609; phage(gi15834498) 2e-173 Click
18complement(986106..986585) conserved hypothetical protein; ESCCO14588_1608 0.0 Click
19complement(986578..986694) conserved hypothetical protein; ESCCO14588_1607 0.0 Click
20complement(987036..987653) conserved hypothetical protein; ESCCO14588_1606 0.0 Click
21complement(988046..989227) PROPHAGE_Escher_CFT073: putative prophage integrase; ESCCO14588_1605; phage(gi26250313) 6e-143 Click
22989783..990148 PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; ESCCO14588_1604; phage(gi24111655) 2e-44 Click
23complement(990190..990933) putative transcription regulator; ESCCO14588_1603 0.0 Click
24991757..992530 PHAGE_Pseudo_OBP: putative homing nuclease; ESCCO14588_1602; phage(gi371671534) 2e-38 Click
25complement(992588..993142) PHAGE_Entero_2: DNA-invertase; ESCCO14588_1601; phage(gi169936026) 8e-89 Click
26993172..993666 PHAGE_Entero_mEp213: tail fiber; ESCCO14588_1600; phage(gi428782611) 4e-82 Click
27993666..994259 PHAGE_Entero_HK106: tail fiber assembly protein; ESCCO14588_1598; phage(gi428783304) 4e-64 Click
28complement(994231..994674) PHAGE_Entero_mEp213: tail fiber assembly protein; ESCCO14588_1599; phage(gi428782612) 2e-25 Click
29complement(994695..995405) PHAGE_Erwini_ENT90: phage tail collar domain protein; ESCCO14588_1597; phage(gi431810938) 4e-15 Click
30complement(995405..995716) PHAGE_Entero_HK140: DNA replication protein P; ESCCO14588_1596; phage(gi428781992) 3e-05 Click
31complement(995713..996210) PHAGE_Entero_lambda: DNA replication protein; ESCCO14588_1595; phage(gi9626295) 3e-96 Click
32complement(996668..996805) PHAGE_Entero_lambda: cII protein; ESCCO14588_1594; phage(gi9626294) 1e-18 Click
33996896..996907 attR    TGCGATTTTGTT 0.0 Click
34complement(997080..997280) PHAGE_Entero_HK544: Cro protein; ESCCO14588_1593; phage(gi428783258) 7e-32 Click
35997381..998094 PHAGE_Entero_mEp234: prophage repressor; ESCCO14588_1592; phage(gi428782293) 3e-133 Click
36998987..999961 PHAGE_Entero_SfV: integrase; ESCCO14588_1591; phage(gi19549014) 4e-178 Click
37999966..999981 attR    TTGATTTAAATGGTGC 0.0 Click

Region 6, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2199200..2199592) PHAGE_Stx2_c_I: Q protein; ESCCO14588_0427; phage(gi20065938) 8e-65 Click
22199749..2199762 attL    AGTTACCGCCGTAA 0.0 Click
3complement(2199751..2200068) hypothetical bacteriophage protein; ESCCO14588_0425 0.0 Click
4complement(2200151..2200276) hypothetical protein; ESCCO14588_0424 0.0 Click
52200312..2200440 hypothetical protein; ESCCO14588_0423 0.0 Click
6complement(2200565..2200693) hypothetical protein; ESCCO14588_0422 0.0 Click
72201193..2201579 conserved hypothetical protein; ESCCO14588_0421 0.0 Click
8complement(2202030..2202167) PerC protein; ESCCO14588_0420 0.0 Click
9complement(2202292..2202759) PHAGE_Sodali_phiSG1: ProP protein; ESCCO14588_0419; phage(gi89886011) 1e-13 Click
10complement(2202776..2203225) PHAGE_Lactoc_Q54: hypothetical protein Q54_gp12; ESCCO14588_0418; phage(gi115304283) 2e-12 Click
112203528..2203656 hypothetical protein; ESCCO14588_0417 0.0 Click
12complement(2203717..2205540) PHAGE_Entero_P4: DNA primase; ESCCO14588_0416; phage(gi9627512) 1e-129 Click
13complement(2205537..2205659) hypothetical bacteriophage protein; ESCCO14588_0415 0.0 Click
14complement(2205717..2205908) PHAGE_Salmon_1: hypothetical protein STM0898.6n.Fels1; ESCCO14588_0414; phage(gi169257169) 4e-05 Click
15complement(2205953..2206162) conserved hypothetical protein; ESCCO14588_0413 0.0 Click
16complement(2206166..2206351) conserved hypothetical protein; ESCCO14588_0412 0.0 Click
17complement(2206344..2206475) hypothetical protein; ESCCO14588_0411 0.0 Click
18complement(2206463..2207494) hypothetical protein; ESCCO14588_0410 0.0 Click
19complement(2207481..2208329) PHAGE_Stx2_c_86: phage anti-repressor protein AntB; ESCCO14588_0409; phage(gi116222034) 6e-22 Click
20complement(2208397..2208612) phage transcriptional regulator, AlpA; ESCCO14588_0408 0.0 Click
21complement(2208999..2209649) conserved hypothetical protein; ESCCO14588_0407 0.0 Click
222209353..2209366 attR    AGTTACCGCCGTAA 0.0 Click
23complement(2209646..2210968) PHAGE_Burkho_BcepC6B: putative integrase protein; ESCCO14588_0406; phage(gi48697215) 7e-47 Click

Region 7, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13273750..3273761 attL    GTTTTTTCTGGC 0.0 Click
23273979..3275184 PHAGE_Temper_1: integrase-like protein; ESCCO14588_5200; phage(gi16271777) 8e-07 Click
33275186..3276298 site-specific recombinase, phage integrase family protein; ESCCO14588_5199 0.0 Click
43276366..3276500 conserved hypothetical protein; ESCCO14588_5198 0.0 Click
53276497..3278128 conserved DNA-binding protein; ESCCO14588_5197 0.0 Click
63278306..3278527 conserved hypothetical protein; ESCCO14588_5196 0.0 Click
73278625..3279038 conserved hypothetical protein; ESCCO14588_5195 0.0 Click
83279578..3280654 PHAGE_Cafete_BV_PW1: hypothetical protein; ESCCO14588_5194; phage(gi310831380) 7e-18 Click
9complement(3280730..3281008) conserved hypothetical protein; ESCCO14588_5193 0.0 Click
10complement(3281068..3281823) PROPHAGE_Escher_MG1655: IS30 transposase; ESCCO14588_5192; phage(gi16132105) 2e-141 Click
113282724..3283335 PHAGE_Stx2_c_1717: NinG protein; ESCCO14588_5191; phage(gi209447163) 5e-101 Click
123283332..3283997 PHAGE_Stx2_c_1717: NinI protein; ESCCO14588_5190; phage(gi209447164) 3e-130 Click
133283994..3284617 PHAGE_Entero_mEpX1: late gene regulator Q; ESCCO14588_5189; phage(gi428781929) 7e-116 Click
143284688..3284804 hypothetical protein; ESCCO14588_5188 0.0 Click
153284897..3285613 conserved hypothetical protein; ESCCO14588_5187 0.0 Click
163285699..3285866 PHAGE_Entero_P1: TciB; ESCCO14588_5186; phage(gi46401695) 1e-06 Click
173286274..3288127 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp44; ESCCO14588_5185; phage(gi209447169) 0.0 Click
183288277..3288492 PHAGE_Stx2_c_1717: holin protein S-like protein; ESCCO14588_5184; phage(gi209447171) 7e-35 Click
193288497..3288841 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF47; ESCCO14588_5183; phage(gi157166032) 3e-60 Click
203288892..3289122 PHAGE_Entero_2008: putative endolysin; ESCCO14588_5182; phage(gi209427769) 4e-35 Click
213289575..3289922 PHAGE_Stx2_c_1717: transposase; ESCCO14588_5181; phage(gi209447152) 2e-62 Click
22complement(3290423..3291313) PROPHAGE_Escher_Sakai: putative transposase; ESCCO14588_5180; phage(gi15834498) 2e-173 Click
23complement(3291310..3291636) PHAGE_Stx2_c_1717: putative transposase; ESCCO14588_5179; phage(gi209447180) 1e-58 Click
243291703..3291951 PHAGE_Stx2_c_II: putative tail fiber protein; ESCCO14588_5178; phage(gi302393091) 1e-38 Click
253292127..3292534 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp78; ESCCO14588_5177; phage(gi209447201) 4e-21 Click
263294566..3294577 attR    GTTTTTTCTGGC 0.0 Click

Region 8, total : 91 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13559482..3559493 attL    TTTTTTGCTCGC 0.0 Click
2complement(3570783..3571409) PHAGE_Staphy_StB27: integrase; ESCCO14588_4896; phage(gi431809677) 3e-10 Click
33572075..3573487 conserved hypothetical protein; ESCCO14588_4895 0.0 Click
4complement(3574158..3574853) hypothetical protein; ESCCO14588_4894 0.0 Click
53574875..3575405 PHAGE_Entero_Sf6: gene 9 protein; ESCCO14588_4893; phage(gi41057287) 9e-92 Click
63575405..3575872 PHAGE_Sodali_phiSG1: hypothetical protein SGPHI_0018; ESCCO14588_4892; phage(gi89885999) 2e-64 Click
73575859..3576539 PHAGE_Sodali_phiSG1: phage DNA transfer protein; ESCCO14588_4891; phage(gi89886000) 2e-75 Click
83576549..3577109 PHAGE_Salmon_vB_SemP_Emek: injection protein; ESCCO14588_4890; phage(gi399498803) 3e-31 Click
93577534..3577683 putative DNA injection protein; ESCCO14588_4889 0.0 Click
10complement(3577857..3579014) PROPHAGE_Escher_Sakai: putative prophage Sf6-like integrase; ESCCO14588_4888; phage(gi15832485) 0.0 Click
113579013..3579171 PHAGE_Entero_HK633: hypothetical protein; ESCCO14588_4887; phage(gi428782546) 3e-16 Click
12complement(3579176..3579250) tRNA 0.0 Click
133579227..3579250 attL    TTATATCCATTTAACTAAGAGGAC 0.0 Click
143579446..3580615 PHAGE_Stx2_c_86: integrase; ESCCO14588_4884; phage(gi116222028) 0.0 Click
15complement(3580599..3580781) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp37; ESCCO14588_4885; phage(gi116222029) 3e-28 Click
16complement(3580842..3581093) PHAGE_Escher_TL_2011c: putative bacteriophage protein; ESCCO14588_4883; phage(gi418487053) 4e-41 Click
173581355..3581477 PHAGE_Escher_P13374: hypothetical protein; ESCCO14588_4881; phage(gi410491599) 4e-17 Click
18complement(3581458..3581874) PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4882; phage(gi418487077) 2e-58 Click
19complement(3581910..3582122) PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4880; phage(gi418487078) 9e-32 Click
20complement(3582082..3582708) PHAGE_Escher_TL_2011c: adenine methylase; ESCCO14588_4879; phage(gi418487054) 2e-122 Click
21complement(3582705..3583136) PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4878; phage(gi418487079) 3e-78 Click
22complement(3583192..3583869) PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4877; phage(gi418487090) 6e-97 Click
233584194..3584451 addiction module antidote protein; ESCCO14588_4876 0.0 Click
243584867..3585172 PHAGE_Azospi_Cd: Helix-turn-helix motif; ESCCO14588_4875; phage(gi168495160) 4e-08 Click
25complement(3585215..3585817) PHAGE_Lactob_phiadh: hypothetical protein phiadhp07; ESCCO14588_4874; phage(gi9633007) 9e-14 Click
26complement(3585777..3585953) PHAGE_Entero_P1: Ant2; ESCCO14588_4873; phage(gi46401670) 3e-11 Click
27complement(3586047..3586670) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip087; ESCCO14588_4872; phage(gi20065882) 2e-120 Click
28complement(3586674..3586961) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip089; ESCCO14588_4871; phage(gi20065884) 1e-51 Click
29complement(3586963..3587181) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip090; ESCCO14588_4870; phage(gi20065885) 1e-36 Click
30complement(3587183..3587398) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip092; ESCCO14588_4869; phage(gi20065887) 4e-39 Click
31complement(3587410..3587529) hypothetical protein; ESCCO14588_4868 0.0 Click
32complement(3587740..3588513) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip094; ESCCO14588_4867; phage(gi20065889) 2e-146 Click
33complement(3588830..3589045) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; ESCCO14588_4866; phage(gi20065893) 5e-35 Click
34complement(3589122..3589235) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip099; ESCCO14588_4865; phage(gi20065894) 4e-14 Click
35complement(3589465..3590145) PHAGE_Escher_TL_2011c: putative exonuclease; ESCCO14588_4864; phage(gi418487057) 8e-132 Click
36complement(3590142..3591092) PHAGE_Escher_TL_2011c: RecT; ESCCO14588_4863; phage(gi418487123) 6e-179 Click
37complement(3591109..3591390) PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4862; phage(gi418487088) 2e-50 Click
38complement(3591411..3591692) PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4861; phage(gi418487089) 5e-37 Click
39complement(3591704..3591916) PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4860; phage(gi418487058) 1e-34 Click
40complement(3591987..3592760) PHAGE_Escher_TL_2011c: phage regulatory protein, Rha family; ESCCO14588_4859; phage(gi418487059) 2e-115 Click
41complement(3593390..3594343) PHAGE_Escher_TL_2011c: type II restriction enzyme BsuBI; ESCCO14588_4858; phage(gi418487060) 0.0 Click
42complement(3594340..3595809) PHAGE_Escher_TL_2011c: modification methylase BsuBI; ESCCO14588_4857; phage(gi418487061) 0.0 Click
43complement(3595904..3596617) PHAGE_Escher_TL_2011c: repressor protein CI; ESCCO14588_4856; phage(gi418487062) 2e-134 Click
443596713..3596916 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4855; phage(gi418487091) 1e-31 Click
453597087..3597281 hypothetical protein; ESCCO14588_4854 0.0 Click
463597694..3597825 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4853; phage(gi418487092) 2e-18 Click
473597819..3599339 PHAGE_Escher_TL_2011c: helicase domain protein; ESCCO14588_4852; phage(gi418487063) 0.0 Click
483599329..3600300 PHAGE_Escher_TL_2011c: putative phage DNA primase; ESCCO14588_4851; phage(gi418487064) 0.0 Click
493600300..3600749 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4850; phage(gi418487093) 4e-81 Click
503600757..3601320 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4849; phage(gi418487094) 2e-104 Click
513601317..3601511 PHAGE_Stx2_c_II: NinH protein; ESCCO14588_4848; phage(gi302393155) 2e-32 Click
523601504..3601938 PHAGE_Stx2_c_86: antitermination protein Q; ESCCO14588_4847; phage(gi116222072) 2e-83 Click
533602187..3602339 PHAGE_Stx2_c_86: DNA modification methylase; ESCCO14588_4846; phage(gi116222073) 1e-19 Click
543602380..3602455 tRNA 0.0 Click
553602464..3602542 tRNA 0.0 Click
563602554..3602632 tRNA 0.0 Click
573602899..3603681 PHAGE_Escher_TL_2011c: Shiga toxin 2 subunit A; ESCCO14588_4842; phage(gi418487067) 7e-146 Click
583603693..3603962 PHAGE_Escher_TL_2011c: Shiga toxin 2 subunit B; ESCCO14588_4841; phage(gi418487068) 1e-46 Click
593604449..3605948 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip148; ESCCO14588_4840; phage(gi20065943) 0.0 Click
603605983..3606387 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4839; phage(gi418487095) 3e-73 Click
613606524..3606703 PHAGE_Escher_P13374: hypothetical protein; ESCCO14588_4838; phage(gi410491643) 2e-28 Click
623606744..3606989 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4837; phage(gi418487098) 2e-24 Click
633607067..3607819 PHAGE_Stx2_c_II: endolysin; ESCCO14588_4836; phage(gi302393165) 2e-103 Click
643608090..3608659 PHAGE_Stx2_c_II: putative antirepressor protein Ant; ESCCO14588_4835; phage(gi302393166) 7e-107 Click
653608659..3608805 PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; ESCCO14588_4834; phage(gi302861202) 2e-20 Click
663608813..3609280 PHAGE_Entero_Sakai: Rz; ESCCO14588_4833; phage(gi9633443) 4e-82 Click
67complement(3609509..3610399) PROPHAGE_Escher_Sakai: putative transposase; ESCCO14588_4832; phage(gi15834498) 2e-173 Click
68complement(3610396..3610722) PROPHAGE_Escher_Sakai: putative transposase; ESCCO14588_4831; phage(gi15832212) 3e-58 Click
693610821..3611321 PHAGE_Escher_P13374: regulatory protein; ESCCO14588_4830; phage(gi410491650) 3e-92 Click
703611445..3611558 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip164; ESCCO14588_4829; phage(gi20065959) 6e-17 Click
713611614..3612408 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip165; ESCCO14588_4828; phage(gi20065960) 7e-147 Click
723612434..3614095 PHAGE_Escher_P13374: phage terminase large subunit; ESCCO14588_4827; phage(gi410491652) 0.0 Click
733614095..3616239 PHAGE_Escher_TL_2011c: putative portal protein; ESCCO14588_4826; phage(gi418487074) 0.0 Click
743616397..3617404 PHAGE_Escher_P13374: hypothetical protein; ESCCO14588_4825; phage(gi410491654) 0.0 Click
753617428..3618642 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4824; phage(gi418487102) 0.0 Click
763618698..3619087 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4823; phage(gi418487103) 2e-66 Click
773619137..3619598 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4822; phage(gi418487104) 2e-82 Click
783619582..3620145 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4821; phage(gi418487105) 2e-104 Click
793620145..3620795 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip017; ESCCO14588_4820; phage(gi20065813) 8e-123 Click
803620792..3621241 PHAGE_Stx2_c_II: putative tail fiber protein; ESCCO14588_4818; phage(gi302393090) 8e-68 Click
81complement(3621201..3621602) hypothetical protein; ESCCO14588_4819 0.0 Click
823621591..3622730 PHAGE_Escher_TL_2011c: putative tail fiber protein; ESCCO14588_4817; phage(gi418487108) 0.0 Click
833622732..3623001 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4816; phage(gi418487109) 4e-47 Click
843623141..3623329 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4815; phage(gi418487110) 4e-31 Click
853623396..3623509 hypothetical protein; ESCCO14588_4814 0.0 Click
863623624..3625249 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip030; ESCCO14588_4813; phage(gi20065826) 0.0 Click
873625246..3626514 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4812; phage(gi418487112) 0.0 Click
883626529..3626807 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp14; ESCCO14588_4811; phage(gi302393094) 8e-52 Click
893626813..3627430 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4810; phage(gi418487113) 4e-122 Click
903627521..3628255 PHAGE_Escher_TL_2011c: outer membrane protein Lom precursor; ESCCO14588_4809; phage(gi418487075) 4e-140 Click
913628488..3628628 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4808; phage(gi418487114) 5e-11 Click
923628709..3629086 PHAGE_Escher_P13374: hypothetical protein; ESCCO14588_4807; phage(gi410491668) 1e-69 Click
933629180..3629836 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip042; ESCCO14588_4806; phage(gi20065838) 5e-122 Click
943629839..3630285 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip045; ESCCO14588_4805; phage(gi20065841) 2e-80 Click
953630295..3630546 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4804; phage(gi418487118) 2e-40 Click
963630557..3631822 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4803; phage(gi418487119) 0.0 Click
973631892..3640276 PHAGE_Stx1_converting: hypothetical protein Stx1_gp23; ESCCO14588_4802; phage(gi302861144) 0.0 Click
983640399..3640422 attR    TTATATCCATTTAACTAAGAGGAC 0.0 Click
993641475..3641486 attR    TTTTTTGCTCGC 0.0 Click

Region 9, total : 49 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13874244..3874260 attL    GAGAACGCCGCCCGTGC 0.0 Click
23887048..3887974 PHAGE_Plankt_PaV_LD: ABC transporter; ESCCO14588_4560; phage(gi371496158) 4e-25 Click
33887979..3888710 ABC transporter, quaternary amine uptake (QAT) family, permease protein; ESCCO14588_4559 0.0 Click
4complement(3888858..3889505) conserved hypothetical protein; ESCCO14588_4558 0.0 Click
5complement(3889580..3890866) PROPHAGE_Escher_Sakai: putative integrase; ESCCO14588_4557; phage(gi15832267) 0.0 Click
6complement(3890900..3891040) PHAGE_Entero_2008: putative excisionase; ESCCO14588_4556; phage(gi209427728) 8e-23 Click
7complement(3891311..3891454) PHAGE_Entero_2008: hypothetical protein YYZ_gp04; ESCCO14588_4555; phage(gi209427730) 7e-21 Click
8complement(3891641..3892003) PHAGE_Entero_2008: hypothetical protein YYZ_gp05; ESCCO14588_4554; phage(gi209427731) 7e-74 Click
9complement(3892690..3892866) PHAGE_Entero_2008: hypothetical protein YYZ_gp08; ESCCO14588_4552; phage(gi209427734) 9e-29 Click
10complement(3892868..3893815) PHAGE_Entero_2008: hypothetical protein YYZ_gp09; ESCCO14588_4551; phage(gi209427735) 0.0 Click
11complement(3894132..3894347) PHAGE_Stx1_converting: hypothetical protein Stx1_gp42; ESCCO14588_4550; phage(gi302861164) 5e-35 Click
12complement(3894424..3894537) PHAGE_Stx1_converting: hypothetical protein Stx1_gp43; ESCCO14588_4549; phage(gi302861165) 4e-14 Click
13complement(3894770..3895447) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip102; ESCCO14588_4548; phage(gi20065897) 4e-132 Click
14complement(3895444..3896229) PHAGE_Stx2_c_I: Bet protein; ESCCO14588_4547; phage(gi20065900) 2e-151 Click
15complement(3896235..3896531) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; ESCCO14588_4546; phage(gi116222045) 4e-51 Click
16complement(3896607..3896750) PHAGE_Stx2_c_86: putative host killing protein Kil; ESCCO14588_4545; phage(gi116222047) 8e-20 Click
17complement(3896956..3897324) PHAGE_Stx2_c_I: Ea10 protein; ESCCO14588_4544; phage(gi20065907) 5e-68 Click
183897585..3898166 PHAGE_Entero_HK140: superinfection exclusion protein; ESCCO14588_4543; phage(gi428781984) 4e-109 Click
19complement(3898183..3898455) PHAGE_Entero_HK629: transcription antitermination protein N; ESCCO14588_4542; phage(gi428782056) 7e-45 Click
20complement(3898968..3899399) PHAGE_Entero_HK544: hypothetical protein; ESCCO14588_4541; phage(gi428783255) 4e-74 Click
21complement(3899526..3899807) PHAGE_Entero_HK544: hypothetical protein; ESCCO14588_4540; phage(gi428783256) 1e-47 Click
22complement(3899930..3900502) PHAGE_Entero_mEpX1: prophage repressor; ESCCO14588_4539; phage(gi428781915) 1e-108 Click
23complement(3901115..3902005) PROPHAGE_Escher_Sakai: putative transposase; ESCCO14588_4538; phage(gi15834498) 2e-173 Click
24complement(3902002..3902328) PROPHAGE_Escher_Sakai: putative transposase; ESCCO14588_4537; phage(gi15832212) 3e-58 Click
25complement(3902448..3902570) hypothetical protein; ESCCO14588_4536 0.0 Click
263902661..3903599 PHAGE_Entero_4795: putative replication protein O; ESCCO14588_4535; phage(gi157166011) 0.0 Click
273903596..3904297 PHAGE_Entero_4795: putative replication protein P; ESCCO14588_4534; phage(gi157166012) 1e-131 Click
283904294..3904584 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip128; ESCCO14588_4533; phage(gi20065923) 2e-49 Click
293904655..3904933 PHAGE_Stx1_converting: hypothetical protein Stx1_gp62; ESCCO14588_4532; phage(gi302861184) 5e-51 Click
303905166..3905528 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip131; ESCCO14588_4531; phage(gi20065926) 2e-67 Click
313905485..3905931 PHAGE_Stx1_converting: NinB protein; ESCCO14588_4530; phage(gi302861187) 2e-83 Click
323905928..3906455 PHAGE_Stx1_converting: DNA N-6-adenine-methyltransferase; ESCCO14588_4529; phage(gi302861188) 1e-101 Click
333906631..3907032 PHAGE_Stx1_converting: hypothetical protein Stx1_gp68; ESCCO14588_4528; phage(gi302861190) 3e-76 Click
343907194..3907799 PHAGE_Stx1_converting: NinG protein; ESCCO14588_4527; phage(gi302861192) 1e-118 Click
353907796..3907990 PHAGE_Stx1_converting: NinH protein; ESCCO14588_4526; phage(gi302861193) 2e-32 Click
363907983..3908417 PHAGE_Stx1_converting: antitermination protein Q; ESCCO14588_4525; phage(gi302861194) 2e-83 Click
373908924..3909871 PHAGE_Stx1_converting: Shiga toxin 1 subunit A; ESCCO14588_4524; phage(gi302861195) 1e-176 Click
383909964..3910149 PHAGE_Stx1_converting: Shiga toxin 1 subunit B; ESCCO14588_4523; phage(gi302861196) 4e-30 Click
393910660..3912606 PHAGE_Stx1_converting: hypothetical protein Stx1_gp75; ESCCO14588_4522; phage(gi302861197) 0.0 Click
403912744..3912923 PHAGE_Escher_P13374: hypothetical protein; ESCCO14588_4521; phage(gi410491643) 2e-28 Click
413912964..3913209 PHAGE_Stx1_converting: hypothetical protein Stx1_gp76; ESCCO14588_4520; phage(gi302861198) 6e-39 Click
423913287..3913502 PHAGE_Stx1_converting: holin; ESCCO14588_4519; phage(gi302861199) 2e-35 Click
433913507..3914040 PHAGE_Stx1_converting: endolysin; ESCCO14588_4518; phage(gi302861200) 1e-103 Click
443914311..3914880 PHAGE_Stx1_converting: putative antirepressor protein Ant; ESCCO14588_4517; phage(gi302861201) 7e-107 Click
453914880..3915026 PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; ESCCO14588_4516; phage(gi302861202) 2e-20 Click
463915034..3915501 PHAGE_Stx1_converting: endopeptidase Rz; ESCCO14588_4515; phage(gi302861203) 2e-79 Click
47complement(3915651..3915923) conserved hypothetical protein; ESCCO14588_4514 0.0 Click
483915956..3916432 PHAGE_Salmon_1: bacteriophage terminase, small subunit; ESCCO14588_4513; phage(gi169257184) 3e-47 Click
493916429..3918525 PROPHAGE_Escher_Sakai: putative terminase large subunit; ESCCO14588_4512; phage(gi15832217) 0.0 Click
50complement(3918526..3919341) PHAGE_Entero_mEp460: hypothetical protein; ESCCO14588_3237; phage(gi428782365) 1e-67 Click
513919549..3919565 attR    GAGAACGCCGCCCGTGC 0.0 Click

Region 10, total : 48 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14033322..4033333 attL    TGGGTTTTACCT 0.0 Click
24033974..4033988 attL    TAAAAACATTAACAA 0.0 Click
3complement(4036630..4037211) PHAGE_Entero_lambda: Putative fiber assembly protein; ESCCO14588_3103; phage(gi9626269) 1e-101 Click
4complement(4037211..4038761) PHAGE_Entero_lambda: Tail fiber; ESCCO14588_3102; phage(gi9626268) 2e-87 Click
5complement(4038722..4038856) hypothetical protein; ESCCO14588_3101 0.0 Click
64038892..4039629 PHAGE_Entero_lambda: hypothetical protein lambdap90; ESCCO14588_3100; phage(gi9626267) 1e-52 Click
74040062..4040190 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; ESCCO14588_3099; phage(gi157166059) 8e-19 Click
8complement(4040191..4040790) PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ESCCO14588_3098; phage(gi209427792) 1e-113 Click
9complement(4040857..4044255) PHAGE_Entero_lambda: tail:host specificity protein; ESCCO14588_3097; phage(gi9626264) 0.0 Click
10complement(4044316..4044888) PHAGE_Entero_lambda: tail component; ESCCO14588_3096; phage(gi9626263) 1e-100 Click
11complement(4044885..4045628) PHAGE_Entero_mEp460: tail fiber component; ESCCO14588_3095; phage(gi428782332) 2e-149 Click
12complement(4045634..4046332) PHAGE_Entero_lambda: tail component; ESCCO14588_3094; phage(gi9626261) 5e-134 Click
13complement(4046332..4046661) PHAGE_Entero_lambda: tail component; ESCCO14588_3093; phage(gi9626260) 1e-56 Click
14complement(4046658..4049207) PHAGE_Entero_lambda: tail component; ESCCO14588_3092; phage(gi9626259) 0.0 Click
15complement(4049200..4049634) PHAGE_Entero_lambda: tail component; ESCCO14588_3091; phage(gi9626258) 2e-81 Click
16complement(4049616..4050038) PHAGE_Entero_lambda: tail component; ESCCO14588_3090; phage(gi9626257) 2e-73 Click
17complement(4050054..4050794) PHAGE_Entero_lambda: tail component; ESCCO14588_3089; phage(gi9626256) 3e-133 Click
18complement(4050802..4051197) PHAGE_Entero_lambda: tail component; ESCCO14588_3088; phage(gi9626255) 2e-72 Click
19complement(4051194..4051772) PHAGE_Entero_lambda: tail component; ESCCO14588_3087; phage(gi9626254) 6e-101 Click
20complement(4051784..4052137) PHAGE_Entero_lambda: head-tail joining protein; ESCCO14588_3086; phage(gi9626253) 3e-62 Click
21complement(4052149..4052547) PHAGE_Entero_lambda: DNA packaging protein; ESCCO14588_3085; phage(gi9626252) 3e-67 Click
22complement(4052589..4053641) PHAGE_Entero_lambda: capsid component; ESCCO14588_3084; phage(gi9626251) 0.0 Click
23complement(4053670..4054002) PHAGE_Entero_lambda: head-DNA stabilization protein; ESCCO14588_3083; phage(gi9626250) 7e-58 Click
24complement(4054012..4055331) PHAGE_Entero_lambda: capsid component; ESCCO14588_3082; phage(gi9626248) 0.0 Click
25complement(4055312..4056913) PHAGE_Entero_lambda: capsid component; ESCCO14588_3081; phage(gi9626247) 0.0 Click
26complement(4056910..4057116) PHAGE_Entero_lambda: head-tail joining protein; ESCCO14588_3080; phage(gi9626246) 1e-31 Click
27complement(4057113..4059038) PHAGE_Entero_lambda: DNA packaging protein; ESCCO14588_3079; phage(gi9626245) 0.0 Click
28complement(4059013..4059558) PHAGE_Entero_lambda: DNA packaging protein; ESCCO14588_3078; phage(gi9626244) 3e-96 Click
294060007..4060141 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ESCCO14588_3077; phage(gi209427772) 5e-09 Click
30complement(4060306..4060512) PHAGE_Entero_lambda: hypothetical protein lambdap79; ESCCO14588_3076; phage(gi19263397) 1e-32 Click
314060798..4061208 PHAGE_Entero_lambda: putative envelope protein; ESCCO14588_3075; phage(gi19263396) 2e-74 Click
324061500..4061793 PHAGE_Entero_lambda: Bor protein precursor; ESCCO14588_3074; phage(gi19263395) 6e-50 Click
33complement(4061825..4062286) PHAGE_Entero_lambda: cell lysis protein; ESCCO14588_3073; phage(gi9626310) 3e-80 Click
34complement(4062283..4062759) PHAGE_Escher_HK75: lysozyme; ESCCO14588_3072; phage(gi356870730) 6e-85 Click
35complement(4062746..4063063) PHAGE_Salmon_ST160: Gp13; ESCCO14588_3071; phage(gi318065943) 5e-40 Click
36complement(4063373..4064062) PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ESCCO14588_3070; phage(gi169257244) 4e-84 Click
37complement(4064059..4064196) PHAGE_Entero_mEp237: hypothetical protein; ESCCO14588_3069; phage(gi435439319) 1e-11 Click
38complement(4064196..4064558) PHAGE_Entero_mEp237: Holliday junction resolvase RusA; ESCCO14588_3068; phage(gi435439318) 1e-61 Click
39complement(4064555..4064845) PHAGE_Entero_mEp237: hypothetical protein; ESCCO14588_3067; phage(gi435439317) 3e-48 Click
40complement(4064838..4065008) PHAGE_Escher_HK639: NinE; ESCCO14588_3066; phage(gi356870663) 1e-14 Click
41complement(4065008..4065463) PHAGE_Cronob_phiES15: hypothetical protein; ESCCO14588_3065; phage(gi401817579) 9e-59 Click
42complement(4065965..4067491) PHAGE_Bacill_WBeta: putative site-specific recombinase; ESCCO14588_3064; phage(gi85701406) 5e-09 Click
434067663..4067677 attR    TAAAAACATTAACAA 0.0 Click
44complement(4067736..4068068) PHAGE_Acinet_Acj61: putative quaternary ammonium compound-resistance protein qacE; ESCCO14588_3063; phage(gi311992758) 1e-10 Click
45complement(4068136..4068438) PHAGE_Entero_lambda: ren exclusion protein; ESCCO14588_3062; phage(gi9626297) 2e-43 Click
46complement(4068435..4069136) PHAGE_Entero_lambda: DNA replication protein; ESCCO14588_3061; phage(gi9626296) 4e-129 Click
47complement(4069133..4069957) PHAGE_Entero_lambda: DNA replication protein; ESCCO14588_3060; phage(gi9626295) 2e-99 Click
484070287..4071429 PHAGE_Entero_mEp235: integrase; ESCCO14588_3059; phage(gi428781836) 5e-61 Click
49complement(4071543..4072793) isocitrate dehydrogenase, NADP-dependent; ESCCO14588_3058 0.0 Click
504072995..4073618 ribosomal large subunit pseudouridine synthase E; ESCCO14588_3057 0.0 Click
514073628..4074089 PHAGE_Vibrio_KVP40: NMN adenylyl tranferase; ESCCO14588_3056; phage(gi34419395) 6e-05 Click
524079878..4079889 attR    TGGGTTTTACCT 0.0 Click

Region 11, total : 32 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14067642..4067653 attL    CACAAAAGAATA 0.0 Click
2complement(4080752..4082413) PHAGE_Burkho_KS9: terminase gp2; ESCCO14588_3048; phage(gi255033734) 5e-84 Click
3complement(4082397..4082753) PHAGE_Salmon_ST64B: terminase small subunit; ESCCO14588_3047; phage(gi23505446) 5e-12 Click
4complement(4082877..4083050) conserved hypothetical protein; ESCCO14588_3046 0.0 Click
5complement(4083043..4083483) PHAGE_Bacill_phi105: hypothetical protein phi105_50; ESCCO14588_3045; phage(gi22855043) 3e-23 Click
6complement(4083483..4083779) PHAGE_Salmon_ST64B: hypothetical protein sb8; ESCCO14588_3044; phage(gi23505453) 2e-05 Click
7complement(4083776..4084114) PHAGE_Entero_HK97: putative head-tail adaptor; ESCCO14588_3043; phage(gi9634168) 3e-25 Click
8complement(4084111..4085322) PHAGE_Salmon_ST64B: Portal Protein; ESCCO14588_3042; phage(gi23505449) 2e-43 Click
9complement(4085324..4085896) PHAGE_Entero_1: prohead protease; ESCCO14588_3041; phage(gi225626394) 5e-30 Click
10complement(4085936..4087093) PHAGE_Salmon_ST64B: Major capsid protein precursor; ESCCO14588_3040; phage(gi23505451) 2e-52 Click
11complement(4087386..4087610) conserved hypothetical protein; ESCCO14588_3039 0.0 Click
12complement(4088018..4088428) PHAGE_Lactoc_Q54: hypothetical protein Q54_gp12; ESCCO14588_3038; phage(gi115304283) 1e-09 Click
134088774..4088911 hypothetical protein; ESCCO14588_3036 0.0 Click
14complement(4088862..4088981) hypothetical protein; ESCCO14588_3037 0.0 Click
15complement(4089047..4091179) PHAGE_Thermo_THSA_485A: protein of unknown function DUF927; ESCCO14588_3035; phage(gi397912648) 5e-21 Click
16complement(4091176..4091475) conserved hypothetical protein; ESCCO14588_3034 0.0 Click
17complement(4091481..4091723) conserved hypothetical protein; ESCCO14588_3033 0.0 Click
18complement(4091713..4091904) PHAGE_Salmon_1: hypothetical protein STM0898.6n.Fels1; ESCCO14588_3032; phage(gi169257169) 1e-09 Click
19complement(4091904..4092089) conserved hypothetical protein; ESCCO14588_3031 0.0 Click
20complement(4092082..4092228) conserved hypothetical protein; ESCCO14588_3030 0.0 Click
21complement(4092305..4093048) conserved hypothetical protein; ESCCO14588_3029 0.0 Click
22complement(4093659..4094888) PHAGE_Salmon_vB_SosS_Oslo: integrase; ESCCO14588_3028; phage(gi399528791) 3e-59 Click
234094893..4095057 conserved hypothetical protein; ESCCO14588_3027 0.0 Click
244095137..4096258 cupin family protein; ESCCO14588_3026 0.0 Click
25complement(4096307..4097575) peptidase T; ESCCO14588_3025 0.0 Click
264097589..4097804 hypothetical protein; ESCCO14588_3024 0.0 Click
274097783..4098919 PHAGE_Plankt_PaV_LD: ABC transporter; ESCCO14588_3023; phage(gi371496158) 7e-27 Click
284098933..4099766 spermidine/putrescine ABC transporter, permease protein PotB; ESCCO14588_3022 0.0 Click
294100130..4101491 PHAGE_Gifsy_1: leucine-rich repeat protein; ESCCO14588_3021; phage(gi169257209) 5e-64 Click
304101815..4101826 attR    CACAAAAGAATA 0.0 Click
31complement(4102055..4102183) PROPHAGE_Escher_CFT073: transposase; ESCCO14588_3020; phage(gi26246249) 3e-12 Click
324102365..4102526 PROPHAGE_Escher_CFT073: transposase insC; ESCCO14588_3019; phage(gi26250372) 4e-24 Click
334102593..4102730 PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; ESCCO14588_3018; phage(gi17546153) 3e-15 Click
344102688..4103593 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; ESCCO14588_3017; phage(gi16130763) 2e-177 Click

Region 12, total : 63 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14107603..4107617 attL    AACAATCATTAATTA 0.0 Click
2complement(4108128..4110476) PHAGE_Staphy_SA11: putative pentapeptide repeat protein; ESCCO14588_3014; phage(gi422935631) 2e-05 Click
3complement(4110598..4110783) PHAGE_Entero_2008: putative tail assembly protein; ESCCO14588_3013; phage(gi209427790) 4e-11 Click
4complement(4110780..4111517) PHAGE_Entero_2008: putative tail component K-like protein; ESCCO14588_3012; phage(gi209427789) 3e-151 Click
5complement(4111571..4112449) PHAGE_Salmon_vB_SemP_Emek: antirepressor; ESCCO14588_3011; phage(gi399498814) 2e-94 Click
6complement(4112752..4112892) conserved hypothetical protein; ESCCO14588_3010 0.0 Click
74113086..4113226 putative regulatory protein; ESCCO14588_3009 0.0 Click
8complement(4113243..4113941) PHAGE_Entero_2008: putative tail protein; ESCCO14588_3008; phage(gi209427787) 4e-131 Click
9complement(4113941..4114282) PHAGE_Entero_2008: putative minor tail protein; ESCCO14588_3007; phage(gi209427786) 3e-63 Click
10complement(4114275..4117517) PHAGE_Entero_2008: putative tail protein; ESCCO14588_3006; phage(gi209427785) 0.0 Click
11complement(4117570..4117773) PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ESCCO14588_3005; phage(gi209427784) 3e-32 Click
12complement(4117875..4118249) PHAGE_Entero_2008: putative tail assembly protein; ESCCO14588_3004; phage(gi209427783) 2e-65 Click
13complement(4118255..4118971) PHAGE_Entero_2008: putative tail protein; ESCCO14588_3003; phage(gi209427782) 2e-122 Click
14complement(4119030..4119374) PHAGE_Entero_2008: putative prophage structural protein; ESCCO14588_3002; phage(gi209427781) 6e-60 Click
15complement(4119371..4119817) PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ESCCO14588_3001; phage(gi209427780) 2e-80 Click
16complement(4119814..4120164) PHAGE_Entero_2008: putative head-tail adaptor; ESCCO14588_3000; phage(gi209427779) 9e-61 Click
17complement(4120174..4120500) PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ESCCO14588_2999; phage(gi209427778) 1e-54 Click
18complement(4120497..4120613) PHAGE_Entero_2008: putative portal protein; ESCCO14588_2998; phage(gi209427777) 6e-17 Click
19complement(4120580..4122994) PHAGE_Entero_2008: putative portal protein; ESCCO14588_2997; phage(gi209427777) 0.0 Click
20complement(4123027..4123248) PHAGE_Entero_2008: hypothetical protein YYZ_gp53; ESCCO14588_2996; phage(gi209427801) 6e-38 Click
21complement(4123293..4125230) PHAGE_Entero_2008: putative major head protein/prohead proteinase; ESCCO14588_2995; phage(gi209427776) 0.0 Click
22complement(4125294..4126955) PHAGE_Entero_2008: putative phage terminase-like protein large subunit; ESCCO14588_2994; phage(gi209427775) 0.0 Click
23complement(4126952..4127515) PHAGE_Entero_2008: putative phage terminase; ESCCO14588_2993; phage(gi209427774) 1e-95 Click
244128212..4128397 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ESCCO14588_2992; phage(gi209427772) 8e-19 Click
25complement(4128527..4128667) conserved hypothetical protein; ESCCO14588_2991 0.0 Click
26complement(4128754..4128876) hypothetical protein; ESCCO14588_2990 0.0 Click
27complement(4129024..4129248) conserved hypothetical protein; ESCCO14588_2989 0.0 Click
28complement(4129272..4129739) PHAGE_Entero_2008: putative endopeptidase; ESCCO14588_2988; phage(gi209427771) 5e-63 Click
29complement(4129747..4129893) PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; ESCCO14588_2987; phage(gi302861202) 2e-20 Click
30complement(4129893..4130462) PHAGE_Entero_2008: putative antirepressor; ESCCO14588_2986; phage(gi209427770) 7e-107 Click
31complement(4130733..4131266) PHAGE_Entero_2008: putative endolysin; ESCCO14588_2985; phage(gi209427769) 4e-103 Click
32complement(4131317..4131661) PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ESCCO14588_2984; phage(gi209427768) 1e-59 Click
33complement(4131666..4131881) PHAGE_Stx2_c_1717: holin protein S-like protein; ESCCO14588_2983; phage(gi209447171) 1e-34 Click
34complement(4131957..4132226) PHAGE_Escher_P13374: hypothetical protein; ESCCO14588_2982; phage(gi410491644) 1e-26 Click
35complement(4132264..4132446) PHAGE_Escher_P13374: hypothetical protein; ESCCO14588_2981; phage(gi410491643) 3e-18 Click
36complement(4132594..4134531) PHAGE_Entero_4795: hypothetical protein YjhS; ESCCO14588_2980; phage(gi157166028) 0.0 Click
37complement(4134580..4134708) conserved hypothetical protein; ESCCO14588_2979 0.0 Click
38complement(4134846..4135013) PHAGE_Entero_P1: TciB; ESCCO14588_2978; phage(gi46401695) 1e-08 Click
39complement(4135010..4135156) PHAGE_Pseudo_AF: putative tellurite resistance protein; ESCCO14588_2977; phage(gi431810338) 4e-07 Click
40complement(4135610..4136431) PHAGE_Entero_HK225: late gene regulator Q; ESCCO14588_2976; phage(gi428782441) 7e-91 Click
41complement(4136428..4136802) PHAGE_Escher_HK75: RusA-like protein; ESCCO14588_2975; phage(gi356870726) 2e-34 Click
42complement(4136815..4137864) PHAGE_Entero_mEp460: hypothetical protein; ESCCO14588_2974; phage(gi428782365) 2e-109 Click
434137947..4138126 conserved hypothetical protein; ESCCO14588_2973 0.0 Click
44complement(4138713..4138862) conserved hypothetical protein; ESCCO14588_2972 0.0 Click
45complement(4138933..4139520) PHAGE_Entero_mEp460: hypothetical protein; ESCCO14588_2971; phage(gi428782343) 7e-40 Click
46complement(4139523..4139714) PHAGE_Salmon_ST160: hypothetical protein; ESCCO14588_2970; phage(gi318065908) 5e-27 Click
47complement(4139716..4140153) PHAGE_Entero_2008: hypothetical protein YYZ_gp09; ESCCO14588_2969; phage(gi209427735) 1e-08 Click
48complement(4140140..4140262) PHAGE_Salmon_E1: hypothetical protein VIP0051; ESCCO14588_2968; phage(gi170676326) 1e-05 Click
49complement(4140411..4140728) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp27; ESCCO14588_2967; phage(gi302393109) 7e-45 Click
50complement(4140718..4141014) PHAGE_Klebsi_phiKO2: Gp58; ESCCO14588_2966; phage(gi46402144) 5e-27 Click
51complement(4141017..4141271) conserved hypothetical protein; ESCCO14588_2965 0.0 Click
52complement(4141331..4142047) conserved hypothetical protein; ESCCO14588_2964 0.0 Click
53complement(4142081..4142503) PHAGE_Escher_HK639: replication protein 14; ESCCO14588_2963; phage(gi356870655) 8e-32 Click
54complement(4142535..4143572) PHAGE_Escher_TL_2011b: hypothetical protein; ESCCO14588_2962; phage(gi418487646) 4e-48 Click
55complement(4143641..4144066) PHAGE_Pectob_ZF40: putative cII repressor; ESCCO14588_2961; phage(gi422936652) 2e-05 Click
564144498..4144974 Rac prophage repressor; ESCCO14588_2960 0.0 Click
574145212..4145442 PHAGE_Salico_CGphi29: hypothetical protein; ESCCO14588_2959; phage(gi472340166) 1e-09 Click
58complement(4145557..4146072) PHAGE_Entero_HK630: HkaP protein; ESCCO14588_2958; phage(gi428782827) 2e-12 Click
594146250..4146594 PHAGE_Entero_mEp460: putative exonuclease; ESCCO14588_2957; phage(gi428782342) 5e-34 Click
604146656..4146925 putative excisionase; ESCCO14588_2956 0.0 Click
614146894..4148012 PHAGE_Entero_mEp235: integrase; ESCCO14588_2955; phage(gi428781836) 3e-52 Click
624148179..4148973 spermidine/putrescine ABC transporter, permease protein PotC; ESCCO14588_2954 0.0 Click
634148970..4150016 spermidine/putrescine ABC transporter, periplasmic spermidine/putrescine-binding protein; ESCCO14588_2953 0.0 Click
64complement(4150172..4150993) PHAGE_Cronob_vB_CsaM_GAP32: putative Sir2-like protein; ESCCO14588_2952; phage(gi414087036) 4e-19 Click
654161543..4161557 attR    AACAATCATTAATTA 0.0 Click

Region 13, total : 86 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14378913..4380241 PHAGE_Lactob_KC5a: putative minor tail protein; ESCCO14588_2691; phage(gi90592623) 8e-06 Click
24381390..4382019 PHAGE_Stx2_c_II: putative antirepressor protein AntB; ESCCO14588_2690; phage(gi302393111) 6e-117 Click
3complement(4382384..4382563) hypothetical protein; ESCCO14588_2689 0.0 Click
44382556..4382774 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp26; ESCCO14588_2688; phage(gi302393108) 1e-37 Click
54382795..4383454 PHAGE_Stx2_c_II: hypothetical protein Stx2IIp080; ESCCO14588_2687; phage(gi302393107) 2e-128 Click
64383454..4383849 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp25; ESCCO14588_2686; phage(gi302393106) 7e-72 Click
74384415..4384759 PHAGE_Stx2_c_II: hypothetical protein Stx2IIp075; ESCCO14588_2685; phage(gi302393104) 6e-59 Click
8complement(4384839..4385027) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip069; ESCCO14588_2684; phage(gi20065864) 6e-31 Click
9complement(4385310..4393691) PHAGE_Stx1_converting: hypothetical protein Stx1_gp23; ESCCO14588_2683; phage(gi302861144) 0.0 Click
10complement(4393761..4394693) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp22; ESCCO14588_2682; phage(gi302393102) 5e-175 Click
11complement(4394745..4395635) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp77; ESCCO14588_2681; phage(gi302393160) 2e-173 Click
12complement(4395632..4395958) PHAGE_Stx2_c_II: putative transposase; ESCCO14588_2680; phage(gi302393161) 1e-57 Click
13complement(4396010..4396339) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp22; ESCCO14588_2679; phage(gi302393102) 4e-58 Click
14complement(4396350..4396601) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp21; ESCCO14588_2678; phage(gi302393101) 2e-40 Click
15complement(4396611..4397057) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp20; ESCCO14588_2677; phage(gi302393100) 2e-80 Click
16complement(4397060..4397716) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp19; ESCCO14588_2676; phage(gi302393099) 5e-122 Click
17complement(4397810..4398187) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp18; ESCCO14588_2675; phage(gi302393098) 1e-69 Click
18complement(4398268..4398408) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp17; ESCCO14588_2674; phage(gi302393097) 1e-21 Click
19complement(4398641..4399375) PHAGE_Stx2_c_II: outer membrane protein Lom precursor; ESCCO14588_2673; phage(gi302393096) 4e-140 Click
20complement(4399466..4400083) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp15; ESCCO14588_2672; phage(gi302393095) 4e-122 Click
21complement(4400089..4400367) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp14; ESCCO14588_2671; phage(gi302393094) 8e-52 Click
22complement(4400382..4401650) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp13; ESCCO14588_2670; phage(gi302393093) 0.0 Click
23complement(4401647..4403272) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp12; ESCCO14588_2669; phage(gi302393092) 0.0 Click
24complement(4403387..4403500) hypothetical protein; ESCCO14588_2668 0.0 Click
25complement(4403567..4403755) PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_2667; phage(gi418487110) 4e-31 Click
26complement(4403895..4404164) PHAGE_Stx2_c_II: putative tail fiber protein; ESCCO14588_2666; phage(gi302393091) 4e-47 Click
27complement(4404166..4406103) PHAGE_Stx2_c_II: putative tail fiber protein; ESCCO14588_2665; phage(gi302393090) 0.0 Click
28complement(4406100..4406750) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp09; ESCCO14588_2664; phage(gi302393089) 8e-123 Click
29complement(4406750..4407313) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp08; ESCCO14588_2663; phage(gi302393088) 2e-104 Click
30complement(4407297..4407758) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp07; ESCCO14588_2662; phage(gi302393087) 2e-82 Click
31complement(4407808..4408197) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp06; ESCCO14588_2661; phage(gi302393086) 2e-66 Click
32complement(4408253..4409467) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp05; ESCCO14588_2660; phage(gi302393085) 0.0 Click
33complement(4409491..4410498) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp04; ESCCO14588_2659; phage(gi302393084) 0.0 Click
34complement(4410656..4412800) PHAGE_Stx2_c_II: portal protein; ESCCO14588_2658; phage(gi302393083) 0.0 Click
35complement(4412800..4414461) PHAGE_Stx2_c_II: terminase, large subunit; ESCCO14588_2657; phage(gi302393082) 0.0 Click
36complement(4414487..4415293) PHAGE_Stx2_c_II: terminase, small subunit; ESCCO14588_2656; phage(gi302393081) 3e-151 Click
37complement(4415349..4415462) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip164; ESCCO14588_2655; phage(gi20065959) 6e-17 Click
384415702..4415995 PHAGE_Stx2_c_II: Bor protein precursor; ESCCO14588_2654; phage(gi302393169) 2e-50 Click
39complement(4416027..4416491) PHAGE_Stx2_c_II: endopeptidase Rz; ESCCO14588_2653; phage(gi302393167) 6e-83 Click
40complement(4416499..4416645) PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; ESCCO14588_2652; phage(gi302861202) 2e-20 Click
41complement(4416645..4417214) PHAGE_Stx2_c_II: putative antirepressor protein Ant; ESCCO14588_2651; phage(gi302393166) 7e-107 Click
42complement(4417485..4418018) PHAGE_Stx2_c_II: endolysin; ESCCO14588_2650; phage(gi302393165) 1e-103 Click
43complement(4418023..4418238) PHAGE_Stx2_c_II: holin; ESCCO14588_2649; phage(gi302393164) 2e-35 Click
44complement(4418315..4418587) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp80; ESCCO14588_2648; phage(gi302393163) 1e-43 Click
45complement(4418628..4418807) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp79; ESCCO14588_2647; phage(gi302393162) 2e-28 Click
46complement(4418820..4418945) PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_2646; phage(gi418487096) 7e-19 Click
47complement(4418942..4419211) PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_2645; phage(gi418487095) 8e-46 Click
484419269..4419595 PHAGE_Stx2_c_II: putative transposase; ESCCO14588_2644; phage(gi302393161) 1e-58 Click
494419592..4420482 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp77; ESCCO14588_2643; phage(gi302393160) 2e-173 Click
504420466..4420636 conserved hypothetical protein; ESCCO14588_2642 0.0 Click
51complement(4422680..4422949) PHAGE_Stx2_c_II: Shiga toxin 2 subunit B; ESCCO14588_2641; phage(gi302393158) 1e-46 Click
52complement(4422961..4423743) PHAGE_Stx2_c_II: Shiga toxin 2 subunit A; ESCCO14588_2640; phage(gi302393157) 7e-146 Click
53complement(4424010..4424088) tRNA 0.0 Click
54complement(4424100..4424178) tRNA 0.0 Click
55complement(4424187..4424262) tRNA 0.0 Click
56complement(4424303..4424455) PHAGE_Stx2_c_86: DNA modification methylase; ESCCO14588_2636; phage(gi116222073) 1e-19 Click
57complement(4424704..4425138) PHAGE_Stx2_c_II: antitermination protein Q; ESCCO14588_2635; phage(gi302393156) 8e-83 Click
58complement(4425322..4425927) PHAGE_Stx2_c_II: NinG protein; ESCCO14588_2634; phage(gi302393154) 1e-118 Click
59complement(4425927..4426649) PHAGE_Stx2_c_II: Roi protein; ESCCO14588_2633; phage(gi302393153) 5e-132 Click
60complement(4426724..4427458) PHAGE_Stx2_c_II: putative antirepressor-like protein; ESCCO14588_2632; phage(gi302393152) 7e-142 Click
614427991..4428428 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip134; ESCCO14588_2631; phage(gi20065929) 5e-21 Click
62complement(4428432..4428878) PHAGE_Stx2_c_II: NinB protein; ESCCO14588_2630; phage(gi302393148) 8e-84 Click
63complement(4428835..4429071) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp64; ESCCO14588_2629; phage(gi302393147) 2e-42 Click
64complement(4429082..4429297) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp63; ESCCO14588_2628; phage(gi302393146) 5e-35 Click
65complement(4429430..4429708) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp62; ESCCO14588_2627; phage(gi302393145) 1e-51 Click
66complement(4429779..4430048) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp61; ESCCO14588_2626; phage(gi302393144) 8e-47 Click
67complement(4430048..4431484) PHAGE_Stx2_c_II: DNA replication protein P; ESCCO14588_2625; phage(gi302393143) 0.0 Click
68complement(4431474..4432373) PHAGE_Stx1_converting: DNA replication protein O; ESCCO14588_2624; phage(gi302861180) 1e-177 Click
69complement(4432545..4432841) PHAGE_Stx2_c_II: CII protein; ESCCO14588_2623; phage(gi302393140) 2e-50 Click
704433274..4433969 PHAGE_Stx2_c_II: CI protein; ESCCO14588_2622; phage(gi302393138) 8e-135 Click
714434114..4434248 hypothetical protein; ESCCO14588_2621 0.0 Click
724434612..4434992 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp54; ESCCO14588_2620; phage(gi302393137) 8e-67 Click
734436052..4436303 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp52; ESCCO14588_2619; phage(gi302393135) 2e-44 Click
744436486..4436854 PHAGE_Stx2_c_II: Ea10 protein; ESCCO14588_2618; phage(gi302393133) 2e-67 Click
754437125..4438660 PHAGE_Entero_HK630: tail length tape measure protein H; ESCCO14588_4263; phage(gi428782803) 0.0 Click
764438612..4439376 PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; ESCCO14588_4262; phage(gi15832203) 1e-140 Click
774439373..4439702 PROPHAGE_Escher_Sakai: putative minor tail protein; ESCCO14588_4261; phage(gi15832202) 3e-60 Click
784439702..4440400 PHAGE_Stx2_c_1717: phage minor tail protein L; ESCCO14588_4260; phage(gi209447192) 5e-132 Click
794440519..4441154 PROPHAGE_Escher_Sakai: putative tail assembly protein; ESCCO14588_4259; phage(gi15832200) 7e-129 Click
804441151..4441729 PROPHAGE_Escher_Sakai: putative tail assembly protein; ESCCO14588_4258; phage(gi15832199) 6e-103 Click
814441775..4441894 hypothetical protein; ESCCO14588_4257 0.0 Click
824441970..4443145 PHAGE_Entero_4795: putative tail component; ESCCO14588_4256; phage(gi157166057) 0.0 Click
834443115..4445448 PHAGE_Entero_2008: phage-related tail protein; ESCCO14588_4255; phage(gi209427791) 0.0 Click
844445516..4446115 PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ESCCO14588_4254; phage(gi209427792) 2e-114 Click
85complement(4446116..4446244) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; ESCCO14588_4253; phage(gi157166059) 8e-19 Click
86complement(4446403..4447263) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip024; ESCCO14588_4252; phage(gi20065820) 1e-34 Click
874447215..4447493 PHAGE_Stx2_c_II: putative tail fiber protein; ESCCO14588_4251; phage(gi302393090) 5e-48 Click
884447495..4447764 PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ESCCO14588_4250; phage(gi209427794) 5e-46 Click
89complement(4447890..4448600) PHAGE_Macaci_1: large tegument protein; ESCCO14588_4249; phage(gi30984464) 8e-10 Click

Region 14, total : 31 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14499288..4499299 attL    ATTTATGTGATA 0.0 Click
24505289..4506479 PROPHAGE_Escher_MG1655: IS30 transposase; ESCCO14588_4174; phage(gi16132105) 0.0 Click
3complement(4506430..4506753) PHAGE_Entero_PsP3: gp26; ESCCO14588_4175; phage(gi41057378) 1e-14 Click
4complement(4506800..4506931) hypothetical protein; ESCCO14588_4173 0.0 Click
54506911..4508095 PHAGE_Erwini_ENT90: tail sheath protein; ESCCO14588_4172; phage(gi431810939) 7e-101 Click
64508095..4508607 PHAGE_Entero_PsP3: gp22; ESCCO14588_4171; phage(gi41057374) 2e-32 Click
74508662..4509027 PROPHAGE_Salmon_Ty2: putative phage tail protein; ESCCO14588_4170; phage(gi29143760) 2e-06 Click
84509063..4509191 PHAGE_Entero_PsP3: gp23.5; ESCCO14588_4169; phage(gi41057394) 3e-06 Click
94509178..4511268 PHAGE_Entero_PsP3: gp24; ESCCO14588_4168; phage(gi41057376) 7e-90 Click
104511280..4511981 putative tail fiber protein of prophage CP-933T; ESCCO14588_4167 0.0 Click
114511994..4512482 PHAGE_Entero_PsP3: gp25; ESCCO14588_4166; phage(gi41057377) 2e-32 Click
124512735..4513211 putative serine acetlyltransferase of prophage CP-933T; ESCCO14588_4165 0.0 Click
13complement(4513255..4513671) PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; ESCCO14588_4164; phage(gi16129505) 5e-66 Click
144513842..4514168 PHAGE_Entero_4795: putative transposase OrfA protein of IS629; ESCCO14588_4163; phage(gi157166066) 9e-58 Click
154514168..4514857 PROPHAGE_Escher_EDL933: transposase for IS629; ESCCO14588_4162; phage(gi15801145) 3e-129 Click
16complement(4515196..4516155) plasmid segregation protein ParM; ESCCO14588_4161 0.0 Click
17complement(4516232..4519054) PHAGE_Entero_PsP3: gp36; ESCCO14588_4160; phage(gi41057388) 1e-86 Click
18complement(4519061..4519426) conserved hypothetical protein; ESCCO14588_4159 0.0 Click
19complement(4519499..4519729) conserved domain protein; ESCCO14588_4158 0.0 Click
20complement(4520052..4520351) PHAGE_Entero_mEp213: hypothetical protein; ESCCO14588_4157; phage(gi428782624) 9e-08 Click
21complement(4520348..4520614) conserved hypothetical protein; ESCCO14588_4156 0.0 Click
22complement(4520611..4520814) conserved hypothetical protein; ESCCO14588_4155 0.0 Click
23complement(4520838..4521254) conserved hypothetical protein; ESCCO14588_4154 0.0 Click
24complement(4521347..4521460) hypothetical protein; ESCCO14588_4153 0.0 Click
25complement(4521457..4521699) conserved hypothetical protein; ESCCO14588_4152 0.0 Click
26complement(4521711..4521989) conserved hypothetical protein; ESCCO14588_4151 0.0 Click
27complement(4522000..4522350) conserved hypothetical protein; ESCCO14588_4150 0.0 Click
28complement(4522372..4522575) PHAGE_Vibrio_kappa: putative regulator; ESCCO14588_4149; phage(gi165970239) 6e-10 Click
294523141..4523278 putative transcriptional regulator; ESCCO14588_4148 0.0 Click
304523294..4523944 conserved hypothetical protein; ESCCO14588_4147 0.0 Click
314523974..4524321 conserved hypothetical protein; ESCCO14588_4146 0.0 Click
324524305..4524316 attR    ATTTATGTGATA 0.0 Click
334524327..4525328 PHAGE_Haemop_HP2: integrase; ESCCO14588_4145; phage(gi17981816) 3e-105 Click

Region 15, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4863282..4863842) PHAGE_Bacill_SPBc2: hypothetical protein SPBc2p012; ESCCO14588_3784; phage(gi9630137) 1e-08 Click
2complement(4863877..4864218) conserved hypothetical protein; ESCCO14588_3783 0.0 Click
34864353..4864679 conserved hypothetical protein; ESCCO14588_3782 0.0 Click
4complement(4864942..4865148) PHAGE_Entero_2008: putative integrase; ESCCO14588_3781; phage(gi209427727) 1e-18 Click
5complement(4865478..4865633) PHAGE_Entero_2008: putative integrase; ESCCO14588_3780; phage(gi209427727) 1e-08 Click
6complement(4865668..4865919) PHAGE_Entero_2008: putative excisionase; ESCCO14588_3779; phage(gi209427728) 6e-17 Click
7complement(4865992..4868226) PHAGE_Entero_mEp460: putative exonuclease; ESCCO14588_3778; phage(gi428782342) 3e-58 Click
84868306..4869959 PHAGE_Entero_2008: phage-related tail protein; ESCCO14588_3721; phage(gi209427791) 0.0 Click
94870027..4870626 PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ESCCO14588_3720; phage(gi209427792) 2e-114 Click
104870691..4871914 PHAGE_Entero_2008: putative tail protein; ESCCO14588_3719; phage(gi209427793) 0.0 Click
114871916..4872185 PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ESCCO14588_3718; phage(gi209427794) 5e-45 Click
124872539..4872874 PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ESCCO14588_3717; phage(gi209427795) 2e-19 Click
134873010..4873576 PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ESCCO14588_3716; phage(gi209427795) 1e-78 Click
144873658..4874299 PHAGE_Entero_2008: hypothetical protein YYZ_gp73; ESCCO14588_3715; phage(gi209427796) 7e-117 Click
15complement(4874461..4874667) PHAGE_Entero_2008: putative DNA damage-inducible protein; ESCCO14588_3714; phage(gi209427797) 5e-28 Click
164874835..4876118 PHAGE_Burkho_phi1026b: gp59; ESCCO14588_3713; phage(gi38707949) 2e-33 Click
174876207..4877667 PHAGE_Microm_MpV1: hypothetical protein; ESCCO14588_3712; phage(gi313768442) 4e-41 Click
18complement(4877703..4877906) PHAGE_Salmon_SSU5: putative selenium-binding protein YdfZ; ESCCO14588_3711; phage(gi410491512) 1e-13 Click

Region 16, total : 72 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15049409..5049423 attL    AAATCAGTTTATCAA 0.0 Click
2complement(5058234..5058875) PHAGE_Entero_2008: hypothetical protein YYZ_gp73; ESCCO14588_3547; phage(gi209427796) 2e-119 Click
3complement(5058957..5059523) PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ESCCO14588_3546; phage(gi209427795) 4e-79 Click
4complement(5059659..5059994) PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ESCCO14588_3545; phage(gi209427795) 2e-19 Click
5complement(5060246..5060374) hypothetical protein; ESCCO14588_3544 0.0 Click
6complement(5060618..5060896) PHAGE_Entero_2008: putative tail protein; ESCCO14588_3543; phage(gi209427793) 2e-50 Click
75060848..5061708 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip024; ESCCO14588_3542; phage(gi20065820) 1e-38 Click
85061867..5061995 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; ESCCO14588_3541; phage(gi157166059) 8e-19 Click
9complement(5061996..5062595) PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ESCCO14588_3540; phage(gi209427792) 6e-112 Click
10complement(5062666..5066163) PHAGE_Entero_2008: phage-related tail protein; ESCCO14588_3539; phage(gi209427791) 0.0 Click
11complement(5066266..5066412) hypothetical protein; ESCCO14588_3538 0.0 Click
125066375..5066824 PHAGE_Salmon_1: hypothetical bacteriophage protein; ESCCO14588_3537; phage(gi169257202) 2e-59 Click
13complement(5067015..5067596) PHAGE_Entero_2008: putative tail assembly protein; ESCCO14588_3536; phage(gi209427790) 4e-101 Click
14complement(5067593..5068336) PHAGE_Entero_2008: putative tail component K-like protein; ESCCO14588_3535; phage(gi209427789) 2e-140 Click
15complement(5068347..5069045) PHAGE_Entero_2008: putative tail protein; ESCCO14588_3534; phage(gi209427787) 1e-126 Click
16complement(5069045..5069386) PHAGE_Entero_2008: putative minor tail protein; ESCCO14588_3533; phage(gi209427786) 1e-63 Click
17complement(5069379..5072459) PHAGE_Entero_2008: putative tail protein; ESCCO14588_3532; phage(gi209427785) 0.0 Click
18complement(5072511..5072714) PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ESCCO14588_3531; phage(gi209427784) 3e-32 Click
19complement(5072816..5073190) PHAGE_Entero_2008: putative tail assembly protein; ESCCO14588_3530; phage(gi209427783) 2e-65 Click
20complement(5073196..5073912) PHAGE_Entero_2008: putative tail protein; ESCCO14588_3529; phage(gi209427782) 2e-122 Click
21complement(5073981..5074325) PHAGE_Entero_2008: putative prophage structural protein; ESCCO14588_3528; phage(gi209427781) 3e-59 Click
22complement(5074322..5074768) PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ESCCO14588_3527; phage(gi209427780) 6e-79 Click
23complement(5074765..5075115) PHAGE_Entero_2008: putative head-tail adaptor; ESCCO14588_3526; phage(gi209427779) 8e-62 Click
24complement(5075125..5075451) PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ESCCO14588_3525; phage(gi209427778) 9e-56 Click
25complement(5075448..5076671) PHAGE_Entero_2008: putative portal protein; ESCCO14588_3524; phage(gi209427777) 0.0 Click
26complement(5076668..5077972) PHAGE_Entero_2008: putative portal protein; ESCCO14588_3523; phage(gi209427777) 0.0 Click
27complement(5077978..5078199) PHAGE_Entero_2008: hypothetical protein YYZ_gp53; ESCCO14588_3522; phage(gi209427801) 6e-36 Click
28complement(5078244..5080181) PHAGE_Entero_2008: putative major head protein/prohead proteinase; ESCCO14588_3521; phage(gi209427776) 0.0 Click
29complement(5080245..5081906) PHAGE_Entero_2008: putative phage terminase-like protein large subunit; ESCCO14588_3520; phage(gi209427775) 0.0 Click
30complement(5081903..5082466) PHAGE_Entero_2008: putative phage terminase; ESCCO14588_3519; phage(gi209427774) 2e-96 Click
31complement(5082755..5083120) PHAGE_Entero_2008: putative DNAse; ESCCO14588_3518; phage(gi209427773) 3e-56 Click
325083162..5083362 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ESCCO14588_3517; phage(gi209427772) 1e-20 Click
33complement(5083494..5083820) TonB family C- domain protein; ESCCO14588_3516 0.0 Click
34complement(5084159..5084617) PHAGE_Entero_2008: putative endopeptidase; ESCCO14588_3515; phage(gi209427771) 2e-69 Click
35complement(5084629..5084760) PHAGE_Escher_P13374: hypothetical protein; ESCCO14588_3514; phage(gi410491648) 3e-15 Click
36complement(5084770..5084895) hypothetical protein; ESCCO14588_3513 0.0 Click
37complement(5084855..5085550) PHAGE_Cronob_ENT47670: phage antirepressor protein; ESCCO14588_3512; phage(gi431810509) 2e-50 Click
38complement(5085824..5086357) PHAGE_Entero_2008: putative endolysin; ESCCO14588_3511; phage(gi209427769) 2e-101 Click
39complement(5086408..5086752) PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ESCCO14588_3510; phage(gi209427768) 1e-56 Click
40complement(5086757..5086972) PHAGE_Stx2_c_1717: holin protein S-like protein; ESCCO14588_3509; phage(gi209447171) 1e-33 Click
41complement(5087122..5088975) PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ESCCO14588_3508; phage(gi209427766) 0.0 Click
42complement(5089386..5089553) PHAGE_Entero_P1: TciB; ESCCO14588_3507; phage(gi46401695) 1e-08 Click
43complement(5089550..5089981) PHAGE_Pseudo_AF: putative tellurite resistance protein; ESCCO14588_3506; phage(gi431810338) 3e-30 Click
44complement(5090150..5090228) tRNA 0.0 Click
45complement(5090328..5090403) tRNA 0.0 Click
46complement(5090543..5091097) PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; ESCCO14588_3503; phage(gi399528832) 7e-07 Click
47complement(5091094..5091384) PHAGE_Erwini_phiEt88: hypothetical protein; ESCCO14588_3502; phage(gi327198620) 2e-34 Click
48complement(5091384..5091983) PHAGE_Gifsy_2: hypothetical protein STM1020.Gifsy2; ESCCO14588_3501; phage(gi169257286) 6e-55 Click
495092753..5093874 conserved hypothetical protein; ESCCO14588_3500 0.0 Click
505093874..5094863 conserved hypothetical protein; ESCCO14588_3498 0.0 Click
51complement(5094831..5095982) PHAGE_Ostreo_2: putative cytosine-specific methyltransferase; ESCCO14588_3499; phage(gi314055145) 7e-27 Click
52complement(5096414..5096536) PHAGE_Entero_N15: gp45; ESCCO14588_3497; phage(gi9630511) 1e-05 Click
53complement(5096738..5096899) PHAGE_Salmon_c341: Truncated P22 EaA protein; ESCCO14588_3496; phage(gi255252704) 1e-15 Click
54complement(5096910..5097173) PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; ESCCO14588_3495; phage(gi399498823) 3e-23 Click
55complement(5097425..5097637) conserved hypothetical protein; ESCCO14588_3494 0.0 Click
56complement(5097743..5098165) conserved hypothetical protein; ESCCO14588_3493 0.0 Click
57complement(5098181..5098942) conserved hypothetical protein; ESCCO14588_3492 0.0 Click
58complement(5098965..5099711) PHAGE_Gifsy_2: bacteriophage DNA replication protein; ESCCO14588_3491; phage(gi169257280) 2e-76 Click
59complement(5099718..5100506) PHAGE_Escher_TL_2011b: hypothetical protein; ESCCO14588_3490; phage(gi418487646) 5e-44 Click
60complement(5100584..5101006) PHAGE_Entero_mEp237: CII protein; ESCCO14588_3489; phage(gi435439306) 1e-08 Click
61complement(5101003..5101257) PHAGE_Escher_HK75: regulatory protein cro; ESCCO14588_3488; phage(gi356870715) 5e-19 Click
625101337..5101756 PHAGE_Entero_HK022: regulatory protein cI; ESCCO14588_3487; phage(gi19343388) 4e-21 Click
635102044..5102178 conserved hypothetical protein; ESCCO14588_3486 0.0 Click
645102189..5102344 PHAGE_Salico_CGphi29: hypothetical protein; ESCCO14588_3484; phage(gi472340166) 7e-10 Click
65complement(5102341..5102571) superinfection exclusion protein B; ESCCO14588_3485 0.0 Click
665103271..5103492 PHAGE_Escher_P13374: host killing protein; ESCCO14588_3483; phage(gi410491620) 8e-06 Click
675103486..5103662 PHAGE_Gifsy_1: hypothetical protein STM2630.Gifsy1; ESCCO14588_3482; phage(gi169257260) 4e-06 Click
685103689..5104012 putative bacteriophage protein; ESCCO14588_3481 0.0 Click
695104114..5106714 PHAGE_Erwini_phiEt88: exodeoxyribonuclease; ESCCO14588_3480; phage(gi327198600) 8e-83 Click
705106707..5107516 PHAGE_Entero_epsilon15: RecT; ESCCO14588_3479; phage(gi30387413) 1e-80 Click
71complement(5107588..5107710) hypothetical protein; ESCCO14588_3478 0.0 Click
725107759..5107947 conserved hypothetical protein; ESCCO14588_3477 0.0 Click
735108047..5108262 conserved hypothetical protein; ESCCO14588_3476 0.0 Click
745108238..5108252 attR    AAATCAGTTTATCAA 0.0 Click
755108264..5109499 PHAGE_Entero_2008: putative integrase; integrase;; phage ESCCO14588_3475(gi209427727) 3e-90 Click
765109551..5110486 PHAGE_Parame_FR483: hypothetical protein FR483_N404R; ESCCO14588_3474; phage(gi155370502) 3e-08 Click

Region 17, total : 63 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(5215724..5215894) PHAGE_Entero_phiP27: hypothetical protein P27p57; ESCCO14588_3365; phage(gi18249921) 3e-10 Click
2complement(5216272..5216862) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp23; ESCCO14588_3364; phage(gi148609405) 4e-09 Click
3complement(5217038..5217433) PROPHAGE_Escher_MG1655: IS1 transposase B; ESCCO14588_3363; phage(gi16131317) 1e-66 Click
4complement(5217460..5217735) PHAGE_Entero_P1: InsA; ESCCO14588_3362; phage(gi46401643) 5e-46 Click
55217945..5217980 attL    ACATGACAACAAAAACCGGAGCCGGACTCCGGTTTT 0.0 Click
6complement(5217995..5218264) PHAGE_Stx2_c_II: putative tail fiber protein; ESCCO14588_3361; phage(gi302393091) 9e-43 Click
7complement(5218266..5218544) PHAGE_Entero_2008: putative tail protein; ESCCO14588_3360; phage(gi209427793) 3e-51 Click
85218496..5219356 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip024; ESCCO14588_3359; phage(gi20065820) 2e-34 Click
95219515..5219643 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; ESCCO14588_3358; phage(gi157166059) 8e-19 Click
10complement(5219644..5220243) PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; ESCCO14588_3357; phage(gi148609401) 2e-108 Click
11complement(5220311..5223787) PHAGE_Entero_cdtI: putative tail tip assembly protein; ESCCO14588_3356; phage(gi148609400) 0.0 Click
12complement(5223863..5223982) hypothetical protein; ESCCO14588_3355 0.0 Click
13complement(5224028..5224606) PHAGE_Stx2_c_1717: putative tail component; ESCCO14588_3354; phage(gi209447195) 2e-102 Click
14complement(5224603..5225238) PHAGE_Entero_cdtI: putative tail protein; ESCCO14588_3353; phage(gi148609398) 1e-112 Click
15complement(5225357..5226055) PHAGE_Entero_4795: putative tail fiber component; ESCCO14588_3352; phage(gi157166054) 8e-132 Click
16complement(5226055..5226384) PROPHAGE_Escher_Sakai: putative minor tail protein; ESCCO14588_3351; phage(gi15832202) 3e-60 Click
17complement(5226381..5229026) PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; ESCCO14588_3350; phage(gi15832203) 0.0 Click
18complement(5229070..5229378) PROPHAGE_Escher_Sakai: putative minor tail protein; ESCCO14588_3349; phage(gi15832204) 2e-57 Click
19complement(5229405..5229827) PROPHAGE_Escher_Sakai: putative minor tail protein; ESCCO14588_3348; phage(gi15832205) 1e-74 Click
20complement(5229841..5230593) PHAGE_Entero_HK630: major tail protein V; ESCCO14588_3347; phage(gi428782800) 1e-112 Click
21complement(5230601..5230999) PROPHAGE_Escher_Sakai: putative minor tail protein U; ESCCO14588_3346; phage(gi15832207) 1e-72 Click
22complement(5231012..5231635) PROPHAGE_Escher_Sakai: putative minor tail protein; ESCCO14588_3345; phage(gi15832208) 3e-111 Click
23complement(5231638..5231886) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp07; ESCCO14588_3344; phage(gi148609389) 7e-13 Click
24complement(5231912..5232238) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp06; ESCCO14588_3343; phage(gi148609388) 2e-22 Click
25complement(5232326..5234281) PHAGE_Entero_cdtI: putative protease/scaffold protein; ESCCO14588_3342; phage(gi148609387) 0.0 Click
26complement(5234295..5235797) PHAGE_Entero_cdtI: putative portal protein; ESCCO14588_3341; phage(gi148609386) 0.0 Click
27complement(5235797..5236009) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp03; ESCCO14588_3340; phage(gi148609385) 2e-24 Click
28complement(5236006..5238129) PHAGE_Entero_cdtI: putative large terminase subunit; ESCCO14588_3339; phage(gi148609384) 0.0 Click
29complement(5238126..5238602) PHAGE_Entero_mEp460: terminase small subunit; ESCCO14588_3338; phage(gi428782317) 2e-46 Click
30complement(5239021..5239245) conserved hypothetical protein; ESCCO14588_3337 0.0 Click
31complement(5239242..5239736) PHAGE_Entero_4795: putative endopeptidase Rz; ESCCO14588_3336; phage(gi157166036) 9e-74 Click
32complement(5240035..5240568) PHAGE_Stx2_c_II: endolysin; ESCCO14588_3335; phage(gi302393165) 2e-102 Click
33complement(5240573..5240788) PHAGE_Stx2_c_II: holin; ESCCO14588_3334; phage(gi302393164) 4e-35 Click
34complement(5240865..5241137) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF45; ESCCO14588_3333; phage(gi157166030) 2e-43 Click
35complement(5241178..5241357) PHAGE_Escher_P13374: hypothetical protein; ESCCO14588_3332; phage(gi410491643) 1e-27 Click
36complement(5241494..5243440) PHAGE_Stx1_converting: hypothetical protein Stx1_gp75; ESCCO14588_3331; phage(gi302861197) 0.0 Click
37complement(5243604..5243723) hypothetical protein; ESCCO14588_3330 0.0 Click
38complement(5243944..5245002) PHAGE_Entero_cdtI: putative DNA methylase; ESCCO14588_3329; phage(gi148609438) 7e-175 Click
39complement(5245153..5245350) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp55; ESCCO14588_3328; phage(gi148609437) 8e-09 Click
40complement(5245577..5246398) PHAGE_Entero_HK225: late gene regulator Q; ESCCO14588_3327; phage(gi428782441) 5e-92 Click
41complement(5246395..5246769) PHAGE_Escher_HK75: RusA-like protein; ESCCO14588_3326; phage(gi356870726) 2e-35 Click
42complement(5246782..5247831) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp51; ESCCO14588_3325; phage(gi148609433) 2e-102 Click
43complement(5247833..5248111) PHAGE_Cronob_phiES15: hypothetical protein; ESCCO14588_3324; phage(gi401817580) 9e-13 Click
44complement(5248177..5248344) hypothetical protein; ESCCO14588_3323 0.0 Click
45complement(5249024..5249173) conserved hypothetical protein; ESCCO14588_3322 0.0 Click
46complement(5249244..5249606) PHAGE_Entero_HK022: hypothetical protein HK022p33; ESCCO14588_3321; phage(gi19343382) 1e-62 Click
47complement(5249603..5249974) PHAGE_Entero_cdtI: Valyl-tRNA synthetase; ESCCO14588_3320; phage(gi148609417) 2e-10 Click
48complement(5250010..5250222) conserved hypothetical protein; ESCCO14588_3319 0.0 Click
49complement(5250271..5250627) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip073; ESCCO14588_3318; phage(gi20065868) 1e-07 Click
50complement(5250684..5251079) conserved hypothetical protein; ESCCO14588_3317 0.0 Click
51complement(5251095..5251865) conserved hypothetical protein; ESCCO14588_3316 0.0 Click
52complement(5251895..5252635) PHAGE_Gifsy_2: bacteriophage DNA replication protein; ESCCO14588_3315; phage(gi169257280) 2e-74 Click
53complement(5252642..5253520) PHAGE_Entero_phiP27: hypothetical protein P27p17; ESCCO14588_3314; phage(gi18249881) 5e-26 Click
54complement(5253618..5254043) PHAGE_Escher_HK639: cII; ESCCO14588_3313; phage(gi356870652) 3e-05 Click
555254405..5254794 PHAGE_Entero_mEp237: hypothetical protein; ESCCO14588_3312; phage(gi435439303) 3e-20 Click
565254963..5255115 PHAGE_Salico_CGphi29: hypothetical protein; ESCCO14588_3311; phage(gi472340166) 1e-08 Click
575255127..5255432 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_3309; phage(gi418487085) 2e-06 Click
58complement(5255419..5255724) conserved hypothetical protein; ESCCO14588_3310 0.0 Click
59complement(5256089..5256259) conserved hypothetical protein; ESCCO14588_3308 0.0 Click
605256533..5256661 conserved hypothetical protein; ESCCO14588_3307 0.0 Click
615256754..5259198 PHAGE_Entero_mEp460: putative exonuclease; ESCCO14588_3306; phage(gi428782342) 9e-59 Click
625259489..5260619 PHAGE_Entero_mEp235: integrase; ESCCO14588_3305; phage(gi428781836) 5e-56 Click
63complement(5260665..5260781) outer membrane protein W; ESCCO14588_3304 0.0 Click
64complement(5261222..5261359) conserved hypothetical protein; ESCCO14588_3303 0.0 Click
65complement(5261919..5262347) PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ESCCO14588_3302; phage(gi209427795) 6e-24 Click
665271706..5271741 attR    ACATGACAACAAAAACCGGAGCCGGACTCCGGTTTT 0.0 Click

Region 18, total : 58 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15265020..5265031 attL    CGGCGGACTGTT 0.0 Click
2complement(5275829..5276098) PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ESCCO14588_3288; phage(gi209427794) 1e-43 Click
3complement(5276100..5277413) PHAGE_Entero_2008: putative tail protein; ESCCO14588_3287; phage(gi209427793) 0.0 Click
4complement(5277565..5278164) PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ESCCO14588_3286; phage(gi209427792) 1e-94 Click
5complement(5278232..5281708) PHAGE_Entero_2008: phage-related tail protein; ESCCO14588_3285; phage(gi209427791) 0.0 Click
6complement(5281775..5281918) hypothetical protein; ESCCO14588_3284 0.0 Click
7complement(5281896..5282333) PHAGE_Entero_2008: putative tail protein; ESCCO14588_3283; phage(gi209427787) 2e-64 Click
8complement(5282333..5282674) PHAGE_Entero_2008: putative minor tail protein; ESCCO14588_3282; phage(gi209427786) 4e-64 Click
9complement(5282667..5285747) PHAGE_Entero_2008: putative tail protein; ESCCO14588_3281; phage(gi209427785) 0.0 Click
10complement(5285800..5286003) PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ESCCO14588_3280; phage(gi209427784) 3e-32 Click
11complement(5286105..5286479) PHAGE_Entero_2008: putative tail assembly protein; ESCCO14588_3279; phage(gi209427783) 2e-65 Click
12complement(5286485..5287201) PHAGE_Entero_2008: putative tail protein; ESCCO14588_3278; phage(gi209427782) 3e-120 Click
13complement(5287260..5287604) PHAGE_Entero_2008: putative prophage structural protein; ESCCO14588_3277; phage(gi209427781) 6e-60 Click
14complement(5287601..5288047) PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ESCCO14588_3276; phage(gi209427780) 6e-79 Click
15complement(5288044..5288394) PHAGE_Entero_2008: putative head-tail adaptor; ESCCO14588_3275; phage(gi209427779) 8e-62 Click
16complement(5288404..5288730) PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ESCCO14588_3274; phage(gi209427778) 3e-55 Click
17complement(5288834..5288991) PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; ESCCO14588_4264; phage(gi169257231) 1e-13 Click
18complement(5289028..5290533) PHAGE_Gifsy_1: bacteriophage prohead protease; Lambda gpC homolog; ESCCO14588_4265; phage(gi169257232) 4e-175 Click
19complement(5290523..5292115) PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; ESCCO14588_4266; phage(gi169257233) 0.0 Click
20complement(5292112..5292318) PHAGE_Entero_mEp237: head-tail connector; ESCCO14588_4267; phage(gi435439268) 1e-13 Click
21complement(5292302..5294230) PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; ESCCO14588_4268; phage(gi169257235) 0.0 Click
22complement(5294202..5294711) PHAGE_Entero_N15: gp1; ESCCO14588_4269; phage(gi9630465) 4e-19 Click
235295166..5295330 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ESCCO14588_4270; phage(gi209427772) 1e-08 Click
245295729..5295842 conserved hypothetical protein; ESCCO14588_4271 0.0 Click
25complement(5295968..5296108) conserved hypothetical protein; ESCCO14588_4272 0.0 Click
26complement(5296191..5296658) PHAGE_Entero_2008: putative endopeptidase; ESCCO14588_4273; phage(gi209427771) 7e-67 Click
27complement(5296810..5296956) conserved hypothetical protein; ESCCO14588_4274 0.0 Click
28complement(5297148..5297681) PHAGE_Entero_2008: putative endolysin; ESCCO14588_4275; phage(gi209427769) 2e-99 Click
29complement(5297732..5298076) PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ESCCO14588_4276; phage(gi209427768) 6e-60 Click
30complement(5298081..5298287) PHAGE_Entero_2008: lysis protein; ESCCO14588_4277; phage(gi209427767) 1e-32 Click
315298607..5298933 PHAGE_Stx2_c_II: putative transposase; ESCCO14588_4278; phage(gi302393161) 1e-58 Click
325298930..5299820 PROPHAGE_Escher_Sakai: putative transposase; ESCCO14588_4279; phage(gi15834498) 2e-173 Click
33complement(5299902..5301752) PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ESCCO14588_4280; phage(gi209427766) 0.0 Click
34complement(5301801..5301923) conserved hypothetical protein; ESCCO14588_4281 0.0 Click
35complement(5302066..5302233) PHAGE_Entero_P1: TciB; ESCCO14588_4282; phage(gi46401695) 3e-08 Click
36complement(5302230..5302658) PHAGE_Pseudo_AF: putative tellurite resistance protein; ESCCO14588_4283; phage(gi431810338) 2e-26 Click
37complement(5302831..5302909) tRNA 0.0 Click
38complement(5302921..5302999) tRNA 0.0 Click
39complement(5303006..5303081) tRNA 0.0 Click
40complement(5303139..5303261) hypothetical protein; ESCCO14588_4287 0.0 Click
41complement(5303292..5303981) PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ESCCO14588_4288; phage(gi169257244) 9e-80 Click
42complement(5303978..5304337) PHAGE_Escher_HK75: RusA-like protein; ESCCO14588_4289; phage(gi356870726) 1e-37 Click
43complement(5304350..5305399) PHAGE_Entero_mEp460: hypothetical protein; ESCCO14588_4290; phage(gi428782365) 4e-111 Click
445305671..5305805 hypothetical bacteriophage protein; ESCCO14588_4291 0.0 Click
45complement(5306246..5306395) conserved hypothetical protein; ESCCO14588_4292 0.0 Click
46complement(5306460..5307023) PHAGE_Entero_mEp460: hypothetical protein; ESCCO14588_4293; phage(gi428782343) 5e-41 Click
47complement(5307150..5307461) PHAGE_Entero_mEp213: hypothetical protein; ESCCO14588_4294; phage(gi428782634) 2e-24 Click
48complement(5307643..5307999) PHAGE_Entero_HK629: hypothetical protein; ESCCO14588_4295; phage(gi428782046) 9e-16 Click
49complement(5308242..5308940) conserved hypothetical protein; ESCCO14588_4296 0.0 Click
50complement(5308975..5309397) PHAGE_Escher_HK639: replication protein 14; ESCCO14588_4297; phage(gi356870655) 5e-31 Click
51complement(5309429..5310466) PHAGE_Escher_TL_2011b: hypothetical protein; ESCCO14588_4298; phage(gi418487646) 1e-46 Click
52complement(5310535..5310960) PHAGE_Pectob_ZF40: putative cII repressor; ESCCO14588_4299; phage(gi422936652) 4e-06 Click
535311267..5311926 PHAGE_Entero_mEp390: prophage repressor; ESCCO14588_4300; phage(gi428782701) 2e-25 Click
545312201..5312353 PHAGE_Salico_CGphi29: hypothetical protein; ESCCO14588_4301; phage(gi472340166) 1e-08 Click
55complement(5312686..5312805) conserved hypothetical protein; ESCCO14588_4302 0.0 Click
565312834..5313022 conserved domain protein; ESCCO14588_4303 0.0 Click
575313019..5313207 conserved hypothetical protein; ESCCO14588_4304 0.0 Click
585313303..5315774 PHAGE_Salmon_ST64B: Endodeoxyribonuclease; ESCCO14588_4305; phage(gi23505474) 1e-55 Click
595315833..5316036 conserved hypothetical protein; ESCCO14588_4306 0.0 Click
605316036..5317058 PHAGE_Salmon_ST64B: Integrase protein; ESCCO14588_4307; phage(gi23505472) 2e-102 Click
61complement(5317110..5317201) tRNA 0.0 Click
625317294..5318091 Mlc titration factor MtfA; ESCCO14588_4309 0.0 Click
635318191..5318268 tRNA 0.0 Click
645318216..5318227 attR    CGGCGGACTGTT 0.0 Click
655318701..5326563 PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; ESCCO14588_4311; phage(gi414087138) 4e-27 Click

Region 19, total : 122 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15488889..5488900 attL    AACCTGCCTCAC 0.0 Click
2complement(5497394..5499079) PHAGE_Entero_2008: putative 2-component sensor protein YehU; ESCCO14588_4483; phage(gi209427798) 0.0 Click
35499168..5499296 hypothetical protein; ESCCO14588_4484 0.0 Click
45499338..5499478 hypothetical protein; ESCCO14588_4485 0.0 Click
55499594..5499842 PHAGE_Entero_2008: putative DNA damage-inducible protein; ESCCO14588_4486; phage(gi209427797) 3e-40 Click
6complement(5500210..5500479) PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ESCCO14588_4487; phage(gi209427794) 3e-44 Click
7complement(5500481..5500759) PHAGE_Entero_2008: putative tail protein; ESCCO14588_4488; phage(gi209427793) 2e-48 Click
85500711..5501571 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip024; ESCCO14588_4489; phage(gi20065820) 1e-38 Click
95501730..5501858 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; ESCCO14588_4490; phage(gi157166059) 8e-19 Click
10complement(5501859..5502458) PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ESCCO14588_4491; phage(gi209427792) 2e-114 Click
11complement(5502526..5502741) PHAGE_Entero_2008: phage-related tail protein; ESCCO14588_4492; phage(gi209427791) 2e-18 Click
12complement(5502744..5504855) PHAGE_Entero_2008: phage-related tail protein; ESCCO14588_4493; phage(gi209427791) 0.0 Click
13complement(5504825..5506000) PHAGE_Entero_2008: phage-related tail protein; ESCCO14588_4494; phage(gi209427791) 0.0 Click
14complement(5506342..5506923) PHAGE_Entero_2008: putative tail assembly protein; ESCCO14588_4495; phage(gi209427790) 2e-101 Click
15complement(5506920..5507555) PHAGE_Entero_2008: putative tail component K-like protein; ESCCO14588_4496; phage(gi209427789) 3e-120 Click
16complement(5507674..5508372) PHAGE_Entero_2008: putative tail protein; ESCCO14588_4497; phage(gi209427787) 5e-127 Click
17complement(5508372..5508713) PHAGE_Entero_2008: putative minor tail protein; ESCCO14588_4498; phage(gi209427786) 4e-64 Click
18complement(5508706..5511948) PHAGE_Entero_2008: putative tail protein; ESCCO14588_4499; phage(gi209427785) 0.0 Click
19complement(5511996..5512199) PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ESCCO14588_4500; phage(gi209427784) 6e-33 Click
20complement(5512301..5512675) PHAGE_Entero_2008: putative tail assembly protein; ESCCO14588_4501; phage(gi209427783) 4e-67 Click
21complement(5512690..5513406) PHAGE_Entero_2008: putative tail protein; ESCCO14588_4502; phage(gi209427782) 1e-131 Click
22complement(5513472..5513816) PHAGE_Entero_2008: putative prophage structural protein; ESCCO14588_4503; phage(gi209427781) 6e-60 Click
23complement(5513813..5514259) PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ESCCO14588_4504; phage(gi209427780) 6e-79 Click
24complement(5514256..5514606) PHAGE_Entero_2008: putative head-tail adaptor; ESCCO14588_4505; phage(gi209427779) 8e-62 Click
25complement(5514616..5514942) PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ESCCO14588_4506; phage(gi209427778) 3e-55 Click
26complement(5514945..5517524) PHAGE_Entero_2008: putative portal protein; ESCCO14588_4507; phage(gi209427777) 0.0 Click
27complement(5517540..5517689) PHAGE_Entero_2008: hypothetical protein YYZ_gp53; ESCCO14588_4508; phage(gi209427801) 4e-14 Click
28complement(5517734..5519671) PHAGE_Entero_2008: putative major head protein/prohead proteinase; ESCCO14588_4509; phage(gi209427776) 0.0 Click
29complement(5519735..5521396) PHAGE_Entero_2008: putative phage terminase-like protein large subunit; ESCCO14588_4510; phage(gi209427775) 0.0 Click
30complement(5521393..5521956) PHAGE_Entero_2008: putative phage terminase; ESCCO14588_4511; phage(gi209427774) 1e-95 Click
315522018..5523525 PHAGE_Entero_2008: phage-related tail protein; ESCCO14588_3759; phage(gi209427791) 0.0 Click
325523528..5523743 PHAGE_Entero_2008: phage-related tail protein; ESCCO14588_3758; phage(gi209427791) 2e-18 Click
335523811..5524410 PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ESCCO14588_3757; phage(gi209427792) 2e-114 Click
345524475..5525698 PHAGE_Entero_2008: putative tail protein; ESCCO14588_3756; phage(gi209427793) 0.0 Click
355525700..5525969 PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ESCCO14588_3755; phage(gi209427794) 5e-45 Click
365526149..5526658 PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ESCCO14588_3754; phage(gi209427795) 3e-21 Click
375526949..5527095 conserved hypothetical protein; ESCCO14588_3753 0.0 Click
385527369..5528019 PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ESCCO14588_3752; phage(gi209427795) 3e-21 Click
395528169..5528591 PROPHAGE_Escher_CFT073: transposase; ESCCO14588_3751; phage(gi26246249) 9e-39 Click
40complement(5528602..5530140) PHAGE_Stx2_c_1717: transposase; ESCCO14588_3750; phage(gi209447153) 0.0 Click
41complement(5530190..5530537) PHAGE_Stx2_c_1717: transposase; ESCCO14588_3749; phage(gi209447152) 2e-62 Click
425530958..5531827 PROPHAGE_Escher_CFT073: transposase; ESCCO14588_3748; phage(gi26246249) 1e-126 Click
43complement(5531877..5532083) PHAGE_Entero_2008: putative DNA damage-inducible protein; ESCCO14588_3747; phage(gi209427797) 5e-28 Click
44complement(5532297..5532848) PHAGE_Entero_2008: putative integrase; ESCCO14588_3746; phage(gi209427727) 2e-61 Click
45complement(5532830..5534074) PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; ESCCO14588_3745; phage(gi169257272) 7e-92 Click
46complement(5534167..5534355) conserved hypothetical protein; ESCCO14588_3744 0.0 Click
47complement(5534352..5534540) conserved domain protein; ESCCO14588_3743 0.0 Click
485534557..5534679 hypothetical protein; ESCCO14588_3742 0.0 Click
495535105..5535314 hypothetical protein; ESCCO14588_3741 0.0 Click
50complement(5535315..5535953) PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_3740; phage(gi418487085) 6e-09 Click
51complement(5535965..5536198) PHAGE_Salico_CGphi29: hypothetical protein; ESCCO14588_3739; phage(gi472340166) 5e-09 Click
52complement(5536410..5537048) PHAGE_Pectob_ZF40: putative cI repressor; ESCCO14588_3738; phage(gi422936650) 2e-18 Click
535537366..5537791 PHAGE_Escher_HK639: cII; ESCCO14588_3737; phage(gi356870652) 2e-05 Click
545537860..5538903 PHAGE_Escher_TL_2011b: hypothetical protein; ESCCO14588_3736; phage(gi418487646) 3e-48 Click
555538896..5539357 PHAGE_Escher_HK639: replication protein 14; ESCCO14588_3735; phage(gi356870655) 5e-29 Click
565539391..5540107 conserved hypothetical protein; ESCCO14588_3734 0.0 Click
575540140..5540421 conserved hypothetical protein; ESCCO14588_3733 0.0 Click
585540418..5540645 PHAGE_Salmon_1: hypothetical protein STM0896.1n.Fels1; ESCCO14588_3732; phage(gi169257161) 2e-16 Click
595540638..5540949 PHAGE_Entero_mEp213: hypothetical protein; ESCCO14588_3731; phage(gi428782634) 9e-21 Click
60complement(5541039..5541929) PROPHAGE_Escher_Sakai: putative transposase; ESCCO14588_3730; phage(gi15834498) 2e-173 Click
61complement(5541926..5542252) PHAGE_Stx2_c_II: putative transposase; ESCCO14588_3729; phage(gi302393161) 1e-58 Click
625542390..5542608 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip090; ESCCO14588_3728; phage(gi20065885) 3e-24 Click
635542610..5543167 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_3727; phage(gi418487081) 6e-28 Click
645543733..5544077 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip070; ESCCO14588_3726; phage(gi20065865) 8e-59 Click
655544199..5544471 PHAGE_Gifsy_2: hypothetical protein STM1021.1n.Gifsy2; ESCCO14588_3725; phage(gi169257287) 5e-14 Click
665544473..5545522 PHAGE_Entero_mEp460: hypothetical protein; ESCCO14588_3724; phage(gi428782365) 2e-112 Click
675545535..5545840 PHAGE_Escher_HK75: RusA-like protein; ESCCO14588_3723; phage(gi356870726) 2e-32 Click
685545903..5546321 putative ante-terminator protein; ESCCO14588_3722 0.0 Click
695546397..5546561 putative antitermination protein; ESCCO14588_3238 0.0 Click
705546786..5546983 PHAGE_Entero_phiP27: hypothetical protein P27p23; ESCCO14588_3239; phage(gi18249887) 7e-29 Click
71complement(5547088..5547228) hypothetical protein; ESCCO14588_3240 0.0 Click
725547245..5547832 putative transcriptional regulator; ESCCO14588_3241 0.0 Click
735547861..5547936 tRNA 0.0 Click
745548036..5548114 tRNA 0.0 Click
755548283..5548714 PHAGE_Pseudo_AF: putative tellurite resistance protein; ESCCO14588_3244; phage(gi431810338) 1e-28 Click
765548711..5548878 PHAGE_Entero_P1: TciB; ESCCO14588_3245; phage(gi46401695) 1e-08 Click
775549021..5549143 conserved hypothetical protein; ESCCO14588_3246 0.0 Click
785549192..5551042 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ESCCO14588_3247; phage(gi209427766) 0.0 Click
79complement(5551321..5551482) conserved hypothetical protein; ESCCO14588_3248 0.0 Click
805551490..5551696 PHAGE_Entero_2008: lysis protein; ESCCO14588_3249; phage(gi209427767) 6e-33 Click
815551701..5552045 PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ESCCO14588_3250; phage(gi209427768) 9e-61 Click
825552096..5552629 PHAGE_Entero_2008: putative endolysin; ESCCO14588_3251; phage(gi209427769) 3e-104 Click
835552900..5553469 PHAGE_Entero_2008: putative antirepressor; ESCCO14588_3252; phage(gi209427770) 7e-107 Click
845553469..5553615 PHAGE_Escher_P13374: hypothetical protein; ESCCO14588_3253; phage(gi410491648) 3e-16 Click
855553627..5554085 PHAGE_Stx2_c_I: endopeptidase; ESCCO14588_3254; phage(gi20065955) 3e-64 Click
865554168..5554308 conserved hypothetical protein; ESCCO14588_3255 0.0 Click
875554334..5554501 hypothetical protein; ESCCO14588_3256 0.0 Click
88complement(5554945..5555109) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ESCCO14588_3257; phage(gi209427772) 5e-08 Click
895555556..5556101 PHAGE_Entero_HK630: terminase small subunit nu1; ESCCO14588_3259; phage(gi428782788) 2e-81 Click
905556076..5558001 PHAGE_Entero_HK630: terminase large subunit A; ESCCO14588_3260; phage(gi428782789) 0.0 Click
915557998..5558204 PHAGE_Entero_HK630: head-tail connector W; ESCCO14588_3261; phage(gi428782790) 1e-31 Click
925558201..5559802 PHAGE_Entero_HK630: portal protein B; ESCCO14588_3262; phage(gi428782791) 0.0 Click
935559783..5561102 PHAGE_Entero_HK630: head maturation protease C; ESCCO14588_3263; phage(gi428782792) 0.0 Click
945561112..5561444 PHAGE_Entero_HK630: head decoration protein D; ESCCO14588_3264; phage(gi428782794) 7e-58 Click
955561473..5562525 PHAGE_Entero_HK630: major head subunit E; ESCCO14588_3265; phage(gi428782795) 0.0 Click
965562567..5562965 PHAGE_Entero_HK225: head assembly protein Fi; ESCCO14588_3266; phage(gi428782384) 7e-21 Click
975562977..5563330 PHAGE_Entero_HK630: head-tail connector Fii; ESCCO14588_3267; phage(gi428782797) 2e-58 Click
985563345..5563878 PHAGE_Entero_HK630: minor tail protein Z; ESCCO14588_3268; phage(gi428782798) 2e-65 Click
995563875..5564270 PHAGE_Entero_HK630: minor tail protein U; ESCCO14588_3269; phage(gi428782799) 6e-59 Click
1005564278..5565030 PHAGE_Entero_HK630: major tail protein V; ESCCO14588_3270; phage(gi428782800) 1e-112 Click
1015565044..5565466 PROPHAGE_Escher_Sakai: putative minor tail protein; ESCCO14588_3271; phage(gi15832205) 7e-74 Click
1025565517..5565906 PROPHAGE_Escher_Sakai: putative minor tail protein; ESCCO14588_3272; phage(gi15832204) 3e-41 Click
1035565887..5568198 PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; ESCCO14588_3273; phage(gi15832203) 0.0 Click
1045568265..5568435 conserved hypothetical protein; ESCCO14588_3777 0.0 Click
105complement(5568805..5569023) hypothetical protein; ESCCO14588_3776 0.0 Click
1065569116..5569316 conserved hypothetical protein; ESCCO14588_3775 0.0 Click
107complement(5569352..5569495) hypothetical protein; ESCCO14588_3774 0.0 Click
108complement(5570027..5570254) conserved hypothetical protein; ESCCO14588_3773 0.0 Click
109complement(5570239..5570457) conserved hypothetical protein; ESCCO14588_3772 0.0 Click
1105571007..5571432 PHAGE_Entero_mEp237: CII protein; ESCCO14588_3771; phage(gi435439306) 3e-05 Click
1115571530..5572417 PHAGE_Entero_phiP27: hypothetical protein P27p17; ESCCO14588_3770; phage(gi18249881) 3e-26 Click
1125572424..5573164 PHAGE_Gifsy_2: bacteriophage DNA replication protein; ESCCO14588_3769; phage(gi169257280) 8e-77 Click
1135573190..5573369 conserved hypothetical protein; ESCCO14588_3768 0.0 Click
1145573405..5573959 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp38; ESCCO14588_3767; phage(gi116222030) 8e-06 Click
1155573975..5574370 conserved hypothetical protein; ESCCO14588_3766 0.0 Click
1165574427..5575011 PHAGE_Entero_cdtI: Valyl-tRNA synthetase; ESCCO14588_3765; phage(gi148609417) 2e-14 Click
1175575082..5575231 conserved hypothetical protein; ESCCO14588_3764 0.0 Click
118complement(5575818..5575997) conserved hypothetical protein; ESCCO14588_3763 0.0 Click
1195576080..5577129 PHAGE_Entero_mEp460: hypothetical protein; ESCCO14588_3762; phage(gi428782365) 4e-110 Click
1205577142..5577501 PHAGE_Escher_HK75: RusA-like protein; ESCCO14588_3761; phage(gi356870726) 1e-38 Click
1215577498..5577916 PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ESCCO14588_3760; phage(gi169257244) 3e-51 Click
122complement(5577917..5578378) YciA; ESCCO14588_A0001 0.0 Click
123complement(5578236..5579012) conserved hypothetical protein; ESCCO14588_A0002 0.0 Click
124complement(5579015..5579491) conserved hypothetical protein; ESCCO14588_A0003 0.0 Click
125complement(5579505..5579726) conserved hypothetical protein; ESCCO14588_A0004 0.0 Click
126complement(5579727..5580410) PHAGE_Natria_PhiCh1: adenine methyltransferase; ESCCO14588_A0005; phage(gi22091198) 3e-22 Click
1275583679..5583690 attR    AACCTGCCTCAC 0.0 Click