Clostridium difficile CIP 107932 , whole genome [asmbl_id: NC_000000].4032580, GC%: 28.32%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1227830..228528 PHAGE_Prochl_Syn1: phosphoribosylaminoimidazole-succinocarboxamide synthase; PP_00226; phage(gi326784002) 1e-48 Click
2228540..229907 PHAGE_Parame_FR483: hypothetical protein FR483_N035R; PP_00227; phage(gi155370133) 6e-22 Click
3229901..230977 PHAGE_Synech_S_SKS1: glycinamide ribonucleotide formyltransferase; PP_00228; phage(gi472340860) 3e-64 Click
4230971..231564 PHAGE_Burkho_phiE255: gp30, formyl transferase, putative; PP_00229; phage(gi134288807) 1e-06 Click
5231557..233089 PHAGE_Prochl_P_SSM2: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase; PP_00230; phage(gi61806062) 5e-61 Click
6233100..234350 phosphoribosylamine--glycine ligase [Clostridium difficile R20291] gi|260685596|ref|YP_003216729.1|; PP_00231 0.0 Click
7234375..238181 PHAGE_Microb_Min1: putative phosphoribosyl formylglycinamidine (FGAM) synthase II; PP_00232; phage(gi149882852) 4e-36 Click
8238387..239259 PHAGE_Escher_phAPEC8: putative dTDP-4-dehydrorhamnose reductase; PP_00233; phage(gi448260370) 1e-34 Click
9239368..240249 PHAGE_Escher_phAPEC8: putative glucose-1-phosphate thymidylyltransferase; PP_00234; phage(gi448260372) 2e-97 Click
10240286..240843 PHAGE_Escher_phAPEC8: putative dTDP-4-dehydrorhamnose 3,5-epimerase; PP_00235; phage(gi448260371) 3e-46 Click
11240881..241864 PHAGE_Escher_phAPEC8: putative dTDP-glucose 4,6-dehydratase; PP_00236; phage(gi448260373) 2e-73 Click
12241903..242571 PHAGE_Pseudo_KPP12: putative lytic tail protein; PP_00237; phage(gi431811119) 5e-17 Click
13242580..243008 hypothetical protein CDR20291_0228 [Clostridium difficile R20291] gi|260685603|ref|YP_003216736.1|; PP_00238 2e-73 Click
14243032..243346 flagellar motor switch protein [Clostridium difficile R20291] gi|260685604|ref|YP_003216737.1|; PP_00239 1e-50 Click
15243498..243773 PHAGE_Cafete_BV_PW1: putative RecQ-like ATP-dependent DNA helicase; PP_00240; phage(gi310831032) 9e-05 Click
16243778..244194 flagellar biosynthesis protein [Clostridium difficile R20291] gi|260685606|ref|YP_003216739.1|; PP_00241 5e-71 Click
17244212..245522 PHAGE_Melano_entomopoxvirus: ORF MSV156 hypothetical protein; PP_00242; phage(gi9631364) 4e-08 Click

Region 2, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1388178..388192 attL    TAAAGTTGGCACGAT 0.0 Click
2402738..403877 PHAGE_Lactoc_1: ORF56; PP_00403; phage(gi13786587) 6e-18 Click
3404210..404785 hypothetical protein CDR20291_3280 [Clostridium difficile R20291] gi|260688621|ref|YP_003219755.1|; PP_00404 4e-106 Click
4405179..405736 PHAGE_Ralsto_RSM3: hypothetical protein RSM3_gp14; PP_00405; phage(gi209901327) 4e-24 Click
5406036..406779 PHAGE_Bacill_phBC6A51: hypothetical protein BC1891; PP_00406; phage(gi31415785) 1e-09 Click
6406975..407193 hypothetical protein [Clostridium difficile BI1] gi|384359034|ref|YP_006196889.1|; PP_00407 5e-37 Click
7407233..407775 hypothetical protein CDR20291_3283 [Clostridium difficile R20291] gi|260688624|ref|YP_003219758.1|; PP_00408 1e-98 Click
8407870..409075 PHAGE_Staphy_SpaA1: phage portal protein, SPP1; PP_00409; phage(gi399498867) 2e-33 Click
9409053..409220 PHAGE_Clostr_phiCD38_2: endolysine; PP_00410; phage(gi333798130) 6e-15 Click
10409291..409473 PHAGE_Clostr_phiMMP02: endolysin; PP_00411; phage(gi414090399) 6e-22 Click
11complement(409604..410047) hypothetical protein CDR20291_3285 [Clostridium difficile R20291] gi|260688626|ref|YP_003219760.1|; PP_00412 3e-78 Click
12complement(410264..410707) hypothetical protein CDR20291_3286 [Clostridium difficile R20291] gi|260688627|ref|YP_003219761.1|; PP_00413 3e-76 Click
13complement(410729..411046) hypothetical protein [Clostridium difficile BI1] gi|384359006|ref|YP_006196861.1|; PP_00414 1e-15 Click
14complement(411236..411937) hypothetical protein CDR20291_3287 [Clostridium difficile R20291] gi|260688628|ref|YP_003219762.1|; PP_00415 1e-118 Click
15complement(411930..412472) hypothetical protein CDR20291_3288 [Clostridium difficile R20291] gi|260688629|ref|YP_003219763.1|; PP_00416 4e-95 Click
16complement(412712..412894) hypothetical; PP_00417 0.0 Click
17complement(412922..413533) leucine-rich repeat protein [Clostridium difficile R20291] gi|260688630|ref|YP_003219764.1|; PP_00418 1e-113 Click
18413984..414502 pseudouridine synthase [Clostridium difficile R20291] gi|260685750|ref|YP_003216883.1|; PP_00419 3e-93 Click
19414535..415890 PHAGE_Acanth_moumouvirus: SAM-dependent methyltransferase; PP_00420; phage(gi441432344) 3e-31 Click
20complement(415972..416118) PHAGE_Clostr_phiC2: putative integrase; PP_00421; phage(gi134287379) 3e-09 Click
21422051..422065 attR    TAAAGTTGGCACGAT 0.0 Click

Region 3, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1369171..1369527) PHAGE_Lactob_KC5a: putative transcriptional regulator; PP_01304; phage(gi90592588) 7e-13 Click
21369696..1369893 PHAGE_Staphy_phiETA: hypothetical protein phiETA_10; PP_01305; phage(gi17426238) 6e-06 Click
31369998..1370438 PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp73; PP_01306; phage(gi90592709) 8e-38 Click
41370687..1371130 PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp13; PP_01307; phage(gi90592649) 4e-24 Click
51371135..1372199 PHAGE_Clostr_phiMMP04: tail sheath; PP_01308; phage(gi414090451) 2e-69 Click
61372213..1372641 PHAGE_Clostr_phiMMP04: XkdM-related protein; PP_01309; phage(gi414090452) 8e-08 Click
71372755..1373201 PHAGE_Clostr_CD119: XkdN protein; PP_01310; phage(gi90592652) 4e-15 Click
81373279..1373395 hypothetical protein CDR20291_1209 [Clostridium difficile R20291] gi|260686574|ref|YP_003217707.1|; PP_01311 1e-14 Click
91373395..1375848 PHAGE_Clostr_phiMMP04: tail tape measure; PP_01312; phage(gi414090455) 2e-22 Click
101375848..1376270 PHAGE_Clostr_phiMMP04: peptidoglycan-binding lysin domain protein; PP_01313; phage(gi414090456) 2e-47 Click
111376552..1378081 PHAGE_Clostr_phiMMP04: cell wall hydrolase; PP_01314; phage(gi414090458) 2e-121 Click
121378097..1378423 PHAGE_Clostr_phiMMP04: hypothetical protein; PP_01315; phage(gi414090459) 3e-55 Click
131378423..1378851 PHAGE_Clostr_phiMMP04: XkdS-related protein; PP_01316; phage(gi414090460) 1e-63 Click
141378844..1379896 PHAGE_Clostr_phiMMP04: baseplate J-like assembly protein; PP_01317; phage(gi414090461) 1e-140 Click
151379893..1380591 PHAGE_Clostr_phiMMP04: hypothetical protein; PP_01318; phage(gi414090462) 2e-52 Click
161380592..1381578 PHAGE_Clostr_phiMMP04: tail fiber; PP_01319; phage(gi414090463) 1e-49 Click
171381600..1386777 PHAGE_Bathyc_BpV1: hypothetical protein; PP_01320; phage(gi313768166) 3e-20 Click
181386794..1387147 hypothetical protein CDR20291_1219 [Clostridium difficile R20291] gi|260686584|ref|YP_003217717.1|; PP_01321 2e-13 Click
191387410..1387670 PHAGE_Clostr_phiCD38_2: putative holin; PP_01322; phage(gi333798129) 4e-37 Click
20complement(1387894..1388349) hypothetical protein CDR20291_1221 [Clostridium difficile R20291] gi|260686586|ref|YP_003217719.1|; PP_01323 1e-78 Click
21complement(1388577..1388996) PHAGE_Strept_3: putative cI-like repressor; PP_01324; phage(gi28876313) 6e-08 Click
221389295..1389504 PHAGE_Bacill_BCJA1c: cro; PP_01325; phage(gi56694875) 4e-08 Click
231389536..1389745 hypothetical protein CDR20291_1224 [Clostridium difficile R20291] gi|260686589|ref|YP_003217722.1|; PP_01326 8e-33 Click
24complement(1389962..1390360) PHAGE_Lister_A118: putative repressor protein; PP_01327; phage(gi16798819) 1e-08 Click
25complement(1390781..1393273) PHAGE_Melano_entomopoxvirus: ORF MSV156 hypothetical protein; PP_01328; phage(gi9631364) 2e-12 Click

Region 4, total : 74 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11607890..1607909 attL    TATTACAACTTAAGTAAATA 0.0 Click
2complement(1608094..1609224) PHAGE_Clostr_phiC2: putative integrase; PP_01525; phage(gi134287379) 3e-137 Click
3complement(1609303..1610010) hypothetical protein CDR20291_1416 [Clostridium difficile R20291] gi|260686780|ref|YP_003217913.1|; PP_01526 1e-135 Click
4complement(1610023..1610892) HipA-like protein [Clostridium difficile R20291] gi|260686781|ref|YP_003217914.1|; PP_01527 2e-168 Click
5complement(1611512..1612018) PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp43; PP_01528; phage(gi209901280) 4e-09 Click
6complement(1612096..1612437) PHAGE_Clostr_phiC2: putative repressor; PP_01529; phage(gi134287382) 2e-10 Click
71613230..1613424 hypothetical; PP_01530 0.0 Click
8complement(1613499..1613879) PHAGE_Clostr_phiMMP04: transcriptional regulator, XRE family; PP_01531; phage(gi414090479) 4e-15 Click
91614024..1614215 hypothetical; PP_01532 0.0 Click
101614227..1615000 PHAGE_Lactob_Lj965: putative antirepressor; PP_01533; phage(gi41179234) 5e-29 Click
111615006..1615809 PHAGE_Brocho_BL3: gp34; PP_01534; phage(gi327409426) 2e-53 Click
121615850..1616458 hypothetical protein CD196_1444 [Clostridium difficile CD196] gi|260683187|ref|YP_003214472.1|; PP_01535 5e-113 Click
131616606..1616776 hypothetical; PP_01536 0.0 Click
141616938..1617330 PHAGE_Clostr_phiC2: hypothetical protein phiC2p59; PP_01537; phage(gi134287391) 1e-20 Click
151617317..1617460 hypothetical; PP_01538 0.0 Click
161617531..1617968 PHAGE_Entero_phiFL4A: hypothetical protein; PP_01539; phage(gi281416448) 1e-08 Click
171617980..1619146 PHAGE_Staphy_phi2958PVL: hypothetical protein phi2958PVL_gp17; PP_01540; phage(gi209363569) 8e-100 Click
181619161..1619496 hypothetical protein H04402_02629 [Clostridium botulinum H04402 065] gi|387818822|ref|YP_005679169.1|; PP_01541 1e-08 Click
191619549..1620121 hypothetical protein CDR20291_1422 [Clostridium difficile R20291] gi|260686786|ref|YP_003217919.1|; PP_01542 3e-105 Click
201620144..1620716 PHAGE_Bacill_PBC1: hypothetical protein; PP_01543; phage(gi389060352) 3e-52 Click
211620716..1622674 PHAGE_Bacill_PBC1: DNA polymerase; PP_01544; phage(gi389060355) 0.0 Click
221622686..1625103 PHAGE_Entero_phiFL4A: VirE domain protein; PP_01545; phage(gi281416460) 0.0 Click
231625087..1625212 hypothetical; PP_01546 0.0 Click
241625385..1625711 PHAGE_Staphy_2638A: ORF037; PP_01547; phage(gi66395482) 3e-15 Click
251625741..1627030 PHAGE_Entero_phiFL4A: DNA helicase; PP_01548; phage(gi281416462) 9e-148 Click
261627054..1627191 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp67; PP_01549; phage(gi209901304) 9e-05 Click
271627184..1627663 PHAGE_Clostr_PhiS63: gp40; PP_01550; phage(gi388570666) 1e-40 Click
281627946..1628398 PHAGE_Clostr_phiMMP02: phage repressor; PP_01551; phage(gi414090441) 2e-71 Click
291628690..1629664 hypothetical protein CDR20291_1429 [Clostridium difficile R20291] gi|260686793|ref|YP_003217926.1|; PP_01552 0.0 Click
301629685..1630194 hypothetical protein CDR20291_1430 [Clostridium difficile R20291] gi|260686794|ref|YP_003217927.1|; PP_01553 3e-89 Click
311630264..1630956 PHAGE_Clostr_phiC2: putative terminase small subunit; PP_01554; phage(gi134287336) 1e-126 Click
321630946..1632187 PHAGE_Clostr_phiC2: putative terminase large subunit; PP_01555; phage(gi134287337) 0.0 Click
331632193..1633635 PHAGE_Clostr_phiC2: putative portal protein; PP_01556; phage(gi134287338) 0.0 Click
341633625..1635160 PHAGE_Clostr_phiC2: putative head morphogenesis protein; PP_01557; phage(gi134287339) 0.0 Click
351635162..1635410 hypothetical; PP_01558 0.0 Click
361635478..1636041 PHAGE_Clostr_phiC2: putative scaffold protein; PP_01559; phage(gi134287341) 4e-104 Click
371636053..1636943 PHAGE_Clostr_phiC2: putative main capsid protein; PP_01560; phage(gi134287342) 5e-168 Click
381636962..1637195 PHAGE_Clostr_phiC2: hypothetical protein phiC2p08; PP_01561; phage(gi134287343) 1e-34 Click
391637205..1637606 PHAGE_Clostr_phiC2: hypothetical protein phiC2p09; PP_01562; phage(gi134287344) 2e-69 Click
401637600..1637947 PHAGE_Clostr_phiC2: hypothetical protein phiC2p10; PP_01563; phage(gi134287345) 3e-59 Click
411637947..1638237 PHAGE_Clostr_phiC2: hypothetical protein phiC2p11; PP_01564; phage(gi134287346) 1e-46 Click
421638347..1639153 PHAGE_Clostr_phiCP26F: hypothetical protein; PP_01565; phage(gi422933952) 2e-50 Click
431639502..1639939 PHAGE_Clostr_phiC2: hypothetical protein phiC2p12; PP_01566; phage(gi134287347) 8e-78 Click
441639932..1640108 hypothetical protein Sterm_1436 [Sebaldella termitidis ATCC 33386] gi|269120052|ref|YP_003308229.1|; PP_01567 3e-06 Click
451640109..1641419 PHAGE_Clostr_phiC2: putative sheath tail protein; PP_01568; phage(gi134287348) 0.0 Click
461641436..1641906 PHAGE_Clostr_phiC2: putative core tail; PP_01569; phage(gi134287349) 5e-73 Click
471641965..1642792 PHAGE_Clostr_phiCP26F: hypothetical protein; PP_01570; phage(gi422933952) 5e-42 Click
481642864..1643304 PHAGE_Clostr_phiC2: hypothetical protein phiC2p16; PP_01571; phage(gi134287351) 2e-49 Click
491643379..1643498 hypothetical; PP_01572 0.0 Click
501645144..1645332 hypothetical; PP_01573 0.0 Click
511645451..1646317 PHAGE_Lactob_Lj965: putative antirepressor; PP_01574; phage(gi41179234) 1e-07 Click
521646370..1646504 hypothetical; PP_01575 0.0 Click
531647182..1647709 PHAGE_Clostr_phiC2: hypothetical protein phiC2p18; PP_01576; phage(gi134287353) 4e-93 Click
541647847..1648035 hypothetical protein CDR20291_1448 [Clostridium difficile R20291] gi|260686812|ref|YP_003217945.1|; PP_01577 8e-30 Click
551648010..1648615 PHAGE_Thermo_THSA_485A: hypothetical protein; PP_01578; phage(gi397912628) 6e-27 Click
561648681..1649706 PHAGE_Clostr_phiC2: putative tail tape measure protein; PP_01579; phage(gi134287355) 9e-70 Click
571649730..1651052 PHAGE_Clostr_phiC2: putative tail tape measure protein; PP_01580; phage(gi134287355) 1e-87 Click
581651069..1651758 PHAGE_Clostr_phiC2: putative LysM; PP_01581; phage(gi134287356) 1e-109 Click
591651751..1653643 PHAGE_Clostr_phiC2: putative hydrolase; PP_01582; phage(gi134287357) 0.0 Click
601653657..1653917 PHAGE_Clostr_phiC2: hypothetical protein phiC2p23; PP_01583; phage(gi134287358) 1e-35 Click
611653922..1654341 PHAGE_Strept_1: hypothetical protein EJ-1p60; PP_01584; phage(gi39653734) 6e-21 Click
621654342..1655391 PHAGE_Clostr_phiC2: hypothetical protein phiC2p25; PP_01585; phage(gi134287359) 0.0 Click
631655384..1656001 PHAGE_Clostr_phiC2: hypothetical protein phiC2p26; PP_01586; phage(gi134287360) 1e-114 Click
641656013..1657038 PHAGE_Clostr_phiC2: putative tail fiber protein; PP_01587; phage(gi134287361) 2e-166 Click
651657055..1658581 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp26; PP_01588; phage(gi209901263) 1e-94 Click
661658596..1658889 PHAGE_Clostr_phiCD6356: hypothetical protein; PP_01589; phage(gi326536870) 2e-40 Click
671658889..1659071 PHAGE_Clostr_phiC2: hypothetical protein phiC2p34; PP_01590; phage(gi134287367) 3e-26 Click
681659106..1659672 PHAGE_Clostr_phiC2: hypothetical protein phiC2p30; PP_01591; phage(gi134287363) 5e-12 Click
691659703..1659993 PHAGE_Staphy_SpaA1: hypothetical secreted or membrane protein; PP_01592; phage(gi399498883) 3e-08 Click
701659997..1660254 PHAGE_Clostr_phiC2: holin; PP_01593; phage(gi134287369) 1e-43 Click
711660515..1661378 PHAGE_Clostr_phiC2: putative abortive infection bacteriophage resistance protein ORF 37; PP_01594; phage(gi134287370) 2e-166 Click
721661457..1662269 PHAGE_Clostr_phiC2: putative amidase/endolysin; PP_01595; phage(gi134287371) 2e-143 Click
731662363..1664762 PHAGE_Amsact_: Possible surface protein; PP_01596; phage(gi9964577) 1e-22 Click
74complement(1664803..1664988) PHAGE_Clostr_phiCD6356: hypothetical protein; PP_01597; phage(gi326536880) 1e-10 Click
75complement(1665217..1665345) PHAGE_Clostr_phiMMP04: hypothetical protein; PP_01598; phage(gi414090472) 2e-10 Click
761665629..1665648 attR    TATTACAACTTAAGTAAATA 0.0 Click