Escherichia albertii TW07627 , whole genome [asmbl_id: NC_000000].4698533, GC%: 49.88%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 8 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1401459..1402499) PHAGE_Synech_S_SSM5: phosphate transporter subunit; ESCAB7627_4787; phage(gi326784278) 5e-52 Click
2complement(1402936..1404765) PHAGE_Parame_NY2A: hypothetical protein NY2A_B143R; ESCAB7627_4788; phage(gi157952447) 5e-134 Click
3complement(1404928..1406298) PHAGE_Megavi_lba: putative UDP-N-acetylglucosamine pyrophosphorylase; ESCAB7627_4789; phage(gi448825189) 3e-32 Click
4complement(1406574..1407272) PHAGE_Camelp_virus: CMLV006; ESCAB7627_4790; phage(gi18640240) 8e-05 Click
5complement(1407530..1408039) PHAGE_Hypert_2: IS element Dka2 orfA; ESCAB7627_4791; phage(gi300116744) 2e-15 Click
6complement(1408170..1410038) PHAGE_Parame_FR483: hypothetical protein FR483_N110R; ESCAB7627_4792; phage(gi155370208) 2e-72 Click
71410261..1411754 PHAGE_Acidia_virus: hypothetical protein ATV_gp66; ESCAB7627_4793; phage(gi75750456) 3e-14 Click
81411754..1413205 PHAGE_Bacill_36: putative metalloprotein chaperonin subunit; ESCAB7627_4794; phage(gi156564046) 2e-05 Click

Region 2, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11550227..1551240 PHAGE_Prochl_P_SSP10: hypothetical protein; ESCAB7627_1380; phage(gi472339118) 1e-05 Click
21551381..1555454 PHAGE_Equid__9: envelope glycoprotein J; ESCAB7627_1381; phage(gi216905924) 6e-05 Click
3complement(1555465..1555968) PROPHAGE_Escher_MG1655: IS1 transposase B; ESCAB7627_1382; phage(gi16131317) 2e-95 Click
41556348..1556491 PHAGE_Escher_TL_2011b: hypothetical protein; ESCAB7627_1383; phage(gi418487683) 1e-20 Click
5complement(1556507..1556635) hypothetical protein; ESCAB7627_1384 0.0 Click
61556820..1557335 PHAGE_Escher_TL_2011b: putative outer membrane lipoprotein; ESCAB7627_1385; phage(gi418487638) 7e-81 Click
71557351..1557890 PHAGE_Escher_TL_2011b: hypothetical protein; ESCAB7627_1386; phage(gi418487682) 4e-82 Click
8complement(1558063..1559640) GMP synthase (glutamine-hydrolyzing); ESCAB7627_1387 0.0 Click
9complement(1559709..1561175) PHAGE_Staphy_42E: ORF012; ESCAB7627_1388; phage(gi66395520) 4e-32 Click

Region 3, total : 36 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3451273..3451854) PHAGE_Entero_2008: hypothetical protein YYZ_gp73; ESCAB7627_3647; phage(gi209427796) 1e-22 Click
2complement(3451969..3452238) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp76; ESCAB7627_3648; phage(gi209447199) 4e-45 Click
3complement(3452240..3452518) PROPHAGE_Escher_Sakai: putative tail fiber protein; ESCAB7627_3649; phage(gi15832195) 4e-50 Click
43453444..3453617 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; ESCAB7627_3651; phage(gi157166059) 1e-27 Click
5complement(3453618..3454217) PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; ESCAB7627_3652; phage(gi148609401) 5e-103 Click
6complement(3454285..3456711) PHAGE_Entero_lambda: tail:host specificity protein; ESCAB7627_3653; phage(gi9626264) 0.0 Click
7complement(3456723..3457076) PHAGE_Entero_lambda: head-tail joining protein; ESCAB7627_3654; phage(gi9626253) 1e-63 Click
8complement(3457088..3457486) PHAGE_Entero_lambda: DNA packaging protein; ESCAB7627_3655; phage(gi9626252) 5e-62 Click
9complement(3457528..3458553) PHAGE_Entero_lambda: capsid component; ESCAB7627_3656; phage(gi9626251) 0.0 Click
10complement(3458610..3458942) PHAGE_Entero_lambda: head-DNA stabilization protein; ESCAB7627_3657; phage(gi9626250) 1e-56 Click
11complement(3458952..3460271) PHAGE_Entero_lambda: capsid component; ESCAB7627_3658; phage(gi9626248) 0.0 Click
12complement(3460252..3461853) PHAGE_Entero_lambda: capsid component; ESCAB7627_3659; phage(gi9626247) 0.0 Click
13complement(3461850..3462056) PHAGE_Entero_lambda: head-tail joining protein; ESCAB7627_3660; phage(gi9626246) 4e-32 Click
14complement(3462053..3463789) PHAGE_Entero_lambda: DNA packaging protein; ESCAB7627_3661; phage(gi9626245) 0.0 Click
15complement(3463953..3464498) PHAGE_Entero_lambda: DNA packaging protein; ESCAB7627_3662; phage(gi9626244) 7e-98 Click
16complement(3464976..3465125) conserved hypothetical protein; ESCAB7627_3664 0.0 Click
17complement(3466079..3466546) PHAGE_Salmon_SPN9CC: endopeptidase; ESCAB7627_3665; phage(gi389060532) 2e-78 Click
18complement(3466543..3467040) PHAGE_Stx2_c_1717: phage-related lysozyme; ESCAB7627_3666; phage(gi209447172) 1e-94 Click
19complement(3467040..3467246) PHAGE_Stx2_c_1717: holin protein S-like protein; ESCAB7627_3667; phage(gi209447171) 3e-33 Click
20complement(3467694..3468812) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp03; ESCAB7627_3669; phage(gi116221995) 3e-165 Click
21complement(3470365..3470619) hypothetical protein; ESCAB7627_3672 0.0 Click
22complement(3470612..3470776) conserved hypothetical protein; ESCAB7627_3673 0.0 Click
23complement(3470947..3471021) tRNA 0.0 Click
24complement(3471025..3471100) tRNA 0.0 Click
25complement(3471105..3471181) tRNA 0.0 Click
26complement(3471272..3471433) PHAGE_Stx2_c_1717: antiterminator Q protein; ESCAB7627_3677; phage(gi209447165) 2e-24 Click
27complement(3471751..3472422) PHAGE_Stx2_c_1717: NinI protein; ESCAB7627_3678; phage(gi209447164) 1e-128 Click
28complement(3472419..3473024) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip141; ESCAB7627_3679; phage(gi20065936) 3e-115 Click
29complement(3473017..3473142) PHAGE_Entero_lambda: NinF protein; ESCAB7627_3680; phage(gi9626302) 2e-14 Click
30complement(3473318..3473845) PHAGE_Entero_HK544: putative N-6-adenine-methyltransferase; ESCAB7627_3681; phage(gi428783266) 2e-101 Click
31complement(3473842..3474282) PHAGE_Entero_HK140: NinB protein; ESCAB7627_3682; phage(gi428781994) 3e-82 Click
32complement(3474643..3475344) PHAGE_Entero_lambda: DNA replication protein; ESCAB7627_3683; phage(gi9626296) 5e-126 Click
33complement(3475341..3476240) PHAGE_Entero_lambda: DNA replication protein; ESCAB7627_3684; phage(gi9626295) 7e-172 Click
343476733..3477755 PROPHAGE_Escher_CFT073: transposase; ESCAB7627_3685; phage(gi26248360) 0.0 Click
353477755..3478534 PROPHAGE_Escher_CFT073: transposase/IS protein; ESCAB7627_3686; phage(gi26248359) 1e-142 Click
36complement(3478635..3478874) PHAGE_Stx2_c_I: Cro protein; ESCAB7627_3687; phage(gi20065917) 1e-37 Click
373478896..3479648 PHAGE_Stx2_c_I: CI protein; ESCAB7627_3688; phage(gi20065916) 7e-133 Click
383481222..3481671 PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; ESCAB7627_3690; phage(gi399528805) 1e-66 Click
393482001..3482504 PROPHAGE_Escher_MG1655: IS1 transposase B; ESCAB7627_3691; phage(gi16131317) 2e-95 Click

Region 4, total : 46 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13658835..3661117 PHAGE_Klebsi_KP27: hypothetical protein; ESCAB7627_2092; phage(gi448260626) 1e-22 Click
23661642..3661653 attL    GACAATGAAACA 0.0 Click
3complement(3661736..3662899) PHAGE_Yersin_413C: gpD; ESCAB7627_2093; phage(gi30065731) 0.0 Click
4complement(3662899..3663378) PHAGE_Yersin_413C: gpU; ESCAB7627_2094; phage(gi30065730) 9e-87 Click
5complement(3663393..3665840) PHAGE_Yersin_413C: gpT; ESCAB7627_2095; phage(gi30065729) 0.0 Click
6complement(3666317..3666835) PHAGE_Yersin_413C: FII; ESCAB7627_2098; phage(gi30065726) 2e-92 Click
7complement(3666848..3668038) PHAGE_Yersin_413C: gpFI; ESCAB7627_2099; phage(gi30065725) 0.0 Click
83668058..3668195 hypothetical protein; ESCAB7627_2100 0.0 Click
9complement(3668473..3669552) hypothetical protein; ESCAB7627_2101 0.0 Click
10complement(3669881..3670459) PHAGE_Entero_HK630: tail fiber assembly protein; ESCAB7627_2102; phage(gi428782810) 8e-71 Click
11complement(3670459..3672276) PHAGE_Yersin_413C: gpH; ESCAB7627_2103; phage(gi30065722) 3e-95 Click
12complement(3672287..3672817) PHAGE_Yersin_413C: gpI; ESCAB7627_2104; phage(gi30065721) 3e-97 Click
13complement(3672810..3673718) PHAGE_Yersin_413C: gpJ; ESCAB7627_2105; phage(gi30065720) 1e-165 Click
14complement(3673723..3674070) PHAGE_Yersin_413C: gpW; ESCAB7627_2106; phage(gi30065719) 5e-60 Click
15complement(3674067..3674702) PHAGE_Yersin_413C: gpV; ESCAB7627_2107; phage(gi30065718) 7e-119 Click
16complement(3674769..3675221) PHAGE_Yersin_413C: gpS; ESCAB7627_2108; phage(gi30065717) 4e-80 Click
17complement(3675214..3675681) PHAGE_Yersin_413C: gpR; ESCAB7627_2109; phage(gi30065716) 1e-82 Click
18complement(3675644..3675802) PHAGE_Erwini_ENT90: putative host lysis-related protein; ESCAB7627_2110; phage(gi431810968) 6e-10 Click
19complement(3675789..3676214) PHAGE_Yersin_413C: LysB; ESCAB7627_2111; phage(gi30065715) 1e-70 Click
20complement(3676202..3676627) PHAGE_Yersin_413C: LysA; ESCAB7627_2112; phage(gi30065714) 2e-66 Click
21complement(3676642..3677139) PHAGE_Yersin_413C: gpK; ESCAB7627_2113; phage(gi30065713) 3e-94 Click
22complement(3677139..3677420) PHAGE_Yersin_413C: gpY; ESCAB7627_2114; phage(gi30065712) 3e-46 Click
23complement(3677424..3677627) PHAGE_Yersin_413C: gpX; ESCAB7627_2115; phage(gi30065711) 1e-32 Click
24complement(3677627..3678100) PHAGE_Yersin_413C: gpL; ESCAB7627_2116; phage(gi30065710) 1e-84 Click
25complement(3678236..3678979) PHAGE_Yersin_413C: gpM; ESCAB7627_2117; phage(gi30065709) 7e-135 Click
26complement(3678983..3680056) PHAGE_Yersin_413C: gpN; ESCAB7627_2118; phage(gi30065708) 0.0 Click
27complement(3680115..3680969) PHAGE_Yersin_413C: gpO; ESCAB7627_2119; phage(gi30065707) 3e-160 Click
283681143..3682915 PHAGE_Yersin_413C: gpP; ESCAB7627_2120; phage(gi30065706) 0.0 Click
293682915..3683037 PHAGE_Yersin_413C: gpQ; ESCAB7627_2121; phage(gi30065705) 6e-14 Click
30complement(3683108..3683857) PROPHAGE_Escher_CFT073: transposase/IS protein; ESCAB7627_2122; phage(gi26248359) 1e-22 Click
31complement(3683869..3685410) putative transposase for insertion sequence; ESCAB7627_2123 0.0 Click
323685709..3686536 PHAGE_Yersin_413C: gpQ; ESCAB7627_2124; phage(gi30065705) 3e-159 Click
33complement(3686575..3686736) hypothetical protein; ESCAB7627_2125 0.0 Click
34complement(3686852..3687712) hypothetical protein; ESCAB7627_2126 0.0 Click
35complement(3687747..3687989) hypothetical protein; ESCAB7627_2127 0.0 Click
36complement(3688034..3690307) PHAGE_Yersin_413C: gpA; ESCAB7627_2128; phage(gi30065742) 0.0 Click
37complement(3690297..3690572) PHAGE_Yersin_413C: hypothetical protein L-413Cp37; ESCAB7627_2129; phage(gi30065741) 6e-47 Click
38complement(3690569..3690793) PHAGE_Yersin_413C: hypothetical protein L-413Cp36; ESCAB7627_2130; phage(gi30065740) 2e-35 Click
39complement(3690793..3691083) PHAGE_Yersin_413C: hypothetical protein L-413Cp35; ESCAB7627_2131; phage(gi30065739) 4e-31 Click
40complement(3691080..3691205) hypothetical protein; ESCAB7627_2132 0.0 Click
41complement(3691341..3691553) PHAGE_Yersin_413C: hypothetical protein L-413Cp34; ESCAB7627_2133; phage(gi30065738) 1e-29 Click
42complement(3691617..3692108) PHAGE_Yersin_413C: gpB; ESCAB7627_2134; phage(gi30065737) 3e-91 Click
433692385..3692579 hypothetical protein; ESCAB7627_2136 0.0 Click
44complement(3692557..3693021) hypothetical protein; ESCAB7627_2135 0.0 Click
45complement(3693031..3693387) Cox protein; ESCAB7627_2137 0.0 Click
463693884..3694879 PHAGE_Yersin_413C: Int; ESCAB7627_2138; phage(gi30065733) 9e-102 Click
473694911..3695708 PHAGE_Entero_T4: NrdG anaerobic NTP reductase, small subunit; ESCAB7627_2139; phage(gi9632803) 6e-07 Click
483706931..3706942 attR    GACAATGAAACA 0.0 Click

Region 5, total : 48 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13703819..3703838 attL    AAAGCGCCCGCAGGCGCTTT 0.0 Click
2complement(3703921..3704913) PHAGE_Vibrio_kappa: putative integrase; ESCAB7627_2147; phage(gi165970235) 4e-64 Click
3complement(3704983..3705132) putative bacteriophage WPhi phage protein C; ESCAB7627_2148 0.0 Click
43705429..3705956 conserved hypothetical protein; ESCAB7627_2149 0.0 Click
53705984..3706133 hypothetical protein; ESCAB7627_2150 0.0 Click
63706155..3706763 hypothetical protein; ESCAB7627_2151 0.0 Click
73707323..3707673 conserved hypothetical protein; ESCAB7627_2152 0.0 Click
83707684..3707962 conserved hypothetical protein; ESCAB7627_2153 0.0 Click
93708213..3708326 hypothetical protein; ESCAB7627_2154 0.0 Click
103708419..3708832 conserved hypothetical protein; ESCAB7627_2155 0.0 Click
113708840..3709169 PHAGE_Salmon_SSU5: hypothetical protein; ESCAB7627_2156; phage(gi410491508) 5e-06 Click
123709169..3709372 conserved hypothetical protein; ESCAB7627_2157 0.0 Click
133709369..3709614 conserved hypothetical protein; ESCAB7627_2158 0.0 Click
143709611..3709910 PHAGE_Entero_mEp213: hypothetical protein; ESCAB7627_2159; phage(gi428782624) 4e-07 Click
153710233..3710463 conserved domain protein; ESCAB7627_2160 0.0 Click
163710536..3710901 conserved hypothetical protein; ESCAB7627_2161 0.0 Click
173710953..3713730 PHAGE_Salmon_RE_2010: replication protein; ESCAB7627_2162; phage(gi418489692) 1e-171 Click
183713807..3714766 plasmid segregation protein ParM (Protein stbA); ESCAB7627_2163 0.0 Click
193714771..3715085 putative stability/partitioning protein encoded within CP-933T; ESCAB7627_2164 0.0 Click
203715100..3715387 PHAGE_Entero_cdtI: Valyl-tRNA synthetase; ESCAB7627_2165; phage(gi148609417) 3e-18 Click
213715399..3715758 tranScriptional repressor of the iscrsua operon; ESCAB7627_2166 0.0 Click
22complement(3715827..3716141) PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_19; ESCAB7627_2167; phage(gi148727148) 1e-10 Click
23complement(3716150..3717184) PHAGE_Haemop_HP2: orf15; ESCAB7627_2168; phage(gi17981829) 2e-90 Click
24complement(3717177..3718964) PHAGE_Haemop_HP2: terminase; ESCAB7627_2169; phage(gi17981830) 0.0 Click
25complement(3718951..3719067) hypothetical protein; ESCAB7627_2170 0.0 Click
263719159..3720049 PHAGE_Haemop_HP2: scaffold; ESCAB7627_2171; phage(gi17981831) 6e-40 Click
273720064..3721077 PHAGE_Aeromo_phiO18P: putative major capsid protein; ESCAB7627_2172; phage(gi148727153) 3e-85 Click
283721095..3721805 PHAGE_Haemop_HP2: packaging protein; ESCAB7627_2173; phage(gi17981833) 1e-39 Click
293721904..3722398 PHAGE_Haemop_HP2: packaging protein; ESCAB7627_2174; phage(gi17981834) 2e-20 Click
303722408..3722881 PHAGE_Haemop_HP2: orf21; ESCAB7627_2175; phage(gi17981835) 2e-11 Click
313722878..3723591 PHAGE_Haemop_HP2: orf22; ESCAB7627_2176; phage(gi17981836) 3e-11 Click
323723611..3724759 PHAGE_Haemop_HP2: tail sheath; ESCAB7627_2177; phage(gi17981837) 4e-85 Click
333724756..3725211 PHAGE_Haemop_HP2: tail tube; ESCAB7627_2178; phage(gi17981838) 3e-35 Click
343725215..3725511 PHAGE_Burkho_KS9: holin gp22; ESCAB7627_2179; phage(gi255033753) 4e-18 Click
353725621..3725962 PHAGE_Pseudo_PaP2: hypothetical protein PaP2_gp17; ESCAB7627_2180; phage(gi48697087) 4e-23 Click
363726033..3726320 PHAGE_Haemop_HP2: orf26; ESCAB7627_2181; phage(gi17981842) 2e-13 Click
373726362..3726508 PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_37; ESCAB7627_2182; phage(gi148727165) 2e-06 Click
383726508..3728604 PHAGE_Haemop_HP2: orf27; ESCAB7627_2183; phage(gi17981843) 5e-117 Click
393728594..3728944 PHAGE_Haemop_HP2: orf28; ESCAB7627_2184; phage(gi17981844) 1e-27 Click
403728937..3730121 PHAGE_Haemop_HP2: orf29; ESCAB7627_2185; phage(gi17981845) 6e-124 Click
413730118..3730753 PHAGE_Haemop_HP2: orf30; ESCAB7627_2186; phage(gi17981846) 2e-40 Click
423730750..3732450 PHAGE_Haemop_HP2: tail fibers; ESCAB7627_2187; phage(gi17981847) 1e-52 Click
433732453..3733004 PHAGE_Entero_phiP27: putative tail fiber assembly protein; ESCAB7627_2188; phage(gi18249919) 9e-69 Click
443733011..3733868 PHAGE_Haemop_HP2: tail fibers; ESCAB7627_2189; phage(gi17981847) 5e-09 Click
453733893..3734951 hypothetical protein; ESCAB7627_2190 0.0 Click
463734984..3735733 PHAGE_Haemop_HP2: orf33; ESCAB7627_2191; phage(gi17981849) 5e-11 Click
473735705..3736280 PHAGE_Haemop_HP2: orf34; ESCAB7627_2192; phage(gi17981850) 4e-29 Click
483736277..3737974 PHAGE_Haemop_HP2: orf35; ESCAB7627_2193; phage(gi17981851) 4e-104 Click
493738803..3738946 PHAGE_Escher_P13374: prophage host toxic membrane protein; ESCAB7627_2194; phage(gi410491667) 8e-14 Click
503739204..3739223 attR    AAAGCGCCCGCAGGCGCTTT 0.0 Click
51complement(3739246..3740538) seryl-tRNA synthetase; ESCAB7627_2195 0.0 Click
52complement(3740629..3741972) PHAGE_Vibrio_vB_VpaS_MAR10: putative DNA polymerase III; ESCAB7627_2196; phage(gi428782157) 8e-11 Click

Region 6, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4399394..4400104) PHAGE_Salmon_1: hypothetical bacteriophage protein; ESCAB7627_4099; phage(gi169257202) 5e-61 Click
24400055..4403513 PHAGE_Entero_4795: putative tail component; ESCAB7627_4100; phage(gi157166057) 0.0 Click
34403581..4404180 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; ESCAB7627_4101; phage(gi148609401) 2e-102 Click
44404146..4404259 hypothetical protein; ESCAB7627_4102 0.0 Click
54405367..4405645 PROPHAGE_Escher_Sakai: putative tail fiber protein; ESCAB7627_4104; phage(gi15832195) 4e-50 Click
64405647..4405916 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp76; ESCAB7627_4105; phage(gi209447199) 4e-45 Click
7complement(4406042..4406935) PHAGE_Physal_virus: overlapping protein/movement protein; ESCAB7627_4106; phage(gi20177480) 2e-05 Click
8complement(4407295..4407798) PROPHAGE_Escher_MG1655: IS1 transposase B; ESCAB7627_4107; phage(gi16131317) 2e-95 Click
9complement(4408158..4408328) PHAGE_Entero_4795: putative avirulence protein; ESCAB7627_4108; phage(gi157166069) 6e-20 Click

Region 7, total : 31 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14467128..4467859 PHAGE_Cafete_BV_PW1: putative ABC-type amino acid transporter; ESCAB7627_1220; phage(gi310831221) 2e-06 Click
24467866..4468582 arginine ABC transporter, permease protein ArtQ; ESCAB7627_1221 0.0 Click
34468582..4469250 arginine ABC transporter, permease protein ArtM; ESCAB7627_1222 0.0 Click
44469546..4470277 arginine ABC transporter, periplasmic arginine-binding protein ArtJ; ESCAB7627_1223 0.0 Click
5complement(4470419..4470862) PHAGE_Acanth_mimivirus: putative RNA methyltransferase; ESCAB7627_1224; phage(gi311977789) 3e-07 Click
6complement(4471184..4471354) PHAGE_Entero_phiP27: hypothetical protein P27p57; ESCAB7627_1225; phage(gi18249921) 3e-10 Click
7complement(4471469..4471738) PHAGE_Entero_HK630: tail fiber assembly protein; ESCAB7627_1226; phage(gi428782810) 8e-22 Click
8complement(4472518..4473102) PHAGE_Entero_HK630: tail fiber assembly protein; ESCAB7627_1227; phage(gi428782810) 1e-102 Click
9complement(4473102..4474907) PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; ESCAB7627_1228; phage(gi16129506) 5e-104 Click
10complement(4474868..4475002) hypothetical protein; ESCAB7627_1229 0.0 Click
114475038..4475775 PHAGE_Entero_lambda: hypothetical protein lambdap90; ESCAB7627_1230; phage(gi9626267) 2e-53 Click
12complement(4476345..4476458) hypothetical protein; ESCAB7627_1231 0.0 Click
13complement(4476424..4477023) PHAGE_Entero_mEp460: Lom protein; ESCAB7627_1232; phage(gi428782335) 3e-98 Click
14complement(4477091..4480564) PHAGE_Entero_HK630: tail fiber J; ESCAB7627_1233; phage(gi428782808) 0.0 Click
15complement(4480908..4481489) PHAGE_Stx2_c_1717: putative tail component; ESCAB7627_1234; phage(gi209447195) 1e-103 Click
16complement(4481486..4482229) PHAGE_Entero_4795: putative tail fiber component; ESCAB7627_1235; phage(gi157166055) 7e-148 Click
17complement(4482240..4482938) PHAGE_Entero_HK630: minor tail protein L; ESCAB7627_1236; phage(gi428782805) 2e-106 Click
18complement(4482938..4483267) PHAGE_Entero_HK630: minor tail protein M; ESCAB7627_1237; phage(gi428782804) 6e-46 Click
19complement(4483264..4485837) PHAGE_Entero_HK630: tail length tape measure protein H; ESCAB7627_1238; phage(gi428782803) 0.0 Click
20complement(4485818..4486207) PHAGE_Entero_HK630: tail assembly protein GT; ESCAB7627_1239; phage(gi428782802) 4e-43 Click
21complement(4486258..4486689) PHAGE_Entero_HK630: minor tail protein G; ESCAB7627_1240; phage(gi428782801) 2e-45 Click
22complement(4486703..4487455) PHAGE_Entero_HK630: major tail protein V; ESCAB7627_1241; phage(gi428782800) 3e-112 Click
23complement(4487463..4487858) PHAGE_Entero_HK630: minor tail protein U; ESCAB7627_1242; phage(gi428782799) 8e-59 Click
24complement(4487855..4488388) PHAGE_Entero_HK630: minor tail protein Z; ESCAB7627_1243; phage(gi428782798) 4e-66 Click
25complement(4488750..4489133) PHAGE_Gifsy_1: bacteriophage accessory DNA packaging protein; Lambda FI homolog; ESCAB7627_1244; phage(gi169257229) 5e-12 Click
26complement(4489185..4490213) PHAGE_Entero_HK630: major head subunit E; ESCAB7627_1245; phage(gi428782795) 1e-114 Click
27complement(4490271..4490618) PHAGE_Entero_HK630: head decoration protein D; ESCAB7627_1246; phage(gi428782794) 2e-24 Click
28complement(4490655..4492160) PHAGE_Entero_HK630: head maturation protease C; ESCAB7627_1247; phage(gi428782792) 2e-106 Click
29complement(4492150..4493742) PHAGE_Entero_HK630: portal protein B; ESCAB7627_1248; phage(gi428782791) 0.0 Click
30complement(4493739..4493945) PHAGE_Entero_HK630: head-tail connector W; ESCAB7627_1249; phage(gi428782790) 1e-11 Click
31complement(4495828..4496307) PHAGE_Entero_HK630: terminase small subunit nu1; ESCAB7627_1251; phage(gi428782788) 1e-20 Click

Region 8, total : 15 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4498833..4499291) PHAGE_Entero_mEp235: lysis protein Rz; ESCAB7627_1254; phage(gi428781868) 2e-70 Click
2complement(4499288..4499821) PHAGE_Entero_mEp460: endolysin; ESCAB7627_1256; phage(gi428782372) 4e-103 Click
3complement(4499877..4500191) PHAGE_Entero_mEp460: hypothetical protein; ESCAB7627_1257; phage(gi428782371) 2e-53 Click
4complement(4500196..4500411) PHAGE_Stx2_c_II: holin; ESCAB7627_1258; phage(gi302393164) 4e-35 Click
5complement(4500562..4502418) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp03; ESCAB7627_1259; phage(gi116221995) 0.0 Click
64502829..4503014 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp43; ESCAB7627_1260; phage(gi209447168) 8e-22 Click
7complement(4503659..4503814) hypothetical protein; ESCAB7627_1261 0.0 Click
8complement(4503786..4503902) conserved hypothetical protein; ESCAB7627_1262 0.0 Click
9complement(4503961..4504039) tRNA 0.0 Click
10complement(4504048..4504123) tRNA 0.0 Click
11complement(4504173..4505222) PHAGE_Entero_mEp460: DNA methylase; ESCAB7627_1265; phage(gi428782369) 6e-175 Click
12complement(4505373..4505570) PHAGE_Entero_mEp460: hypothetical protein; ESCAB7627_1266; phage(gi428782368) 2e-07 Click
13complement(4505797..4506618) PHAGE_Entero_HK225: late gene regulator Q; ESCAB7627_1267; phage(gi428782441) 2e-92 Click
14complement(4506615..4506989) PHAGE_Escher_HK75: RusA-like protein; ESCAB7627_1268; phage(gi356870726) 3e-34 Click
15complement(4507002..4508048) PHAGE_Entero_mEp460: hypothetical protein; ESCAB7627_1269; phage(gi428782365) 1e-111 Click
16complement(4508382..4508555) conserved hypothetical protein; ESCAB7627_1270 0.0 Click
17complement(4508713..4509804) PHAGE_Clostr_phiCD27: putative phage DNA-binding protein; ESCAB7627_1271; phage(gi209901309) 7e-26 Click

Region 9, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14609118..4610965 PHAGE_Entero_HK630: terminase large subunit A; ESCAB7627_3962; phage(gi428782789) 0.0 Click
24610949..4611155 PHAGE_Entero_HK630: head-tail connector W; ESCAB7627_3963; phage(gi428782790) 1e-11 Click
34611152..4612744 PHAGE_Entero_HK630: portal protein B; ESCAB7627_3964; phage(gi428782791) 0.0 Click
44612734..4614239 PHAGE_Entero_HK630: head maturation protease C; ESCAB7627_3965; phage(gi428782792) 2e-106 Click
54614276..4614623 PHAGE_Entero_HK630: head decoration protein D; ESCAB7627_3966; phage(gi428782794) 2e-24 Click
64614681..4615709 PHAGE_Entero_HK630: major head subunit E; ESCAB7627_3967; phage(gi428782795) 1e-114 Click
74615761..4616144 PHAGE_Gifsy_1: bacteriophage accessory DNA packaging protein; Lambda FI homolog; ESCAB7627_3968; phage(gi169257229) 5e-12 Click
84616506..4617039 PHAGE_Entero_HK630: minor tail protein Z; ESCAB7627_3969; phage(gi428782798) 4e-66 Click
94617036..4617431 PHAGE_Entero_HK630: minor tail protein U; ESCAB7627_3970; phage(gi428782799) 8e-59 Click
104617439..4618191 PHAGE_Entero_HK630: major tail protein V; ESCAB7627_3971; phage(gi428782800) 3e-112 Click
114618205..4618636 PHAGE_Entero_HK630: minor tail protein G; ESCAB7627_3972; phage(gi428782801) 2e-45 Click
124618687..4619076 PHAGE_Entero_HK630: tail assembly protein GT; ESCAB7627_3973; phage(gi428782802) 4e-43 Click
134619057..4621630 PHAGE_Entero_HK630: tail length tape measure protein H; ESCAB7627_3974; phage(gi428782803) 0.0 Click
144621627..4621956 PHAGE_Entero_HK630: minor tail protein M; ESCAB7627_3975; phage(gi428782804) 6e-46 Click
154621956..4622654 PHAGE_Entero_HK630: minor tail protein L; ESCAB7627_3976; phage(gi428782805) 2e-106 Click
164622665..4623408 PHAGE_Entero_4795: putative tail fiber component; ESCAB7627_3977; phage(gi157166055) 7e-148 Click