Clostridium difficile ATCC 43255 , whole genome [asmbl_id: NC_000000].4204780, GC%: 28.56%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1245009..245020 attL    TACATAATAATA 0.0 Click
2complement(253923..254984) PHAGE_Clostr_phiMMP02: integrase; PP_00256; phage(gi414090406) 0.0 Click
3complement(255046..255261) PHAGE_Clostr_phiMMP02: lambda repressor-like DNA-binding protein; PP_00257; phage(gi414090407) 4e-31 Click
4255594..255734 hypothetical; PP_00258 0.0 Click
5complement(255750..256115) PHAGE_Clostr_phiC2: putative repressor; PP_00259; phage(gi134287382) 2e-17 Click
6256254..256266 attL    TAATAAAAATATA 0.0 Click
7256299..256502 PHAGE_Sulfit_pCB2047_C: hypothetical protein; PP_00260; phage(gi472341792) 4e-05 Click
8256669..256797 hypothetical; PP_00261 0.0 Click
9complement(256799..256978) PHAGE_Clostr_phiC2: hypothetical protein phiC2p53; PP_00262; phage(gi134287385) 4e-17 Click
10257114..257293 PHAGE_Clostr_phiC2: hypothetical protein phiC2p54; PP_00263; phage(gi134287386) 1e-08 Click
11257286..258074 PHAGE_Clostr_phiMMP02: phage antirepressor; PP_00264; phage(gi414090413) 1e-66 Click
12258110..258364 hypothetical protein CD196_1444 [Clostridium difficile CD196] gi|260683187|ref|YP_003214472.1|; PP_00265 2e-15 Click
13258400..258624 PHAGE_Clostr_phiMMP02: hypothetical protein; PP_00266; phage(gi414090417) 2e-12 Click
14258726..258953 PHAGE_Clostr_phiC2: hypothetical protein phiC2p62; PP_00267; phage(gi134287394) 7e-08 Click
15258966..259283 PHAGE_Clostr_phiMMP02: hypothetical protein; PP_00268; phage(gi414090419) 2e-47 Click
16259366..259875 PHAGE_Clostr_phiMMP02: hypothetical protein; PP_00269; phage(gi414090420) 9e-86 Click
17259885..260493 PHAGE_Clostr_phiMMP02: putative essential recombination function protein; PP_00270; phage(gi414090421) 1e-108 Click
18260503..261384 PHAGE_Clostr_phiMMP02: phage replication protein; PP_00271; phage(gi414090422) 2e-163 Click
19261445..261618 PHAGE_Clostr_phiMMP02: hypothetical protein; PP_00272; phage(gi414090423) 2e-26 Click
20261636..262043 PHAGE_Clostr_phiMMP02: single-strand DNA binding protein; PP_00273; phage(gi414090424) 4e-61 Click
21262118..262528 PHAGE_Clostr_phiMMP02: YopX; PP_00274; phage(gi414090425) 5e-75 Click
22262515..262766 PHAGE_Clostr_phiMMP02: hypothetical protein; PP_00275; phage(gi414090426) 4e-38 Click
23262783..263106 PHAGE_Clostr_phiMMP02: hypothetical protein; PP_00276; phage(gi414090427) 7e-13 Click
24263531..263920 PHAGE_Clostr_phiMMP02: regulatory protein; PP_00277; phage(gi414090404) 3e-68 Click
25264013..264393 PHAGE_Clostr_phiMMP02: regulatory protein; PP_00278; phage(gi414090405) 3e-44 Click
26265074..266504 membrane-associated nucleotidase [Clostridium difficile R20291] gi|260685574|ref|YP_003216707.1|; PP_00279 0.0 Click
27complement(266652..267527) PHAGE_Burkho_phi1026b: gp58; PP_00280; phage(gi38707948) 3e-08 Click
28275498..275510 attR    TAATAAAAATATA 0.0 Click
29275622..275633 attR    TACATAATAATA 0.0 Click

Region 2, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1282923..283321 PHAGE_Helico_phiHP33: transposase; PP_00294; phage(gi371671361) 1e-42 Click
2283318..284481 PHAGE_Staphy_SA11: transposase; PP_00295; phage(gi422935718) 3e-17 Click
3complement(284865..285377) nitroreductase [Clostridium difficile R20291] gi|260685589|ref|YP_003216722.1|; PP_00296 3e-92 Click
4285827..286303 phosphoribosylaminoimidazole carboxylase catalytic subunit [Clostridium difficile R20291] gi|260685590|ref|YP_003216723.1|; PP_00297 1e-80 Click
5286309..287007 PHAGE_Prochl_Syn1: phosphoribosylaminoimidazole-succinocarboxamide synthase; PP_00298; phage(gi326784002) 1e-48 Click
6287019..288386 PHAGE_Parame_FR483: hypothetical protein FR483_N035R; PP_00299; phage(gi155370133) 6e-22 Click
7288380..289456 PHAGE_Synech_S_SKS1: glycinamide ribonucleotide formyltransferase; PP_00300; phage(gi472340860) 2e-64 Click
8289450..290043 PHAGE_Synech_S_SKS1: cyanobacterial phosphoribosylglycinamide formyltransferase; PP_00301; phage(gi472340960) 2e-28 Click
9290036..291568 PHAGE_Prochl_P_SSM2: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase; PP_00302; phage(gi61806062) 3e-61 Click
10291579..292829 phosphoribosylamine--glycine ligase [Clostridium difficile R20291] gi|260685596|ref|YP_003216729.1|; PP_00303 0.0 Click
11292854..296660 PHAGE_Microb_Min1: putative phosphoribosyl formylglycinamidine (FGAM) synthase II; PP_00304; phage(gi149882852) 9e-35 Click
12296866..297738 PHAGE_Escher_phAPEC8: putative dTDP-4-dehydrorhamnose reductase; PP_00305; phage(gi448260370) 8e-35 Click
13297847..298716 PHAGE_Escher_phAPEC8: putative glucose-1-phosphate thymidylyltransferase; PP_00306; phage(gi448260372) 7e-97 Click
14298765..300342 PHAGE_Escher_phAPEC8: putative dTDP-glucose 4,6-dehydratase; PP_00307; phage(gi448260373) 1e-72 Click
15300372..301040 PHAGE_Pseudo_PB1: putative tail protein containing transglycosylase; PP_00308; phage(gi219523908) 2e-16 Click
16301049..301477 hypothetical protein CDR20291_0228 [Clostridium difficile R20291] gi|260685603|ref|YP_003216736.1|; PP_00309 2e-73 Click
17301501..301815 flagellar motor switch protein [Clostridium difficile R20291] gi|260685604|ref|YP_003216737.1|; PP_00310 1e-50 Click
18301967..302242 negative regulator of flagellin synthesis (anti-sigma-d factor) [Clostridium difficile R20291] gi|260685605|ref|YP_003216738.1|; PP_00311 3e-43 Click
19302247..302663 flagellar biosynthesis protein [Clostridium difficile R20291] gi|260685606|ref|YP_003216739.1|; PP_00312 3e-70 Click
20302681..303991 PHAGE_Melano_entomopoxvirus: ORF MSV156 hypothetical protein; PP_00313; phage(gi9631364) 5e-05 Click

Region 3, total : 30 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11484784..1484984 PHAGE_Lactoc_bIL312: Csp; PP_01395; phage(gi13095918) 6e-17 Click
21485405..1485833 regulatory protein [Clostridium difficile R20291] gi|260686563|ref|YP_003217696.1|; PP_01396 4e-77 Click
3complement(1485976..1486731) peptidyl-prolyl isomerase [Clostridium difficile R20291] gi|260686564|ref|YP_003217697.1|; PP_01397 6e-137 Click
4complement(1486852..1487268) hypothetical protein CDR20291_1200 [Clostridium difficile R20291] gi|260686565|ref|YP_003217698.1|; PP_01398 2e-73 Click
5complement(1487432..1487938) PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp43; PP_01399; phage(gi209901280) 3e-10 Click
6complement(1487983..1488339) PHAGE_Lactob_KC5a: putative transcriptional regulator; PP_01400; phage(gi90592588) 7e-13 Click
71488508..1488705 PHAGE_Staphy_phiETA: hypothetical protein phiETA_10; PP_01401; phage(gi17426238) 6e-06 Click
81488809..1489249 PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp73; PP_01402; phage(gi90592709) 8e-38 Click
91489498..1489941 PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp13; PP_01403; phage(gi90592649) 3e-24 Click
101489946..1491010 PHAGE_Clostr_phiMMP04: tail sheath; PP_01404; phage(gi414090451) 4e-69 Click
111491024..1491452 PHAGE_Clostr_phiMMP04: XkdM-related protein; PP_01405; phage(gi414090452) 8e-08 Click
121491578..1492024 PHAGE_Clostr_CD119: XkdN protein; PP_01406; phage(gi90592652) 4e-15 Click
131492051..1492218 hypothetical protein CDR20291_1209 [Clostridium difficile R20291] gi|260686574|ref|YP_003217707.1|; PP_01407 4e-26 Click
141492218..1494671 PHAGE_Clostr_phiMMP04: tail tape measure; PP_01408; phage(gi414090455) 6e-21 Click
151494671..1495093 PHAGE_Clostr_phiMMP04: peptidoglycan-binding lysin domain protein; PP_01409; phage(gi414090456) 2e-47 Click
161495375..1496904 PHAGE_Clostr_phiMMP04: cell wall hydrolase; PP_01410; phage(gi414090458) 6e-122 Click
171496920..1497246 PHAGE_Clostr_phiMMP04: hypothetical protein; PP_01411; phage(gi414090459) 3e-55 Click
181497246..1497674 PHAGE_Clostr_phiMMP04: XkdS-related protein; PP_01412; phage(gi414090460) 8e-64 Click
191497667..1498719 PHAGE_Clostr_phiMMP04: baseplate J-like assembly protein; PP_01413; phage(gi414090461) 3e-140 Click
201498716..1499414 PHAGE_Clostr_phiMMP04: hypothetical protein; PP_01414; phage(gi414090462) 3e-52 Click
211499415..1500401 PHAGE_Clostr_phiMMP04: tail fiber; PP_01415; phage(gi414090463) 1e-49 Click
221500423..1505597 PHAGE_Bathyc_BpV1: hypothetical protein; PP_01416; phage(gi313768166) 2e-18 Click
231505614..1505967 hypothetical protein CDR20291_1219 [Clostridium difficile R20291] gi|260686584|ref|YP_003217717.1|; PP_01417 5e-13 Click
241506230..1506490 PHAGE_Clostr_phiCD38_2: putative holin; PP_01418; phage(gi333798129) 4e-37 Click
25complement(1506697..1507152) hypothetical protein CDR20291_1221 [Clostridium difficile R20291] gi|260686586|ref|YP_003217719.1|; PP_01419 1e-78 Click
26complement(1507380..1507799) PHAGE_Strept_3: putative cI-like repressor; PP_01420; phage(gi28876313) 6e-08 Click
271508098..1508307 PHAGE_Bacill_BCJA1c: cro; PP_01421; phage(gi56694875) 4e-08 Click
281508339..1508548 hypothetical protein CDR20291_1224 [Clostridium difficile R20291] gi|260686589|ref|YP_003217722.1|; PP_01422 8e-33 Click
29complement(1508765..1509163) PHAGE_Lister_A118: putative repressor protein; PP_01423; phage(gi16798819) 1e-08 Click
30complement(1509583..1512075) PHAGE_Melano_entomopoxvirus: ORF MSV156 hypothetical protein; PP_01424; phage(gi9631364) 1e-12 Click

Region 4, total : 49 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11720737..1722425 PHAGE_Ostreo_2: putative acetolactate synthase large subunit; PP_01615; phage(gi314055125) 5e-61 Click
21722581..1722600 attL    TATTACAACTTAAGTAAATA 0.0 Click
3complement(1722785..1723915) PHAGE_Clostr_phiC2: putative integrase; PP_01616; phage(gi134287379) 3e-137 Click
4complement(1724155..1724661) PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp43; PP_01617; phage(gi209901280) 4e-09 Click
5complement(1724924..1726513) PHAGE_Bacill_phBC6A51: hypothetical protein BC1912; PP_01618; phage(gi31415804) 6e-74 Click
6complement(1726537..1727100) PHAGE_Lister_A500: gp33; PP_01619; phage(gi157324992) 4e-13 Click
71727253..1727474 PHAGE_Thermo_THSA_485A: helix-turn-helix domain protein; PP_01620; phage(gi397912659) 3e-06 Click
81727477..1728151 PHAGE_Clostr_phiC2: putative antirepressor; PP_01621; phage(gi134287384) 3e-44 Click
91728162..1728293 PHAGE_Staphy_PH15: putative antirepressor; PP_01622; phage(gi119967871) 5e-08 Click
101728342..1728470 hypothetical; PP_01623 0.0 Click
11complement(1728472..1728651) PHAGE_Clostr_phiC2: hypothetical protein phiC2p53; PP_01624; phage(gi134287385) 1e-16 Click
121728728..1728865 hypothetical; PP_01625 0.0 Click
131728876..1729100 hypothetical; PP_01626 0.0 Click
141729284..1729454 hypothetical; PP_01627 0.0 Click
151729598..1730260 PHAGE_Lister_B054: gp72; PP_01628; phage(gi157325355) 1e-55 Click
161730307..1730516 hypothetical; PP_01629 0.0 Click
17complement(1730526..1730900) hypothetical protein Desmer_1153 [Desulfosporosinus meridiei DSM 13257] gi|402571698|ref|YP_006621041.1|; PP_01630 3e-14 Click
181730976..1731173 PHAGE_Clostr_phiC2: putative repressor; PP_01631; phage(gi134287390) 3e-18 Click
191731204..1731596 PHAGE_Clostr_phiC2: hypothetical protein phiC2p59; PP_01632; phage(gi134287391) 7e-21 Click
201731583..1731726 hypothetical; PP_01633 0.0 Click
211731797..1732234 PHAGE_Entero_phiFL4A: hypothetical protein; PP_01634; phage(gi281416448) 6e-09 Click
221732246..1733412 PHAGE_Staphy_phi2958PVL: hypothetical protein phi2958PVL_gp17; PP_01635; phage(gi209363569) 2e-100 Click
231733427..1733762 hypothetical protein H04402_02629 [Clostridium botulinum H04402 065] gi|387818822|ref|YP_005679169.1|; PP_01636 2e-08 Click
241733815..1734387 hypothetical protein CDR20291_1422 [Clostridium difficile R20291] gi|260686786|ref|YP_003217919.1|; PP_01637 3e-105 Click
251734410..1734982 PHAGE_Bacill_PBC1: hypothetical protein; PP_01638; phage(gi389060352) 4e-52 Click
261734982..1736940 PHAGE_Bacill_PBC1: DNA polymerase; PP_01639; phage(gi389060355) 0.0 Click
271736952..1739369 PHAGE_Entero_phiFL4A: VirE domain protein; PP_01640; phage(gi281416460) 0.0 Click
281739353..1739478 hypothetical; PP_01641 0.0 Click
291739650..1739976 PHAGE_Staphy_2638A: ORF037; PP_01642; phage(gi66395482) 3e-15 Click
301740006..1741295 PHAGE_Entero_phiFL4A: DNA helicase; PP_01643; phage(gi281416462) 7e-148 Click
311741319..1741456 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp67; PP_01644; phage(gi209901304) 9e-05 Click
321741449..1741928 PHAGE_Clostr_PhiS63: gp40; PP_01645; phage(gi388570666) 1e-36 Click
331742067..1742336 PHAGE_Bacill_36: hypothetical protein 0305phi8-36p222; PP_01646; phage(gi156564203) 5e-06 Click
341742403..1742564 hypothetical protein Cspa_c26580 [Clostridium saccharoperbutylacetonicum N1-4(HMT)] gi|451819476|ref|YP_007455677.1|; PP_01647 2e-06 Click
35complement(1742592..1742792) PHAGE_Strept_4: hypothetical protein SpyM3_1259; PP_01648; phage(gi28876373) 7e-11 Click
361742921..1743394 PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp77; PP_01649; phage(gi90592713) 2e-82 Click
371743618..1743842 PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp77; PP_01650; phage(gi90592713) 2e-35 Click
381743865..1744446 PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp78; PP_01651; phage(gi90592714) 3e-45 Click
391744559..1745218 hypothetical; PP_01652 0.0 Click
401745277..1745960 PHAGE_Clostr_phiC2: putative terminase small subunit; PP_01653; phage(gi134287336) 4e-120 Click
411745950..1746180 PHAGE_Clostr_phiC2: putative terminase large subunit; PP_01654; phage(gi134287337) 1e-33 Click
421746196..1747542 PHAGE_Clostr_phiCD6356: hypothetical protein; PP_01655; phage(gi326536869) 1e-08 Click
431747542..1747721 PHAGE_Clostr_phiC2: hypothetical protein phiC2p34; PP_01656; phage(gi134287367) 1e-19 Click
441747762..1747992 PHAGE_Clostr_phiC2: hypothetical protein phiC2p35; PP_01657; phage(gi134287368) 7e-18 Click
451748012..1748269 PHAGE_Clostr_phiC2: holin; PP_01658; phage(gi134287369) 1e-43 Click
461748530..1749393 PHAGE_Clostr_phiC2: putative abortive infection bacteriophage resistance protein ORF 37; PP_01659; phage(gi134287370) 2e-166 Click
471749472..1750284 PHAGE_Clostr_phiC2: putative amidase/endolysin; PP_01660; phage(gi134287371) 1e-141 Click
481750571..1752580 PHAGE_Melano_entomopoxvirus: ORF MSV251 hypothetical protein containing C3H2C3 RING finger; PP_01661; phage(gi9631414) 8e-21 Click
49complement(1752625..1752810) PHAGE_Clostr_phiCD6356: hypothetical protein; PP_01662; phage(gi326536880) 2e-10 Click
50complement(1753039..1753167) PHAGE_Clostr_phiMMP04: hypothetical protein; PP_01663; phage(gi414090472) 2e-10 Click
511753481..1753500 attR    TATTACAACTTAAGTAAATA 0.0 Click

Region 5, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13543542..3543556 attL    TTTAAAACCTAAATC 0.0 Click
2complement(3544409..3545167) PHAGE_Clostr_phiCD6356: probable phage N-acetylmuramoyl-L-alanine amidase; PP_03278; phage(gi326536875) 3e-33 Click
3complement(3545305..3545568) PHAGE_Clostr_phiCTP1: predicted holin; PP_03279; phage(gi304360690) 9e-16 Click
4complement(3545635..3545781) hypothetical protein [Clostridium difficile BI1] gi|384358998|ref|YP_006196853.1|; PP_03280 4e-19 Click
5complement(3545951..3546133) PHAGE_Clostr_phiC2: hypothetical protein phiC2p34; PP_03281; phage(gi134287367) 3e-26 Click
6complement(3546133..3546426) PHAGE_Clostr_phiCD6356: hypothetical protein; PP_03282; phage(gi326536870) 1e-29 Click
7complement(3546443..3547921) PHAGE_Clostr_phiCD6356: hypothetical protein; PP_03283; phage(gi326536869) 1e-16 Click
8complement(3548278..3548805) hypothetical protein Desdi_1434 [Desulfitobacterium dichloroeliminans LMG P-21439] gi|431793424|ref|YP_007220329.1|; PP_03284 4e-61 Click
9complement(3548959..3549078) hypothetical; PP_03285 0.0 Click
103549245..3549466 PHAGE_Clostr_phiCD6356: helix-turn-helix domain protein; PP_03286; phage(gi326536884) 5e-12 Click
113549515..3549760 phage integrase [Clostridium difficile R20291] gi|260688348|ref|YP_003219482.1|; PP_03287 5e-18 Click
123549784..3549798 attR    TTTAAAACCTAAATC 0.0 Click
133550022..3550693 PHAGE_Rhodoc_REQ2: phage integrase; PP_03288; phage(gi372449859) 8e-25 Click

Region 6, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13680040..3680054 attL    AACTATTTATTAATT 0.0 Click
2complement(3693079..3693465) PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp42; PP_03411; phage(gi90592678) 1e-42 Click
3complement(3693505..3693786) PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp41; PP_03412; phage(gi90592677) 1e-47 Click
4complement(3694179..3694517) PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp57; PP_03413; phage(gi90592693) 1e-14 Click
5complement(3694522..3694794) PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp55; PP_03414; phage(gi90592691) 9e-40 Click
6complement(3694797..3695195) PHAGE_Clostr_phiMMP02: YopX; PP_03415; phage(gi414090425) 8e-47 Click
7complement(3695215..3696153) PHAGE_Clostr_CD119: putative replication protein; PP_03416; phage(gi90592688) 1e-19 Click
8complement(3696168..3697001) PHAGE_Geobac_GBSV1: DNA-binding phage-related protein; PP_03417; phage(gi115334612) 2e-56 Click
9complement(3697014..3697976) PHAGE_Lister_A118: gp47; PP_03418; phage(gi16798834) 1e-61 Click
10complement(3698099..3698326) PHAGE_Clostr_phiC2: hypothetical protein phiC2p62; PP_03419; phage(gi134287394) 8e-38 Click
11complement(3698326..3698484) PHAGE_Clostr_phiC2: hypothetical protein phiC2p61; PP_03420; phage(gi134287393) 2e-08 Click
123698640..3698828 PHAGE_Clostr_phiC2: hypothetical protein phiC2p53; PP_03421; phage(gi134287385) 3e-09 Click
13complement(3698806..3698946) hypothetical; PP_03422 0.0 Click
14complement(3698978..3699166) hypothetical; PP_03423 0.0 Click
15complement(3699268..3699597) PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp49; PP_03424; phage(gi90592685) 4e-39 Click
16complement(3699667..3700458) PHAGE_Brocho_BL3: gp34; PP_03425; phage(gi327409426) 7e-51 Click
17complement(3700451..3700687) PHAGE_Clostr_PhiS63: gp26; PP_03426; phage(gi388570671) 2e-07 Click
183700832..3701197 PHAGE_Clostr_CD119: RepR; putative repressor; PP_03427; phage(gi90592681) 5e-13 Click
19complement(3701212..3701352) hypothetical; PP_03428 0.0 Click
203701849..3703297 PHAGE_Melano_entomopoxvirus: ORF MSV156 hypothetical protein; PP_03429; phage(gi9631364) 6e-12 Click
213703567..3705231 PHAGE_Strept_1: hypothetical protein EJ-1p03; PP_03430; phage(gi39653677) 2e-84 Click
223705686..3706087 PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp44; PP_03431; phage(gi90592680) 3e-71 Click
233706152..3707270 PHAGE_Clostr_CD119: putative integrase; PP_03432; phage(gi90592679) 8e-115 Click
24complement(3707422..3708102) PHAGE_Ectoca_1: EsV-1-65; PP_03433; phage(gi13242537) 6e-08 Click
25complement(3708152..3710167) PHAGE_Feldma_virus: putative hybrid sensor histdine kinase; PP_03434; phage(gi197322490) 8e-13 Click
263710212..3710226 attR    AACTATTTATTAATT 0.0 Click
27complement(3710239..3710916) PHAGE_Feldma_virus: putative sensor histidine kinase; PP_03435; phage(gi197322366) 6e-05 Click
28complement(3711812..3712654) PHAGE_Cyanop_S_TIM5: phosphate ABC transporter substrate-binding protein; PP_03436; phage(gi422936171) 2e-17 Click

Region 7, total : 126 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14116908..4119334 PHAGE_Cyanop_S_TIM5: DNA gyrase subunit A; PP_03827; phage(gi422936149) 2e-75 Click
24119403..4119699 hypothetical protein CD196_0007 [Clostridium difficile CD196] gi|260681776|ref|YP_003213061.1|; PP_03828 1e-50 Click
34119699..4119959 hypothetical protein CD196_0008 [Clostridium difficile CD196] gi|260681777|ref|YP_003213062.1|; PP_03829 7e-41 Click
44119971..4120288 anti-sigma-B factor antagonist [Clostridium difficile CD196] gi|260681778|ref|YP_003213063.1|; PP_03830 4e-52 Click
54120292..4120699 anti-sigma-B factor (serine-protein kinase) [Clostridium difficile R20291] gi|260685376|ref|YP_003216509.1|; PP_03831 7e-71 Click
64120699..4121472 PHAGE_Bacill_BCP78: putative RNA polymerase sigma 28 subunit SigF; PP_03832; phage(gi410492877) 7e-18 Click
74121491..4122081 PHAGE_Clostr_phiC2: putative amidase/endolysin; PP_03833; phage(gi134287371) 9e-99 Click
84122230..4122304 tRNA 0.0 Click
94122310..4122395 tRNA 0.0 Click
104122411..4122486 tRNA 0.0 Click
114122494..4122568 tRNA 0.0 Click
124122500..4123102 diaminopropionate ammonia-lyase [Clostridium difficile R20291] gi|260688381|ref|YP_003219515.1|; PP_03834 1e-98 Click
134123086..4123631 N-acetylmuramoyl-L-alanine amidase [Clostridium difficile R20291] gi|260686259|ref|YP_003217392.1|; PP_03835 8e-94 Click
14complement(4123618..4124595) PHAGE_Clostr_phiC2: putative hydrolase; PP_03836; phage(gi134287357) 2e-111 Click
15complement(4124600..4124860) PHAGE_Clostr_phiC2: hypothetical protein phiC2p23; PP_03837; phage(gi134287358) 4e-37 Click
16complement(4124874..4124996) PHAGE_Clostr_phiC2: putative hydrolase; PP_03838; phage(gi134287357) 1e-16 Click
174124960..4125613 PHAGE_Clostr_phiC2: hypothetical protein phiC2p25; PP_03839; phage(gi134287359) 3e-98 Click
184125606..4125959 PHAGE_Clostr_phiC2: hypothetical protein phiC2p26; PP_03840; phage(gi134287360) 3e-59 Click
194126007..4126522 PHAGE_Clostr_phiC2: hypothetical protein phiC2p25; PP_03841; phage(gi134287359) 7e-93 Click
204126515..4127132 PHAGE_Clostr_phiC2: hypothetical protein phiC2p26; PP_03842; phage(gi134287360) 1e-116 Click
214127144..4127869 PHAGE_Clostr_phiC2: putative tail fiber protein; PP_03843; phage(gi134287361) 1e-122 Click
224127847..4127923 tRNA 0.0 Click
234127931..4128006 tRNA 0.0 Click
244128095..4128183 tRNA 0.0 Click
254128187..4128262 tRNA 0.0 Click
264128269..4128345 tRNA 0.0 Click
274128357..4128433 tRNA 0.0 Click
284128457..4128533 tRNA 0.0 Click
294128541..4128617 tRNA 0.0 Click
304128626..4128701 tRNA 0.0 Click
314128709..4128782 tRNA 0.0 Click
32complement(4128946..4129365) PHAGE_Strept_1: hypothetical protein EJ-1p60; PP_03844; phage(gi39653734) 5e-21 Click
33complement(4129370..4129630) PHAGE_Clostr_phiC2: hypothetical protein phiC2p23; PP_03845; phage(gi134287358) 1e-35 Click
34complement(4129644..4129763) PHAGE_Clostr_phiC2: putative hydrolase; PP_03846; phage(gi134287357) 4e-16 Click
354130073..4130918 N-acetylmuramoyl-L-alanine amidase [Clostridium difficile R20291] gi|260686258|ref|YP_003217391.1|; PP_03847 3e-152 Click
364130941..4131546 PHAGE_Clostr_phiC2: hypothetical protein phiC2p32; PP_03848; phage(gi134287365) 2e-96 Click
374131570..4131875 PHAGE_Clostr_phiC2: hypothetical protein phiC2p33; PP_03849; phage(gi134287366) 1e-50 Click
384131875..4132039 PHAGE_Clostr_phiC2: hypothetical protein phiC2p34; PP_03850; phage(gi134287367) 5e-17 Click
39complement(4132091..4132873) PHAGE_Clostr_phiC2: putative portal protein; PP_03851; phage(gi134287338) 3e-148 Click
40complement(4133238..4134431) PHAGE_Lausan: putative translation elongation factor 1-alpha; PP_03852; phage(gi327409596) 4e-20 Click
41complement(4134386..4134664) PHAGE_Clostr_phiC2: hypothetical protein phiC2p08; PP_03853; phage(gi134287343) 3e-35 Click
42complement(4134664..4135563) PHAGE_Clostr_phiC2: putative main capsid protein; PP_03854; phage(gi134287342) 2e-172 Click
43complement(4135575..4135982) PHAGE_Clostr_phiC2: putative scaffold protein; PP_03855; phage(gi134287341) 1e-75 Click
444137629..4138918 PHAGE_Clostr_phiC2: putative head morphogenesis protein; PP_03856; phage(gi134287339) 0.0 Click
454138933..4139133 PHAGE_Clostr_phiC2: hypothetical protein phiC2p05; PP_03857; phage(gi134287340) 3e-33 Click
464139199..4139363 PHAGE_Clostr_phiC2: putative scaffold protein; PP_03858; phage(gi134287341) 5e-24 Click
474139438..4140499 PHAGE_Clostr_phiC2: putative hydrolase; PP_03859; phage(gi134287357) 2e-47 Click
484140513..4140773 PHAGE_Clostr_phiC2: hypothetical protein phiC2p23; PP_03860; phage(gi134287358) 1e-41 Click
49complement(4141066..4141548) virulence factor MviN [Clostridium difficile R20291] gi|260686713|ref|YP_003217846.1|; PP_03861 3e-65 Click
50complement(4142021..4142905) PHAGE_Synech_S_CBS3: group 2 RNA polymerase sigma factor; PP_03862; phage(gi331028036) 5e-38 Click
514143140..4144525 PHAGE_Clostr_phiC2: putative head morphogenesis protein; PP_03863; phage(gi134287339) 3e-171 Click
524144491..4144733 hypothetical; PP_03864 0.0 Click
534145043..4145207 PHAGE_Clostr_phiC2: putative scaffold protein; PP_03865; phage(gi134287341) 8e-23 Click
544147736..4148344 PHAGE_Salmon_SFP10: peptidoglycan binding protein; PP_03866; phage(gi351518523) 4e-05 Click
55complement(4148568..4148750) transposase mutator type [Clostridium difficile R20291] gi|260688631|ref|YP_003219765.1|; PP_03867 7e-12 Click
564149532..4149909 PHAGE_Clostr_phiC2: putative transcriptional regulator; PP_03868; phage(gi134287378) 1e-31 Click
574149914..4152361 PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp31; PP_03869; phage(gi90592667) 0.0 Click
584152377..4152670 PHAGE_Clostr_phiCD6356: hypothetical protein; PP_03870; phage(gi326536870) 1e-38 Click
594152670..4152852 PHAGE_Clostr_phiC2: hypothetical protein phiC2p34; PP_03871; phage(gi134287367) 6e-26 Click
604153021..4153167 hypothetical protein [Clostridium difficile BI1] gi|384358998|ref|YP_006196853.1|; PP_03872 2e-20 Click
614153235..4153666 PHAGE_Clostr_phiMMP04: holin; PP_03873; phage(gi414090467) 1e-75 Click
624153771..4155432 PHAGE_Clostr_phiMMP02: hypothetical protein; PP_03874; phage(gi414090391) 0.0 Click
634155446..4155739 PHAGE_Clostr_phiMMP04: hypothetical protein; PP_03875; phage(gi414090465) 1e-46 Click
644155739..4155921 PHAGE_Clostr_phiC2: hypothetical protein phiC2p34; PP_03876; phage(gi134287367) 3e-24 Click
654155954..4156145 PHAGE_Clostr_phiC2: hypothetical protein phiC2p30; PP_03877; phage(gi134287363) 1e-27 Click
664156159..4156791 PHAGE_Clostr_phiC2: hypothetical protein phiC2p31; PP_03878; phage(gi134287364) 6e-110 Click
674156802..4157005 hypothetical; PP_03879 0.0 Click
684157115..4157552 PHAGE_Clostr_phiC2: hypothetical protein phiC2p12; PP_03880; phage(gi134287347) 1e-81 Click
694157545..4157721 hypothetical protein Cphy_2959 [Clostridium phytofermentans ISDg] gi|160881087|ref|YP_001560055.1|; PP_03881 4e-06 Click
704157722..4159032 PHAGE_Clostr_phiC2: putative sheath tail protein; PP_03882; phage(gi134287348) 0.0 Click
714159051..4159527 PHAGE_Clostr_phiC2: putative core tail; PP_03883; phage(gi134287349) 3e-78 Click
724159580..4159837 PHAGE_Clostr_phiC2: hypothetical protein phiC2p15; PP_03884; phage(gi134287350) 3e-31 Click
734159839..4160279 PHAGE_Clostr_phiC2: hypothetical protein phiC2p16; PP_03885; phage(gi134287351) 4e-77 Click
74complement(4161043..4161624) PHAGE_Clostr_phiC2: putative hydrolase; PP_03886; phage(gi134287357) 3e-102 Click
75complement(4161617..4162318) PHAGE_Clostr_phiC2: putative LysM; PP_03887; phage(gi134287356) 4e-130 Click
76complement(4162335..4164728) PHAGE_Clostr_phiC2: putative tail tape measure protein; PP_03888; phage(gi134287355) 1e-173 Click
77complement(4164792..4165310) PHAGE_Clostr_phiC2: hypothetical protein phiC2p19; PP_03889; phage(gi134287354) 6e-48 Click
78complement(4165348..4165920) PHAGE_Clostr_phiC2: putative hydrolase; PP_03890; phage(gi134287357) 6e-102 Click
79complement(4165913..4166602) PHAGE_Clostr_phiC2: putative LysM; PP_03891; phage(gi134287356) 3e-110 Click
80complement(4166618..4168987) PHAGE_Clostr_phiC2: putative tail tape measure protein; PP_03892; phage(gi134287355) 0.0 Click
81complement(4169054..4169581) PHAGE_Thermo_THSA_485A: hypothetical protein; PP_03893; phage(gi397912628) 4e-27 Click
82complement(4169587..4169748) hypothetical; PP_03894 0.0 Click
834169711..4170214 PHAGE_Clostr_phiC2: putative tail fiber protein; PP_03895; phage(gi134287361) 9e-56 Click
844170231..4171946 PHAGE_Clostr_phiMMP02: hypothetical protein; PP_03896; phage(gi414090391) 0.0 Click
854171960..4172256 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp27; PP_03897; phage(gi209901264) 1e-50 Click
864172256..4172438 PHAGE_Clostr_phiC2: hypothetical protein phiC2p34; PP_03898; phage(gi134287367) 7e-26 Click
874172473..4173705 PHAGE_Clostr_phiC2: hypothetical protein phiC2p30; PP_03899; phage(gi134287363) 1e-12 Click
884173702..4174001 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp30; PP_03900; phage(gi209901267) 1e-51 Click
894174002..4174139 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp31; PP_03901; phage(gi209901268) 2e-21 Click
904174171..4174401 PHAGE_Clostr_phiC2: hypothetical protein phiC2p35; PP_03902; phage(gi134287368) 2e-37 Click
914174421..4174678 PHAGE_Clostr_phiC2: holin; PP_03903; phage(gi134287369) 1e-40 Click
924174678..4174833 PHAGE_Clostr_phiC2: putative amidase/endolysin; PP_03904; phage(gi134287371) 4e-08 Click
93complement(4175052..4175228) hypothetical; PP_03905 0.0 Click
944175482..4175670 PHAGE_Clostr_phiC2: hypothetical protein phiC2p43; PP_03906; phage(gi134287376) 5e-33 Click
954176372..4176893 PHAGE_Clostr_phiC2: DUF955; PP_03907; phage(gi134287375) 1e-98 Click
964176887..4178455 PHAGE_Clostr_phiC2: hypothetical protein phiC2p41; PP_03908; phage(gi134287374) 0.0 Click
97complement(4178519..4179037) PHAGE_Clostr_phiC2: hypothetical protein phiC2p40; PP_03909; phage(gi134287373) 3e-92 Click
98complement(4179203..4179550) PHAGE_Clostr_phiC2: hypothetical protein phiC2p39; PP_03910; phage(gi134287372) 9e-61 Click
99complement(4179646..4179768) PHAGE_Clostr_phiC2: putative amidase/endolysin; PP_03911; phage(gi134287371) 7e-16 Click
100complement(4179810..4180517) PHAGE_Clostr_phiC2: putative hydrolase; PP_03912; phage(gi134287357) 5e-13 Click
101complement(4181018..4181452) DNA-binding domain-containing protein [Desulfitobacterium dichloroeliminans LMG P-21439] gi|431793308|ref|YP_007220213.1|; PP_03913 4e-25 Click
102complement(4181530..4182441) DNA-binding domain-containing protein [Desulfosporosinus orientis DSM 765] gi|374995486|ref|YP_004970985.1|; PP_03914 1e-82 Click
103complement(4182590..4182703) hypothetical; PP_03915 0.0 Click
104complement(4182708..4183259) PHAGE_Bacill_SPBc2: hypothetical protein SPBc2p012; PP_03916; phage(gi9630137) 2e-05 Click
105complement(4183273..4183749) hypothetical protein Desor_2720 [Desulfosporosinus orientis DSM 765] gi|374995278|ref|YP_004970777.1|; PP_03917 2e-62 Click
106complement(4183830..4184645) transcriptional regulator [Desulfosporosinus orientis DSM 765] gi|374995277|ref|YP_004970776.1|; PP_03918 3e-94 Click
1074185068..4185505 PHAGE_Clostr_phiC2: hypothetical protein phiC2p12; PP_03919; phage(gi134287347) 4e-78 Click
1084185498..4185674 hypothetical protein Sterm_1436 [Sebaldella termitidis ATCC 33386] gi|269120052|ref|YP_003308229.1|; PP_03920 5e-06 Click
1094185675..4186985 PHAGE_Clostr_phiC2: putative sheath tail protein; PP_03921; phage(gi134287348) 0.0 Click
1104187002..4187472 PHAGE_Clostr_phiC2: putative core tail; PP_03922; phage(gi134287349) 4e-74 Click
1114187544..4187984 PHAGE_Clostr_phiC2: hypothetical protein phiC2p16; PP_03923; phage(gi134287351) 2e-49 Click
1124188059..4188178 hypothetical; PP_03924 0.0 Click
1134188325..4188486 PHAGE_Clostr_phiCD38_2: hypothetical protein; PP_03925; phage(gi333798140) 1e-13 Click
1144189199..4189324 hypothetical; PP_03926 0.0 Click
1154189686..4190567 PHAGE_Clostr_phiMMP02: hypothetical protein; PP_03927; phage(gi414090383) 7e-10 Click
1164190639..4192927 PHAGE_Clostr_phiC2: putative tail tape measure protein; PP_03928; phage(gi134287355) 0.0 Click
1174192943..4193638 PHAGE_Clostr_phiC2: putative LysM; PP_03929; phage(gi134287356) 2e-109 Click
1184193631..4194791 PHAGE_Clostr_phiC2: putative hydrolase; PP_03930; phage(gi134287357) 0.0 Click
119complement(4194979..4195671) PHAGE_Clostr_phiC2: putative terminase small subunit; PP_03931; phage(gi134287336) 9e-131 Click
120complement(4195741..4195968) PHAGE_Clostr_phiC2: hypothetical protein phiC2p85; PP_03932; phage(gi134287417) 2e-38 Click
1214196092..4196409 PHAGE_Clostr_phiC2: hypothetical protein phiC2p84; PP_03933; phage(gi134287416) 6e-57 Click
122complement(4196389..4196577) PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp76; PP_03934; phage(gi90592712) 3e-29 Click
123complement(4196654..4197265) PHAGE_Clostr_phiC2: hypothetical protein phiC2p83; PP_03935; phage(gi134287415) 7e-107 Click
124complement(4197265..4197438) PHAGE_Clostr_phiC2: hypothetical protein phiC2p82; PP_03936; phage(gi134287414) 7e-26 Click
125complement(4198185..4198673) PHAGE_Clostr_phiC2: hypothetical protein phiC2p80; PP_03937; phage(gi134287412) 2e-90 Click
126complement(4198776..4199624) PHAGE_Clostr_phiC2: hypothetical protein phiC2p79; PP_03938; phage(gi134287411) 3e-158 Click
127complement(4199726..4200133) PHAGE_Clostr_phiC2: putative endodeoxyribonuclease RusA; PP_03939; phage(gi134287410) 1e-67 Click
128complement(4200130..4200243) PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp67; PP_03940; phage(gi209901304) 7e-16 Click
129complement(4200271..4200456) PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp68; PP_03941; phage(gi90592704) 7e-29 Click
130complement(4200487..4200693) hypothetical protein H04402_02623 [Clostridium botulinum H04402 065] gi|387818816|ref|YP_005679163.1|; PP_03942 1e-08 Click
131complement(4200674..4200961) PHAGE_Clostr_phiMMP02: hypothetical protein; PP_03943; phage(gi414090435) 1e-36 Click
132complement(4201054..4201362) hypothetical; PP_03944 0.0 Click
133complement(4201365..4201526) PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp65; PP_03945; phage(gi90592701) 8e-23 Click
134complement(4201523..4202248) PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp64; PP_03946; phage(gi90592700) 6e-125 Click
135complement(4202257..4203252) PHAGE_Clostr_phiC2: hypothetical protein phiC2p75; PP_03947; phage(gi134287407) 6e-156 Click
136complement(4203264..4203473) PHAGE_Clostr_phiC2: hypothetical protein phiC2p74; PP_03948; phage(gi134287406) 4e-31 Click
137complement(4203491..4204180) PHAGE_Burkho_phi1026b: gp47; PP_03949; phage(gi38707937) 5e-18 Click
138complement(4204294..4204470) PHAGE_Clostr_phiMMP02: hypothetical protein; PP_03950; phage(gi414090430) 6e-26 Click
139complement(4204473..4204589) PHAGE_Clostr_phiC2: hypothetical protein phiC2p72; PP_03951; phage(gi134287404) 2e-05 Click
140complement(4204586..4204726) PHAGE_Clostr_phiMMP02: hypothetical protein; PP_03952; phage(gi414090428) 3e-17 Click