Escherichia coli O157:H7 str. EC4076 , whole [asmbl_id: NC_000000].5705645, GC%: 50.56%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1227841..227853 attL    ACACCAACAAAAA 0.0 Click
2complement(227857..228264) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp78; ECH7EC4076_2816; phage(gi209447201) 4e-21 Click
3complement(228440..228709) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp76; ECH7EC4076_2817; phage(gi209447199) 2e-42 Click
4228708..228875 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip026; ECH7EC4076_2818; phage(gi20065822) 4e-26 Click
5228927..229253 PHAGE_Stx2_c_1717: putative transposase; ECH7EC4076_2819; phage(gi209447180) 1e-58 Click
6229250..230140 PROPHAGE_Escher_Sakai: putative transposase; ECH7EC4076_2820; phage(gi15834498) 2e-173 Click
7complement(230641..230988) PHAGE_Stx2_c_1717: transposase; ECH7EC4076_2821; phage(gi209447152) 2e-62 Click
8complement(231441..231671) PHAGE_Entero_2008: putative endolysin; ECH7EC4076_2822; phage(gi209427769) 4e-35 Click
9complement(231722..232066) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF47; ECH7EC4076_2823; phage(gi157166032) 3e-60 Click
10complement(232071..232286) PHAGE_Stx2_c_1717: holin protein S-like protein; ECH7EC4076_2824; phage(gi209447171) 7e-35 Click
11complement(232436..234289) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp44; ECH7EC4076_2825; phage(gi209447169) 0.0 Click
12234530..234859 conserved hypothetical protein; ECH7EC4076_2826 0.0 Click
13complement(234950..235666) conserved hypothetical protein; ECH7EC4076_2827 0.0 Click
14complement(235759..235875) hypothetical protein; ECH7EC4076_2828 0.0 Click
15complement(235946..236569) PHAGE_Entero_mEpX1: late gene regulator Q; ECH7EC4076_2829; phage(gi428781929) 7e-116 Click
16complement(236566..237231) PHAGE_Stx2_c_1717: NinI protein; ECH7EC4076_2830; phage(gi209447164) 3e-130 Click
17complement(237228..237839) PHAGE_Stx2_c_1717: NinG protein; ECH7EC4076_2831; phage(gi209447163) 5e-101 Click
18238746..239501 PROPHAGE_Escher_MG1655: IS30 transposase; ECH7EC4076_2832; phage(gi16132105) 2e-141 Click
19239561..239839 conserved hypothetical protein; ECH7EC4076_2833 0.0 Click
20complement(239915..240979) PHAGE_Cafete_BV_PW1: hypothetical protein; ECH7EC4076_2834; phage(gi310831380) 4e-15 Click
21complement(241519..241932) conserved hypothetical protein; ECH7EC4076_2835 0.0 Click
22complement(242030..242251) conserved hypothetical protein; ECH7EC4076_2836 0.0 Click
23complement(242429..244060) conserved DNA-binding protein; ECH7EC4076_2837 0.0 Click
24complement(244057..245370) site-specific recombinase, phage integrase family protein; ECH7EC4076_2838 0.0 Click
25248349..248361 attR    ACACCAACAAAAA 0.0 Click

Region 2, total : 40 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1910315..910329 attL    GCTTTTTTATACTAA 0.0 Click
2complement(910403..911473) PHAGE_Entero_HK106: integrase; ECH7EC4076_2081; phage(gi428783305) 0.0 Click
3911721..911891 hypothetical protein; ECH7EC4076_2082 0.0 Click
4912178..912300 conserved hypothetical protein; ECH7EC4076_2083 0.0 Click
5912572..912721 conserved hypothetical protein; ECH7EC4076_2084 0.0 Click
6complement(913252..913467) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; ECH7EC4076_2085; phage(gi20065893) 3e-34 Click
7complement(913544..913657) PHAGE_Entero_HK630: hypothetical protein; ECH7EC4076_2086; phage(gi428782820) 2e-12 Click
8complement(913887..914567) PHAGE_Stx2_c_1717: exonuclease; ECH7EC4076_2087; phage(gi209447136) 4e-132 Click
9complement(914564..915211) PHAGE_Stx2_c_I: Bet protein; ECH7EC4076_2088; phage(gi20065900) 1e-125 Click
10915604..916227 PHAGE_Entero_Sf6: gene 54 protein; ECH7EC4076_2089; phage(gi41057342) 2e-114 Click
11916224..916889 PHAGE_Stx2_c_1717: NinI protein; ECH7EC4076_2090; phage(gi209447164) 3e-130 Click
12complement(917101..918060) putative outer membrane protein; ECH7EC4076_2091 0.0 Click
13918535..919224 PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECH7EC4076_2092; phage(gi169257244) 3e-81 Click
14919435..920151 conserved hypothetical protein; ECH7EC4076_2093 0.0 Click
15920237..920395 PHAGE_Entero_P1: TciB; ECH7EC4076_2094; phage(gi46401695) 3e-06 Click
16921232..921729 PHAGE_Entero_cdtI: lysin; ECH7EC4076_2096; phage(gi148609440) 1e-91 Click
17921726..922193 PHAGE_Salmon_SPN9CC: endopeptidase; ECH7EC4076_2097; phage(gi389060532) 2e-78 Click
18922181..922333 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4076_2098; phage(gi428782374) 1e-21 Click
19923008..923499 PHAGE_Entero_mEp460: terminase small subunit; ECH7EC4076_2099; phage(gi428782317) 5e-74 Click
20923499..925601 PHAGE_Entero_cdtI: putative large terminase subunit; ECH7EC4076_2100; phage(gi148609384) 0.0 Click
21925598..925810 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp03; ECH7EC4076_2101; phage(gi148609385) 8e-35 Click
22927333..929291 PHAGE_Entero_cdtI: putative protease/scaffold protein; ECH7EC4076_2104; phage(gi148609387) 0.0 Click
23929378..929701 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp06; ECH7EC4076_2105; phage(gi148609388) 2e-54 Click
24929694..929969 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp07; ECH7EC4076_2106; phage(gi148609389) 6e-39 Click
25929981..930559 PHAGE_Entero_cdtI: putative tail component; ECH7EC4076_2107; phage(gi148609390) 2e-103 Click
26930556..930957 PHAGE_Entero_cdtI: putative tail component; ECH7EC4076_2108; phage(gi148609391) 8e-73 Click
27930968..931711 PHAGE_Entero_cdtI: putative major tail subunit; ECH7EC4076_2109; phage(gi148609392) 4e-137 Click
28931772..932158 PHAGE_Entero_cdtI: putative tail component; ECH7EC4076_2110; phage(gi148609393) 5e-65 Click
29932179..932496 PHAGE_Entero_cdtI: putative minor tail protein; ECH7EC4076_2111; phage(gi148609394) 1e-56 Click
30932468..935533 PHAGE_Entero_cdtI: putative tail protein; ECH7EC4076_2112; phage(gi148609395) 0.0 Click
31935533..935862 PHAGE_Entero_cdtI: putative minor tail protein; ECH7EC4076_2113; phage(gi148609396) 2e-61 Click
32935872..936570 PHAGE_Entero_cdtI: putative minor tail protein; ECH7EC4076_2114; phage(gi148609397) 9e-136 Click
33936576..937319 PHAGE_Entero_cdtI: putative tail protein; ECH7EC4076_2115; phage(gi148609398) 3e-142 Click
34937352..937864 PHAGE_Entero_cdtI: putative tail component; ECH7EC4076_2116; phage(gi148609399) 7e-86 Click
35937925..941338 PHAGE_Entero_cdtI: putative tail tip assembly protein; ECH7EC4076_2117; phage(gi148609400) 0.0 Click
36941409..942008 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; ECH7EC4076_2118; phage(gi148609401) 3e-104 Click
37942068..943384 PHAGE_Entero_cdtI: putative tail fiber protein; ECH7EC4076_2119; phage(gi148609402) 0.0 Click
38943386..943655 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp22; ECH7EC4076_2120; phage(gi148609404) 1e-46 Click
39943832..944812 PHAGE_Salmon_ST64B: hypothetical protein sb26; ECH7EC4076_2121; phage(gi23505470) 3e-90 Click
40944873..945865 non-LEE encoded type III effector C; ECH7EC4076_2122 0.0 Click
41946693..947574 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp23; ECH7EC4076_2123; phage(gi148609405) 9e-156 Click
42948905..948919 attR    GCTTTTTTATACTAA 0.0 Click

Region 3, total : 86 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11826051..1826062 attL    TTAATGGCCTCA 0.0 Click
2complement(1830162..1831427) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp22; ECH7EC4076_4794; phage(gi302393102) 0.0 Click
3complement(1831438..1831731) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp21; ECH7EC4076_4795; phage(gi302393101) 2e-32 Click
4complement(1831741..1832187) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp20; ECH7EC4076_4796; phage(gi302393100) 9e-78 Click
5complement(1832190..1832846) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp19; ECH7EC4076_4797; phage(gi302393099) 8e-121 Click
6complement(1832941..1833318) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp18; ECH7EC4076_4798; phage(gi302393098) 4e-67 Click
7complement(1833399..1833539) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp17; ECH7EC4076_4799; phage(gi302393097) 1e-21 Click
8complement(1833770..1834504) PHAGE_Stx2_c_II: outer membrane protein Lom precursor; ECH7EC4076_4800; phage(gi302393096) 8e-139 Click
9complement(1834595..1835212) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp15; ECH7EC4076_4801; phage(gi302393095) 4e-122 Click
10complement(1835511..1836779) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp13; ECH7EC4076_4802; phage(gi302393093) 0.0 Click
11complement(1836776..1838401) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp12; ECH7EC4076_4803; phage(gi302393092) 0.0 Click
12complement(1838516..1838629) hypothetical protein; ECH7EC4076_4804 0.0 Click
13complement(1839023..1839292) PHAGE_Stx2_c_II: putative tail fiber protein; ECH7EC4076_4806; phage(gi302393091) 4e-47 Click
14complement(1839294..1841231) PHAGE_Stx2_c_II: putative tail fiber protein; ECH7EC4076_4807; phage(gi302393090) 0.0 Click
15complement(1841228..1841878) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp09; ECH7EC4076_4808; phage(gi302393089) 9e-122 Click
16complement(1841878..1842441) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp08; ECH7EC4076_4809; phage(gi302393088) 2e-104 Click
17complement(1842425..1842886) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp07; ECH7EC4076_4810; phage(gi302393087) 2e-82 Click
18complement(1842936..1843325) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp06; ECH7EC4076_4811; phage(gi302393086) 2e-66 Click
19complement(1843381..1844595) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp05; ECH7EC4076_4812; phage(gi302393085) 0.0 Click
20complement(1844619..1845035) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp04; ECH7EC4076_4813; phage(gi302393084) 3e-73 Click
211845166..1845492 PHAGE_Stx2_c_II: putative transposase; ECH7EC4076_4814; phage(gi302393161) 1e-58 Click
221845489..1846379 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp77; ECH7EC4076_4815; phage(gi302393160) 2e-173 Click
23complement(1846382..1846939) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp04; ECH7EC4076_4816; phage(gi302393084) 5e-94 Click
24complement(1847097..1849241) PHAGE_Stx2_c_II: portal protein; ECH7EC4076_4817; phage(gi302393083) 0.0 Click
25complement(1849241..1850902) PHAGE_Stx2_c_II: terminase, large subunit; ECH7EC4076_4818; phage(gi302393082) 0.0 Click
26complement(1850928..1851734) PHAGE_Stx2_c_II: terminase, small subunit; ECH7EC4076_4819; phage(gi302393081) 3e-151 Click
27complement(1851790..1851903) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip164; ECH7EC4076_4820; phage(gi20065959) 6e-17 Click
281852143..1852436 PHAGE_Stx2_c_II: Bor protein precursor; ECH7EC4076_4821; phage(gi302393169) 2e-50 Click
29complement(1852468..1852932) PHAGE_Stx2_c_II: endopeptidase Rz; ECH7EC4076_4822; phage(gi302393167) 5e-69 Click
30complement(1852940..1853074) PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; ECH7EC4076_4823; phage(gi302861202) 4e-16 Click
31complement(1853089..1853658) PHAGE_Stx2_c_II: putative antirepressor protein Ant; ECH7EC4076_4824; phage(gi302393166) 1e-102 Click
32complement(1853932..1854465) PHAGE_Stx2_c_II: endolysin; ECH7EC4076_4825; phage(gi302393165) 2e-100 Click
33complement(1854470..1854685) PHAGE_Stx2_c_II: holin; ECH7EC4076_4826; phage(gi302393164) 2e-35 Click
34complement(1854762..1855034) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp80; ECH7EC4076_4827; phage(gi302393163) 1e-43 Click
35complement(1855075..1855254) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp79; ECH7EC4076_4828; phage(gi302393162) 2e-28 Click
36complement(1855267..1855392) PHAGE_Escher_TL_2011c: hypothetical protein; ECH7EC4076_4829; phage(gi418487096) 7e-19 Click
37complement(1855389..1857326) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip148; ECH7EC4076_4830; phage(gi20065943) 0.0 Click
38complement(1857813..1858082) PHAGE_Stx2_c_II: Shiga toxin 2 subunit B; ECH7EC4076_4831; phage(gi302393158) 1e-46 Click
39complement(1858094..1858876) PHAGE_Stx2_c_II: Shiga toxin 2 subunit A; ECH7EC4076_4832; phage(gi302393157) 7e-146 Click
40complement(1859143..1859221) tRNA 0.0 Click
41complement(1859233..1859311) tRNA 0.0 Click
42complement(1859318..1859393) tRNA 0.0 Click
43complement(1859835..1860269) PHAGE_Stx2_c_II: antitermination protein Q; ECH7EC4076_4837; phage(gi302393156) 8e-83 Click
44complement(1860262..1860456) PHAGE_Stx2_c_II: NinH protein; ECH7EC4076_4838; phage(gi302393155) 2e-32 Click
45complement(1860453..1861058) PHAGE_Stx2_c_II: NinG protein; ECH7EC4076_4839; phage(gi302393154) 3e-118 Click
46complement(1861058..1861780) PHAGE_Stx2_c_86: DNA-binding protein Roi; ECH7EC4076_4840; phage(gi116222069) 3e-132 Click
47complement(1861942..1862343) PHAGE_Stx1_converting: hypothetical protein Stx1_gp68; ECH7EC4076_4841; phage(gi302861190) 8e-76 Click
48complement(1862418..1863092) PHAGE_Stx2_c_II: putative antirepressor-like protein; ECH7EC4076_4842; phage(gi302393152) 2e-113 Click
49complement(1863540..1864067) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip133; ECH7EC4076_4843; phage(gi20065928) 4e-101 Click
50complement(1864093..1864212) hypothetical protein; ECH7EC4076_4844 0.0 Click
511864941..1865054 hypothetical protein; ECH7EC4076_4845 0.0 Click
52complement(1865597..1865875) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp62; ECH7EC4076_4847; phage(gi302393145) 5e-51 Click
53complement(1865946..1866236) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip128; ECH7EC4076_4848; phage(gi20065923) 2e-49 Click
54complement(1866233..1866934) PHAGE_Entero_4795: putative replication protein P; ECH7EC4076_4849; phage(gi157166012) 4e-132 Click
55complement(1866931..1867869) PHAGE_Entero_4795: putative replication protein O; ECH7EC4076_4850; phage(gi157166011) 0.0 Click
56complement(1867902..1868198) PHAGE_Entero_Min27: regulatory protein CII; ECH7EC4076_4851; phage(gi170783637) 4e-46 Click
57complement(1868337..1868564) PHAGE_Stx2_c_I: Cro protein; ECH7EC4076_4852; phage(gi20065917) 1e-37 Click
581868643..1869350 PHAGE_Stx2_c_I: CI protein; ECH7EC4076_4853; phage(gi20065916) 2e-134 Click
591869411..1869752 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp61; ECH7EC4076_4854; phage(gi116222054) 2e-64 Click
601870275..1871321 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip116; ECH7EC4076_4855; phage(gi20065911) 0.0 Click
611871977..1872360 PHAGE_Stx2_c_I: N protein; ECH7EC4076_4856; phage(gi20065909) 6e-68 Click
621872419..1872889 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip113; ECH7EC4076_4857; phage(gi20065908) 2e-91 Click
631873040..1873408 PHAGE_Stx2_c_I: Ea10 protein; ECH7EC4076_4858; phage(gi20065907) 7e-67 Click
641873614..1873778 PHAGE_Stx2_c_II: Kil protein; ECH7EC4076_4859; phage(gi302393131) 1e-19 Click
651873833..1874129 PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; ECH7EC4076_4860; phage(gi116222045) 3e-52 Click
661874135..1874920 PHAGE_Stx2_c_86: recombination protein Bet; ECH7EC4076_4861; phage(gi116222044) 3e-151 Click
671874917..1875597 PHAGE_Stx2_c_II: exonuclease; ECH7EC4076_4862; phage(gi302393128) 5e-131 Click
681875827..1875940 PHAGE_Entero_HK630: hypothetical protein; ECH7EC4076_4863; phage(gi428782820) 8e-14 Click
691876017..1876232 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp41; ECH7EC4076_4864; phage(gi302393124) 5e-35 Click
701876549..1877496 PHAGE_Entero_2008: hypothetical protein YYZ_gp09; ECH7EC4076_4865; phage(gi209427735) 1e-179 Click
711877498..1878004 PHAGE_Entero_phiV10: hypothetical protein PhiV10p53; ECH7EC4076_4866; phage(gi89152467) 7e-21 Click
721877964..1878179 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp36; ECH7EC4076_4867; phage(gi302393119) 1e-36 Click
731878181..1878399 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp35; ECH7EC4076_4868; phage(gi302393118) 1e-36 Click
741878401..1878688 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp34; ECH7EC4076_4869; phage(gi302393117) 1e-51 Click
751880345..1880572 PHAGE_Stx2_c_II: putative antirepressor protein AntB; ECH7EC4076_4871; phage(gi302393111) 4e-29 Click
761880615..1880782 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp41; ECH7EC4076_4872; phage(gi116222033) 9e-29 Click
771881009..1881635 PHAGE_Escher_P13374: methylase; ECH7EC4076_4873; phage(gi410491602) 4e-122 Click
781881595..1881807 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp43; ECH7EC4076_4874; phage(gi302393126) 2e-09 Click
791881835..1881846 attL    AGAAAAAAATGA 0.0 Click
801881843..1882220 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp38; ECH7EC4076_4875; phage(gi116222030) 1e-63 Click
811882299..1882481 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp37; ECH7EC4076_4877; phage(gi116222029) 4e-29 Click
82complement(1882465..1883634) PHAGE_Stx2_c_86: integrase; ECH7EC4076_4876; phage(gi116222028) 0.0 Click
831883829..1883905 tRNA 0.0 Click
841884066..1885223 PROPHAGE_Escher_Sakai: putative prophage Sf6-like integrase; ECH7EC4076_4879; phage(gi15832485) 0.0 Click
85complement(1885398..1886534) PHAGE_Salmon_vB_SemP_Emek: injection protein; ECH7EC4076_4880; phage(gi399498803) 3e-51 Click
86complement(1886544..1887224) PHAGE_Sodali_phiSG1: phage DNA transfer protein; ECH7EC4076_4881; phage(gi89886000) 2e-75 Click
87complement(1887211..1887678) PHAGE_Sodali_phiSG1: hypothetical protein SGPHI_0018; ECH7EC4076_4882; phage(gi89885999) 2e-64 Click
88complement(1887678..1888208) PHAGE_Entero_Sf6: gene 9 protein; ECH7EC4076_4883; phage(gi41057287) 9e-92 Click
891888230..1888925 conserved hypothetical protein; ECH7EC4076_4884 0.0 Click
901889126..1889137 attR    AGAAAAAAATGA 0.0 Click
91complement(1889595..1891007) conserved hypothetical protein; ECH7EC4076_4885 0.0 Click
92complement(1891194..1891370) conserved hypothetical protein; ECH7EC4076_4886 0.0 Click
931891673..1892299 PHAGE_Staphy_StB27: integrase; ECH7EC4076_4887; phage(gi431809677) 3e-10 Click
941907245..1907256 attR    TTAATGGCCTCA 0.0 Click

Region 4, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12015907..2015918 attL    ACTTCTTCTTCA 0.0 Click
22027212..2027748 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4076_3673; phage(gi428782339) 2e-100 Click
32027945..2028118 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4076_3674; phage(gi428782340) 4e-26 Click
4complement(2028166..2028447) PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4076_3675; phage(gi428782341) 1e-48 Click
5complement(2028484..2028600) PHAGE_Entero_mEp460: putative exonuclease; ECH7EC4076_3676; phage(gi428782342) 2e-16 Click
6complement(2028792..2028989) PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4076_3677; phage(gi428782343) 1e-13 Click
7complement(2029606..2029935) PHAGE_Escher_P13374: hypothetical protein; ECH7EC4076_3680; phage(gi410491610) 4e-38 Click
8complement(2029947..2030483) PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4076_3681; phage(gi428782349) 8e-99 Click
9complement(2030611..2030997) PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4076_3682; phage(gi428782350) 2e-65 Click
102031084..2031737 PHAGE_Entero_2008: phage-related tail protein; ECH7EC4076_3683; phage(gi209427791) 1e-78 Click
112031805..2032404 PHAGE_Entero_mEp460: Lom protein; ECH7EC4076_3684; phage(gi428782335) 2e-106 Click
122032469..2033782 PROPHAGE_Escher_Sakai: putative tail fiber protein; ECH7EC4076_3685; phage(gi15832195) 0.0 Click
132033784..2034053 PHAGE_Stx2_c_II: putative tail fiber protein; ECH7EC4076_3686; phage(gi302393091) 8e-44 Click
142034165..2034737 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp78; ECH7EC4076_3687; phage(gi209447201) 6e-21 Click
152035038..2035439 PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECH7EC4076_3688; phage(gi209427795) 2e-72 Click
162035521..2036162 PHAGE_Entero_2008: hypothetical protein YYZ_gp73; ECH7EC4076_3689; phage(gi209427796) 2e-117 Click
17complement(2036323..2036571) PHAGE_Entero_mEp460: DinI-like protein; ECH7EC4076_3690; phage(gi428782337) 1e-40 Click
18complement(2036633..2037730) PHAGE_Entero_mEp460: integrase; ECH7EC4076_3691; phage(gi428782338) 0.0 Click
192037819..2038856 tRNA-dihydrouridine synthase A; ECH7EC4076_3692 0.0 Click
202038990..2039232 phage shock protein G; ECH7EC4076_3693 0.0 Click
21complement(2039398..2040381) quinone oxidoreductase; ECH7EC4076_3694 0.0 Click
222040464..2041879 PHAGE_Entero_P1: Ban; ECH7EC4076_3695; phage(gi46401697) 0.0 Click
232044998..2045009 attR    ACTTCTTCTTCA 0.0 Click

Region 5, total : 38 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12505365..2506414 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4076_1422; phage(gi428782365) 8e-112 Click
22506427..2506798 PHAGE_Escher_HK75: RusA-like protein; ECH7EC4076_1423; phage(gi356870726) 1e-36 Click
32507034..2507159 PHAGE_Escher_TL_2011c: putative late gene regulator Q; ECH7EC4076_1424; phage(gi418487066) 3e-11 Click
42507311..2508129 CAAX amino terminal protease family; ECH7EC4076_1425 0.0 Click
5complement(2508719..2508859) hypothetical protein; ECH7EC4076_1427 0.0 Click
62508876..2509463 putative envelope protein encoded within prophage CP-933N; ECH7EC4076_1428 0.0 Click
72509492..2509567 tRNA 0.0 Click
82509574..2509652 tRNA 0.0 Click
92509664..2509742 tRNA 0.0 Click
10complement(2509834..2509962) conserved hypothetical protein; ECH7EC4076_1432 0.0 Click
112510231..2512081 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECH7EC4076_1433; phage(gi209427766) 0.0 Click
122512257..2512583 PHAGE_Stx2_c_II: putative transposase; ECH7EC4076_1434; phage(gi302393161) 1e-58 Click
132512580..2513470 PROPHAGE_Escher_Sakai: putative transposase; ECH7EC4076_1435; phage(gi15834498) 2e-173 Click
14complement(2514232..2514372) conserved hypothetical protein; ECH7EC4076_1436 0.0 Click
15complement(2514455..2514922) PHAGE_Entero_4795: putative endopeptidase Rz; ECH7EC4076_1437; phage(gi157166036) 1e-73 Click
16complement(2514924..2515037) hypothetical protein; ECH7EC4076_1438 0.0 Click
17complement(2515258..2515791) PHAGE_Entero_2008: putative endolysin; ECH7EC4076_1439; phage(gi209427769) 2e-99 Click
182515909..2516223 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp06; ECH7EC4076_1440; phage(gi116221998) 4e-18 Click
19complement(2516479..2516685) PHAGE_Stx2_c_1717: holin protein S-like protein; ECH7EC4076_1441; phage(gi209447171) 3e-31 Click
202516693..2516854 conserved hypothetical protein; ECH7EC4076_1442 0.0 Click
212517436..2517711 conserved hypothetical protein; ECH7EC4076_1443 0.0 Click
222518164..2518511 PHAGE_Stx2_c_1717: transposase; ECH7EC4076_1444; phage(gi209447152) 2e-62 Click
232518561..2520099 PHAGE_Stx2_c_1717: transposase; ECH7EC4076_1445; phage(gi209447153) 0.0 Click
242520149..2520391 PHAGE_Entero_HK630: terminase small subunit nu1; ECH7EC4076_1446; phage(gi428782788) 2e-13 Click
252522276..2522482 PHAGE_Entero_HK630: head-tail connector W; ECH7EC4076_1449; phage(gi428782790) 1e-11 Click
262524063..2525568 PHAGE_Entero_HK630: head maturation protease C; ECH7EC4076_1452; phage(gi428782792) 4e-108 Click
272525605..2525952 PHAGE_Entero_HK630: head decoration protein D; ECH7EC4076_1453; phage(gi428782794) 6e-25 Click
282526010..2526276 PHAGE_Entero_HK630: major head subunit E; ECH7EC4076_1454; phage(gi428782795) 2e-20 Click
292526336..2526998 PHAGE_Entero_HK630: major tail protein V; ECH7EC4076_1455; phage(gi428782800) 5e-97 Click
302527012..2527443 PHAGE_Entero_HK630: minor tail protein G; ECH7EC4076_1456; phage(gi428782801) 5e-45 Click
312527494..2527883 PHAGE_Entero_HK630: tail assembly protein GT; ECH7EC4076_1457; phage(gi428782802) 4e-43 Click
322527864..2530443 PHAGE_Entero_HK630: tail length tape measure protein H; ECH7EC4076_1458; phage(gi428782803) 0.0 Click
332530440..2530769 PHAGE_Entero_HK630: minor tail protein M; ECH7EC4076_1459; phage(gi428782804) 4e-45 Click
342530769..2531467 PHAGE_Entero_HK630: minor tail protein L; ECH7EC4076_1460; phage(gi428782805) 1e-105 Click
352531586..2532221 PROPHAGE_Escher_Sakai: putative tail assembly protein; ECH7EC4076_1461; phage(gi15832200) 2e-127 Click
362532218..2532799 PHAGE_Stx2_c_1717: putative tail component; ECH7EC4076_1462; phage(gi209447195) 8e-106 Click
37complement(2532990..2533649) PHAGE_Salmon_1: hypothetical bacteriophage protein; ECH7EC4076_1463; phage(gi169257202) 4e-61 Click
382533651..2537124 PHAGE_Entero_HK630: tail fiber J; ECH7EC4076_1464; phage(gi428782808) 0.0 Click
392537192..2537791 PHAGE_Stx2_c_1717: outer membrane protein Lom precursor; ECH7EC4076_1465; phage(gi209447197) 9e-113 Click
402537813..2539168 PROPHAGE_Escher_Sakai: putative tail fiber protein; ECH7EC4076_1466; phage(gi15832195) 0.0 Click
412539170..2539439 PHAGE_Stx2_c_II: putative tail fiber protein; ECH7EC4076_1467; phage(gi302393091) 2e-43 Click

Region 6, total : 68 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13045428..3045440 attL    CCGCGCCGCTATT 0.0 Click
23046956..3047159 PHAGE_Salmon_SSU5: putative selenium-binding protein YdfZ; ECH7EC4076_5970; phage(gi410491512) 1e-13 Click
3complement(3047195..3048655) PHAGE_Microm_MpV1: hypothetical protein; ECH7EC4076_5971; phage(gi313768442) 4e-41 Click
4complement(3048744..3050027) PHAGE_Burkho_phi1026b: gp59; ECH7EC4076_5972; phage(gi38707949) 2e-33 Click
53050195..3050401 PHAGE_Entero_2008: putative DNA damage-inducible protein; ECH7EC4076_5973; phage(gi209427797) 5e-28 Click
6complement(3050563..3051204) PHAGE_Entero_2008: hypothetical protein YYZ_gp73; ECH7EC4076_5974; phage(gi209427796) 3e-117 Click
7complement(3051286..3051687) PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECH7EC4076_5975; phage(gi209427795) 6e-71 Click
8complement(3051988..3052323) PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECH7EC4076_5976; phage(gi209427795) 2e-19 Click
9complement(3052677..3052946) PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ECH7EC4076_5977; phage(gi209427794) 5e-46 Click
10complement(3052948..3054261) PHAGE_Entero_2008: putative tail protein; ECH7EC4076_5978; phage(gi209427793) 0.0 Click
11complement(3054326..3054925) PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECH7EC4076_5979; phage(gi209427792) 2e-114 Click
12complement(3054993..3057506) PHAGE_Entero_2008: phage-related tail protein; ECH7EC4076_5980; phage(gi209427791) 0.0 Click
13complement(3057503..3059071) PHAGE_Entero_2008: phage-related tail protein; ECH7EC4076_5981; phage(gi209427791) 0.0 Click
14complement(3059413..3059994) PHAGE_Entero_2008: putative tail assembly protein; ECH7EC4076_5982; phage(gi209427790) 2e-101 Click
15complement(3059991..3060734) PHAGE_Entero_2008: putative tail component K-like protein; ECH7EC4076_5983; phage(gi209427789) 3e-138 Click
16complement(3060745..3061443) PHAGE_Entero_2008: putative tail protein; ECH7EC4076_5984; phage(gi209427787) 4e-126 Click
17complement(3061443..3061784) PHAGE_Entero_2008: putative minor tail protein; ECH7EC4076_5985; phage(gi209427786) 4e-64 Click
18complement(3061777..3065019) PHAGE_Entero_2008: putative tail protein; ECH7EC4076_5986; phage(gi209427785) 0.0 Click
19complement(3065071..3065274) PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECH7EC4076_5987; phage(gi209427784) 3e-32 Click
20complement(3065376..3065750) PHAGE_Entero_2008: putative tail assembly protein; ECH7EC4076_5988; phage(gi209427783) 2e-65 Click
21complement(3065756..3066472) PHAGE_Entero_2008: putative tail protein; ECH7EC4076_5989; phage(gi209427782) 5e-122 Click
22complement(3066531..3066875) PHAGE_Entero_2008: putative prophage structural protein; ECH7EC4076_5990; phage(gi209427781) 6e-60 Click
23complement(3066872..3067318) PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ECH7EC4076_5991; phage(gi209427780) 2e-80 Click
24complement(3067315..3067665) PHAGE_Entero_2008: putative head-tail adaptor; ECH7EC4076_5992; phage(gi209427779) 9e-61 Click
25complement(3067675..3068001) PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ECH7EC4076_5993; phage(gi209427778) 6e-54 Click
26complement(3070042..3070263) PHAGE_Entero_2008: hypothetical protein YYZ_gp53; ECH7EC4076_5996; phage(gi209427801) 5e-35 Click
27complement(3070308..3070841) PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECH7EC4076_5997; phage(gi209427776) 1e-92 Click
28complement(3070807..3071214) PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECH7EC4076_5998; phage(gi209427768) 9e-54 Click
29complement(3071219..3071425) PHAGE_Entero_2008: lysis protein; ECH7EC4076_5999; phage(gi209427767) 6e-33 Click
303071433..3071594 conserved hypothetical protein; ECH7EC4076_6000 0.0 Click
31complement(3071873..3073723) PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECH7EC4076_6001; phage(gi209427766) 0.0 Click
32complement(3074037..3074204) PHAGE_Entero_P1: TciB; ECH7EC4076_6003; phage(gi46401695) 1e-08 Click
33complement(3074201..3074632) PHAGE_Pseudo_AF: putative tellurite resistance protein; ECH7EC4076_6004; phage(gi431810338) 1e-28 Click
34complement(3074801..3074879) tRNA 0.0 Click
35complement(3074979..3075054) tRNA 0.0 Click
36complement(3075083..3075670) putative transcriptional regulator; ECH7EC4076_6007 0.0 Click
373075687..3075827 hypothetical protein; ECH7EC4076_6008 0.0 Click
38complement(3075932..3076252) PHAGE_Entero_phiP27: hypothetical protein P27p23; ECH7EC4076_6009; phage(gi18249887) 7e-29 Click
39complement(3076354..3076908) PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; ECH7EC4076_6010; phage(gi399528832) 9e-07 Click
40complement(3077289..3078338) PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4076_6012; phage(gi428782365) 2e-112 Click
41complement(3078340..3078612) PHAGE_Gifsy_2: hypothetical protein STM1021.1n.Gifsy2; ECH7EC4076_6013; phage(gi169257287) 5e-14 Click
42complement(3078734..3079078) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip070; ECH7EC4076_6014; phage(gi20065865) 8e-59 Click
43complement(3079644..3080201) PHAGE_Escher_TL_2011c: hypothetical protein; ECH7EC4076_6015; phage(gi418487081) 6e-28 Click
44complement(3080203..3080421) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip090; ECH7EC4076_6016; phage(gi20065885) 3e-24 Click
45complement(3080549..3080860) PHAGE_Entero_mEp213: hypothetical protein; ECH7EC4076_6017; phage(gi428782634) 9e-21 Click
46complement(3080853..3081080) PHAGE_Salmon_1: hypothetical protein STM0896.1n.Fels1; ECH7EC4076_6018; phage(gi169257161) 2e-16 Click
47complement(3081077..3081331) conserved hypothetical protein; ECH7EC4076_6019 0.0 Click
48complement(3081391..3082107) conserved hypothetical protein; ECH7EC4076_6020 0.0 Click
49complement(3082141..3082602) PHAGE_Escher_HK639: replication protein 14; ECH7EC4076_6021; phage(gi356870655) 5e-29 Click
50complement(3082595..3083638) PHAGE_Escher_TL_2011b: hypothetical protein; ECH7EC4076_6022; phage(gi418487646) 3e-48 Click
51complement(3083707..3084132) PHAGE_Escher_HK639: cII; ECH7EC4076_6023; phage(gi356870652) 2e-05 Click
523084489..3085088 PHAGE_Pectob_ZF40: putative cI repressor; ECH7EC4076_6024; phage(gi422936650) 2e-17 Click
533085300..3085533 PHAGE_Salico_CGphi29: hypothetical protein; ECH7EC4076_6025; phage(gi472340166) 5e-09 Click
543085545..3086183 PHAGE_Escher_TL_2011c: hypothetical protein; ECH7EC4076_6026; phage(gi418487085) 6e-09 Click
55complement(3086184..3086393) hypothetical protein; ECH7EC4076_6027 0.0 Click
56complement(3086692..3086847) hypothetical protein; ECH7EC4076_6028 0.0 Click
573086958..3087146 conserved domain protein; ECH7EC4076_6029 0.0 Click
583087143..3087331 conserved hypothetical protein; ECH7EC4076_6030 0.0 Click
593087424..3088668 PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; ECH7EC4076_6031; phage(gi169257272) 7e-92 Click
603088410..3088422 attR    CCGCGCCGCTATT 0.0 Click
613088650..3089201 PHAGE_Entero_2008: putative integrase; ECH7EC4076_6032; phage(gi209427727) 2e-61 Click
623089415..3089621 PHAGE_Entero_2008: putative DNA damage-inducible protein; ECH7EC4076_6033; phage(gi209427797) 5e-28 Click
63complement(3089671..3090540) PROPHAGE_Escher_CFT073: transposase; ECH7EC4076_6034; phage(gi26246249) 1e-126 Click
643090961..3091308 PHAGE_Stx2_c_1717: transposase; ECH7EC4076_6035; phage(gi209447152) 2e-62 Click
653091358..3092896 PHAGE_Stx2_c_1717: transposase; ECH7EC4076_6036; phage(gi209447153) 0.0 Click
66complement(3092907..3093329) PROPHAGE_Escher_CFT073: transposase; ECH7EC4076_6037; phage(gi26246249) 9e-39 Click
67complement(3093479..3094129) PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECH7EC4076_6038; phage(gi209427795) 3e-21 Click
68complement(3094403..3094549) conserved hypothetical protein; ECH7EC4076_6039 0.0 Click
69complement(3094840..3095415) PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECH7EC4076_6040; phage(gi209427795) 3e-21 Click
70complement(3095529..3095798) PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ECH7EC4076_6041; phage(gi209427794) 5e-45 Click
71complement(3095800..3097023) PHAGE_Entero_2008: putative tail protein; ECH7EC4076_6042; phage(gi209427793) 0.0 Click
72complement(3097088..3097687) PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECH7EC4076_6043; phage(gi209427792) 2e-114 Click

Region 7, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3721786..3722607) PHAGE_Stx2_c_1717: bacteriophage DNA replication protein O; ECH7EC4076_3147; phage(gi209447149) 4e-156 Click
2complement(3722788..3723084) PHAGE_Stx2_c_1717: CII protein; ECH7EC4076_3148; phage(gi209447147) 2e-50 Click
33723216..3723228 attL    GCTCCGCTTATTA 0.0 Click
43723517..3724212 PHAGE_Stx2_c_1717: repressor; ECH7EC4076_3149; phage(gi209447145) 2e-126 Click
53724357..3724491 hypothetical protein; ECH7EC4076_3150 0.0 Click
63724855..3725235 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp19; ECH7EC4076_3151; phage(gi209447144) 8e-67 Click
73726295..3726546 PHAGE_Entero_mEp234: hypothetical protein; ECH7EC4076_3152; phage(gi428782288) 2e-44 Click
83726729..3727097 PHAGE_Stx2_c_1717: putative single-stranded DNA binding protein; ECH7EC4076_3153; phage(gi209447141) 2e-68 Click
93727303..3727446 PHAGE_Stx2_c_1717: Kil protein; ECH7EC4076_3154; phage(gi209447139) 2e-20 Click
103727521..3727817 PHAGE_Stx2_c_1717: Gam; ECH7EC4076_3155; phage(gi209447138) 5e-53 Click
113727823..3728608 PHAGE_Stx2_c_1717: Bet recombination protein; ECH7EC4076_3156; phage(gi209447137) 1e-150 Click
12complement(3728903..3729793) PROPHAGE_Escher_Sakai: putative transposase; ECH7EC4076_3157; phage(gi15834498) 2e-173 Click
13complement(3729790..3730116) PHAGE_Stx2_c_1717: putative transposase; ECH7EC4076_3158; phage(gi209447180) 1e-58 Click
143730209..3730598 PHAGE_Stx2_c_1717: exonuclease; ECH7EC4076_3159; phage(gi209447136) 1e-72 Click
153730828..3730941 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp10; ECH7EC4076_3160; phage(gi209447135) 5e-14 Click
163731018..3731233 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp09; ECH7EC4076_3161; phage(gi209447134) 5e-35 Click
173731550..3732497 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp07; ECH7EC4076_3162; phage(gi209447132) 0.0 Click
183733362..3733712 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp04; ECH7EC4076_3165; phage(gi209447129) 1e-67 Click
193733900..3734244 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp03; ECH7EC4076_3166; phage(gi209447128) 2e-61 Click
203734322..3734513 PHAGE_Entero_mEp234: hypothetical protein; ECH7EC4076_3168; phage(gi428782280) 8e-33 Click
21complement(3734494..3735672) PHAGE_Stx2_c_1717: integrase; ECH7EC4076_3167; phage(gi209447127) 0.0 Click
223742337..3742349 attR    GCTCCGCTTATTA 0.0 Click

Region 8, total : 31 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3823324..3823578) PHAGE_Yersin_413C: Ogr; ECH7EC4076_3247; phage(gi30065732) 2e-45 Click
2complement(3823624..3824787) PHAGE_Yersin_413C: gpD; ECH7EC4076_3248; phage(gi30065731) 0.0 Click
3complement(3824787..3825266) PHAGE_Yersin_413C: gpU; ECH7EC4076_3249; phage(gi30065730) 4e-85 Click
4complement(3825281..3827728) PHAGE_Yersin_413C: gpT; ECH7EC4076_3250; phage(gi30065729) 0.0 Click
5complement(3828205..3828723) PHAGE_Yersin_413C: FII; ECH7EC4076_3253; phage(gi30065726) 6e-93 Click
6complement(3828736..3829926) PHAGE_Yersin_413C: gpFI; ECH7EC4076_3254; phage(gi30065725) 0.0 Click
7complement(3829986..3830579) PHAGE_Entero_2: DNA-invertase; ECH7EC4076_3255; phage(gi169936026) 9e-88 Click
83830610..3831020 PHAGE_Erwini_ENT90: phage tail collar domain protein; ECH7EC4076_3256; phage(gi431810938) 1e-13 Click
93831041..3831484 PHAGE_Entero_mEp213: tail fiber assembly protein; ECH7EC4076_3258; phage(gi428782612) 2e-26 Click
10complement(3831456..3832058) PHAGE_Entero_HK106: tail fiber assembly protein; ECH7EC4076_3257; phage(gi428783304) 1e-95 Click
11complement(3832058..3833377) PHAGE_Salmon_RE_2010: tail fiber protein; ECH7EC4076_3259; phage(gi418489713) 2e-108 Click
12complement(3833374..3833985) PHAGE_Yersin_413C: gpI; ECH7EC4076_3260; phage(gi30065721) 3e-82 Click
13complement(3833978..3834886) PHAGE_Yersin_413C: gpJ; ECH7EC4076_3261; phage(gi30065720) 3e-166 Click
14complement(3834891..3835238) PHAGE_Yersin_413C: gpW; ECH7EC4076_3262; phage(gi30065719) 2e-59 Click
15complement(3835235..3835870) PHAGE_Yersin_413C: gpV; ECH7EC4076_3263; phage(gi30065718) 4e-117 Click
16complement(3835937..3836389) PHAGE_Yersin_413C: gpS; ECH7EC4076_3264; phage(gi30065717) 1e-77 Click
17complement(3836382..3836849) PHAGE_Yersin_413C: gpR; ECH7EC4076_3265; phage(gi30065716) 2e-83 Click
18complement(3836812..3836970) PHAGE_Erwini_ENT90: putative host lysis-related protein; ECH7EC4076_3266; phage(gi431810968) 2e-10 Click
19complement(3836957..3837382) PHAGE_Yersin_413C: LysB; ECH7EC4076_3267; phage(gi30065715) 1e-68 Click
20complement(3837370..3837795) PHAGE_Yersin_413C: LysA; ECH7EC4076_3268; phage(gi30065714) 4e-68 Click
21complement(3837810..3838307) PHAGE_Yersin_413C: gpK; ECH7EC4076_3269; phage(gi30065713) 3e-94 Click
22complement(3838307..3838588) PHAGE_Yersin_413C: gpY; ECH7EC4076_3270; phage(gi30065712) 3e-46 Click
23complement(3838592..3838795) PHAGE_Yersin_413C: gpX; ECH7EC4076_3271; phage(gi30065711) 2e-32 Click
24complement(3838795..3839268) PHAGE_Yersin_413C: gpL; ECH7EC4076_3272; phage(gi30065710) 5e-85 Click
25complement(3839404..3840147) PHAGE_Yersin_413C: gpM; ECH7EC4076_3273; phage(gi30065709) 7e-135 Click
26complement(3840151..3841224) PHAGE_Yersin_413C: gpN; ECH7EC4076_3274; phage(gi30065708) 0.0 Click
27complement(3841283..3842137) PHAGE_Yersin_413C: gpO; ECH7EC4076_3275; phage(gi30065707) 3e-160 Click
283842311..3844083 PHAGE_Yersin_413C: gpP; ECH7EC4076_3276; phage(gi30065706) 0.0 Click
293844083..3845117 PHAGE_Yersin_413C: gpQ; ECH7EC4076_3277; phage(gi30065705) 0.0 Click
30complement(3845156..3845317) hypothetical protein; ECH7EC4076_3278 0.0 Click
31complement(3845435..3847402) PHAGE_Melano_entomopoxvirus: ORF MSV156 hypothetical protein; ECH7EC4076_3279; phage(gi9631364) 7e-09 Click

Region 9, total : 46 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13823195..3823222 attL    AATCTCCCTTACACGGGCTTATTTTTTA 0.0 Click
2complement(3823324..3823578) PHAGE_Yersin_413C: Ogr; ECH7EC4076_3247; phage(gi30065732) 2e-45 Click
3complement(3823624..3824787) PHAGE_Yersin_413C: gpD; ECH7EC4076_3248; phage(gi30065731) 0.0 Click
4complement(3824787..3825266) PHAGE_Yersin_413C: gpU; ECH7EC4076_3249; phage(gi30065730) 4e-85 Click
5complement(3825281..3827728) PHAGE_Yersin_413C: gpT; ECH7EC4076_3250; phage(gi30065729) 0.0 Click
6complement(3828205..3828723) PHAGE_Yersin_413C: FII; ECH7EC4076_3253; phage(gi30065726) 6e-93 Click
7complement(3828736..3829926) PHAGE_Yersin_413C: gpFI; ECH7EC4076_3254; phage(gi30065725) 0.0 Click
8complement(3829986..3830579) PHAGE_Entero_2: DNA-invertase; ECH7EC4076_3255; phage(gi169936026) 9e-88 Click
93830610..3831020 PHAGE_Erwini_ENT90: phage tail collar domain protein; ECH7EC4076_3256; phage(gi431810938) 1e-13 Click
103831041..3831484 PHAGE_Entero_mEp213: tail fiber assembly protein; ECH7EC4076_3258; phage(gi428782612) 2e-26 Click
11complement(3831456..3832058) PHAGE_Entero_HK106: tail fiber assembly protein; ECH7EC4076_3257; phage(gi428783304) 1e-95 Click
12complement(3832058..3833377) PHAGE_Salmon_RE_2010: tail fiber protein; ECH7EC4076_3259; phage(gi418489713) 2e-108 Click
13complement(3833374..3833985) PHAGE_Yersin_413C: gpI; ECH7EC4076_3260; phage(gi30065721) 3e-82 Click
14complement(3833978..3834886) PHAGE_Yersin_413C: gpJ; ECH7EC4076_3261; phage(gi30065720) 3e-166 Click
15complement(3834891..3835238) PHAGE_Yersin_413C: gpW; ECH7EC4076_3262; phage(gi30065719) 2e-59 Click
16complement(3835235..3835870) PHAGE_Yersin_413C: gpV; ECH7EC4076_3263; phage(gi30065718) 4e-117 Click
17complement(3835937..3836389) PHAGE_Yersin_413C: gpS; ECH7EC4076_3264; phage(gi30065717) 1e-77 Click
18complement(3836382..3836849) PHAGE_Yersin_413C: gpR; ECH7EC4076_3265; phage(gi30065716) 2e-83 Click
19complement(3836812..3836970) PHAGE_Erwini_ENT90: putative host lysis-related protein; ECH7EC4076_3266; phage(gi431810968) 2e-10 Click
20complement(3836957..3837382) PHAGE_Yersin_413C: LysB; ECH7EC4076_3267; phage(gi30065715) 1e-68 Click
21complement(3837370..3837795) PHAGE_Yersin_413C: LysA; ECH7EC4076_3268; phage(gi30065714) 4e-68 Click
22complement(3837810..3838307) PHAGE_Yersin_413C: gpK; ECH7EC4076_3269; phage(gi30065713) 3e-94 Click
23complement(3838307..3838588) PHAGE_Yersin_413C: gpY; ECH7EC4076_3270; phage(gi30065712) 3e-46 Click
24complement(3838592..3838795) PHAGE_Yersin_413C: gpX; ECH7EC4076_3271; phage(gi30065711) 2e-32 Click
25complement(3838795..3839268) PHAGE_Yersin_413C: gpL; ECH7EC4076_3272; phage(gi30065710) 5e-85 Click
26complement(3839404..3840147) PHAGE_Yersin_413C: gpM; ECH7EC4076_3273; phage(gi30065709) 7e-135 Click
27complement(3840151..3841224) PHAGE_Yersin_413C: gpN; ECH7EC4076_3274; phage(gi30065708) 0.0 Click
28complement(3841283..3842137) PHAGE_Yersin_413C: gpO; ECH7EC4076_3275; phage(gi30065707) 3e-160 Click
293842311..3844083 PHAGE_Yersin_413C: gpP; ECH7EC4076_3276; phage(gi30065706) 0.0 Click
303844083..3845117 PHAGE_Yersin_413C: gpQ; ECH7EC4076_3277; phage(gi30065705) 0.0 Click
31complement(3845156..3845317) hypothetical protein; ECH7EC4076_3278 0.0 Click
32complement(3845435..3847402) PHAGE_Melano_entomopoxvirus: ORF MSV156 hypothetical protein; ECH7EC4076_3279; phage(gi9631364) 7e-09 Click
33complement(3847402..3847854) hypothetical protein; ECH7EC4076_3280 0.0 Click
34complement(3847901..3849124) conserved hypothetical protein; ECH7EC4076_3281 0.0 Click
35complement(3849214..3851496) PHAGE_Yersin_413C: gpA; ECH7EC4076_3282; phage(gi30065742) 0.0 Click
36complement(3851486..3851761) PHAGE_Yersin_413C: hypothetical protein L-413Cp37; ECH7EC4076_3283; phage(gi30065741) 1e-46 Click
37complement(3851758..3851982) PHAGE_Yersin_413C: hypothetical protein L-413Cp36; ECH7EC4076_3284; phage(gi30065740) 9e-35 Click
38complement(3851985..3852284) PHAGE_Yersin_413C: hypothetical protein L-413Cp35; ECH7EC4076_3285; phage(gi30065739) 8e-49 Click
39complement(3852284..3852508) PHAGE_Yersin_413C: hypothetical protein L-413Cp34; ECH7EC4076_3286; phage(gi30065738) 1e-32 Click
40complement(3852572..3853072) PHAGE_Yersin_413C: gpB; ECH7EC4076_3287; phage(gi30065737) 8e-94 Click
41complement(3853069..3853239) PHAGE_Yersin_413C: hypothetical protein L-413Cp32; ECH7EC4076_3288; phage(gi30065736) 1e-26 Click
42complement(3853250..3853435) PHAGE_Yersin_413C: Cox; ECH7EC4076_3289; phage(gi30065735) 1e-12 Click
433854062..3855075 PHAGE_Yersin_413C: Int; ECH7EC4076_3290; phage(gi30065733) 1e-91 Click
443855155..3855182 attR    AATCTCCCTTACACGGGCTTATTTTTTA 0.0 Click
45complement(3855340..3855600) conserved hypothetical protein; ECH7EC4076_3291 0.0 Click
463856063..3856962 diacylglycerol kinase catalytic domain protein; ECH7EC4076_3292 0.0 Click
47complement(3857044..3857823) galactitol utilization operon repressor; ECH7EC4076_3293 0.0 Click
48complement(3857923..3858963) PHAGE_Synech_S_SM2: zinc-containing alcohol dehydrogenase superfamily protein; ECH7EC4076_3294; phage(gi326781942) 8e-11 Click

Region 10, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13882032..3882052 attL    CGGTGTAGTTAATGGTGTAGT 0.0 Click
23882079..3883308 PHAGE_Salmon_vB_SosS_Oslo: integrase; ECH7EC4076_3320; phage(gi399528791) 2e-59 Click
33883919..3884863 conserved hypothetical protein; ECH7EC4076_3321 0.0 Click
43884856..3885068 hypothetical protein; ECH7EC4076_3322 0.0 Click
53885515..3885748 conserved hypothetical protein; ECH7EC4076_3324 0.0 Click
63885754..3886053 conserved hypothetical protein; ECH7EC4076_3325 0.0 Click
73886050..3887450 PHAGE_Mycoba_PG1: gp59; ECH7EC4076_3326; phage(gi38638462) 8e-30 Click
83887651..3887902 hypothetical bacteriophage protein; ECH7EC4076_3327 0.0 Click
93887899..3888309 PHAGE_Lactoc_Q54: hypothetical protein Q54_gp12; ECH7EC4076_3328; phage(gi115304283) 3e-09 Click
103888549..3888677 hypothetical protein; ECH7EC4076_3329 0.0 Click
113889195..3889401 conserved hypothetical protein; ECH7EC4076_3331 0.0 Click
123889401..3890456 PHAGE_Entero_N15: gp8; ECH7EC4076_3332; phage(gi9630472) 6e-69 Click
133890469..3890804 PHAGE_Entero_N15: gp7; ECH7EC4076_3333; phage(gi9630471) 8e-07 Click
143890817..3891230 conserved hypothetical protein; ECH7EC4076_3334 0.0 Click
153891436..3891978 PHAGE_Entero_N15: gp1; ECH7EC4076_3336; phage(gi9630465) 4e-36 Click
16complement(3891958..3892182) conserved hypothetical protein; ECH7EC4076_3335 0.0 Click
173892234..3892515 hypothetical bacteriophage protein; ECH7EC4076_3337 0.0 Click
183893009..3893029 attR    CGGTGTAGTTAATGGTGTAGT 0.0 Click

Region 11, total : 47 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3898627..3899088) PHAGE_Vibrio_KVP40: NMN adenylyl tranferase; ECH7EC4076_3344; phage(gi34419395) 6e-05 Click
2complement(3899098..3899721) ribosomal large subunit pseudouridine synthase E; ECH7EC4076_3345 0.0 Click
33899923..3901173 isocitrate dehydrogenase, NADP-dependent; ECH7EC4076_3346 0.0 Click
43901155..3901166 attL    GATCATCAAGAA 0.0 Click
5complement(3901287..3902429) PHAGE_Entero_mEp235: integrase; ECH7EC4076_3347; phage(gi428781836) 5e-61 Click
63902759..3903583 PHAGE_Entero_lambda: DNA replication protein; ECH7EC4076_3348; phage(gi9626295) 2e-99 Click
73903580..3904281 PHAGE_Entero_lambda: DNA replication protein; ECH7EC4076_3349; phage(gi9626296) 4e-129 Click
83904278..3904580 PHAGE_Entero_lambda: ren exclusion protein; ECH7EC4076_3350; phage(gi9626297) 2e-43 Click
93904648..3904980 PHAGE_Acinet_Acj61: putative quaternary ammonium compound-resistance protein qacE; ECH7EC4076_3351; phage(gi311992758) 1e-10 Click
103907238..3907693 PHAGE_Cronob_phiES15: hypothetical protein; ECH7EC4076_3354; phage(gi401817579) 9e-59 Click
113907693..3907863 PHAGE_Escher_HK639: NinE; ECH7EC4076_3355; phage(gi356870663) 1e-14 Click
123907856..3908146 PHAGE_Entero_mEp237: hypothetical protein; ECH7EC4076_3356; phage(gi435439317) 3e-48 Click
133908143..3908505 PHAGE_Entero_mEp237: Holliday junction resolvase RusA; ECH7EC4076_3357; phage(gi435439318) 1e-61 Click
143908505..3908642 PHAGE_Entero_mEp237: hypothetical protein; ECH7EC4076_3358; phage(gi435439319) 1e-11 Click
153908639..3909328 PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECH7EC4076_3359; phage(gi169257244) 4e-84 Click
163909650..3909955 PHAGE_Salmon_ST160: Gp13; ECH7EC4076_3360; phage(gi318065943) 3e-39 Click
173909942..3910418 PHAGE_Escher_HK75: lysozyme; ECH7EC4076_3361; phage(gi356870730) 6e-85 Click
183910415..3910876 PHAGE_Entero_lambda: cell lysis protein; ECH7EC4076_3362; phage(gi9626310) 3e-80 Click
19complement(3910908..3911201) PHAGE_Entero_lambda: Bor protein precursor; ECH7EC4076_3363; phage(gi19263395) 6e-50 Click
20complement(3911493..3911903) PHAGE_Entero_lambda: putative envelope protein; ECH7EC4076_3364; phage(gi19263396) 2e-74 Click
213912189..3912395 PHAGE_Entero_lambda: hypothetical protein lambdap79; ECH7EC4076_3365; phage(gi19263397) 1e-32 Click
22complement(3912560..3912694) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECH7EC4076_3366; phage(gi209427772) 5e-09 Click
233913143..3913688 PHAGE_Entero_lambda: DNA packaging protein; ECH7EC4076_3367; phage(gi9626244) 3e-96 Click
243913663..3915588 PHAGE_Entero_lambda: DNA packaging protein; ECH7EC4076_3368; phage(gi9626245) 0.0 Click
253915585..3915791 PHAGE_Entero_lambda: head-tail joining protein; ECH7EC4076_3369; phage(gi9626246) 1e-31 Click
263915788..3917389 PHAGE_Entero_lambda: capsid component; ECH7EC4076_3370; phage(gi9626247) 0.0 Click
273917370..3918689 PHAGE_Entero_lambda: capsid component; ECH7EC4076_3371; phage(gi9626248) 0.0 Click
283918699..3919031 PHAGE_Entero_lambda: head-DNA stabilization protein; ECH7EC4076_3372; phage(gi9626250) 7e-58 Click
293919060..3920112 PHAGE_Entero_lambda: capsid component; ECH7EC4076_3373; phage(gi9626251) 0.0 Click
303920154..3920552 PHAGE_Entero_lambda: DNA packaging protein; ECH7EC4076_3374; phage(gi9626252) 3e-67 Click
313920564..3920917 PHAGE_Entero_lambda: head-tail joining protein; ECH7EC4076_3375; phage(gi9626253) 3e-62 Click
323920929..3921507 PHAGE_Entero_lambda: tail component; ECH7EC4076_3376; phage(gi9626254) 6e-101 Click
333921504..3921899 PHAGE_Entero_lambda: tail component; ECH7EC4076_3377; phage(gi9626255) 2e-72 Click
343921907..3922647 PHAGE_Entero_lambda: tail component; ECH7EC4076_3378; phage(gi9626256) 3e-133 Click
353922663..3923085 PHAGE_Entero_lambda: tail component; ECH7EC4076_3379; phage(gi9626257) 2e-73 Click
363923067..3923501 PHAGE_Entero_lambda: tail component; ECH7EC4076_3380; phage(gi9626258) 2e-81 Click
373923494..3926043 PHAGE_Entero_lambda: tail component; ECH7EC4076_3381; phage(gi9626259) 0.0 Click
383926040..3926369 PHAGE_Entero_lambda: tail component; ECH7EC4076_3382; phage(gi9626260) 1e-56 Click
393926369..3927067 PHAGE_Entero_lambda: tail component; ECH7EC4076_3383; phage(gi9626261) 5e-134 Click
403927073..3927816 PHAGE_Entero_mEp460: tail fiber component; ECH7EC4076_3384; phage(gi428782332) 2e-149 Click
413927813..3928385 PHAGE_Entero_lambda: tail component; ECH7EC4076_3385; phage(gi9626263) 1e-100 Click
423928446..3931844 PHAGE_Entero_lambda: tail:host specificity protein; ECH7EC4076_3386; phage(gi9626264) 0.0 Click
433931911..3932510 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; ECH7EC4076_3387; phage(gi148609401) 6e-112 Click
44complement(3932511..3932684) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; ECH7EC4076_3388; phage(gi157166059) 2e-29 Click
45complement(3933072..3933809) PHAGE_Entero_lambda: hypothetical protein lambdap90; ECH7EC4076_3389; phage(gi9626267) 1e-52 Click
463933845..3933979 hypothetical protein; ECH7EC4076_3390 0.0 Click
473933940..3935490 PHAGE_Entero_lambda: Tail fiber; ECH7EC4076_3391; phage(gi9626268) 2e-87 Click
483935490..3936071 PHAGE_Entero_lambda: Putative fiber assembly protein; ECH7EC4076_3392; phage(gi9626269) 4e-102 Click
493948269..3948280 attR    GATCATCAAGAA 0.0 Click

Region 12, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13991326..3991337 attL    TTATATGGTTTA 0.0 Click
2complement(3999380..4000222) PHAGE_Prochl_P_SSM7: PRGA-formyltransferase; ECH7EC4076_3462; phage(gi326784531) 1e-17 Click
3complement(4000272..4000751) PHAGE_Sphing_PAU: gp60; ECH7EC4076_3463; phage(gi435844563) 7e-05 Click
44000804..4001748 PHAGE_Acanth_1: hypothetical protein ATCV1_Z612R; ECH7EC4076_3464; phage(gi155371559) 1e-11 Click
54001840..4002853 PHAGE_Feldma_virus: putative sensor histidine kinase; ECH7EC4076_3465; phage(gi197322366) 1e-07 Click
64004327..4004770 PHAGE_Entero_mEp213: tail fiber assembly protein; ECH7EC4076_5726; phage(gi428782612) 2e-25 Click
7complement(4004742..4005335) PHAGE_Entero_HK97: Gp29; ECH7EC4076_5725; phage(gi9634180) 3e-64 Click
8complement(4005335..4005829) PHAGE_Entero_HK97: tail fiber; ECH7EC4076_5727; phage(gi9634179) 3e-23 Click
94005859..4006413 PHAGE_Entero_2: DNA-invertase; ECH7EC4076_5728; phage(gi169936026) 8e-89 Click
10complement(4006471..4007244) PHAGE_Pseudo_OBP: putative homing nuclease; ECH7EC4076_5729; phage(gi371671534) 2e-38 Click
114008067..4008810 putative AraC-type regulatory protein encoded in prophage CP-933H; ECH7EC4076_5730 0.0 Click
12complement(4008852..4009217) PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; ECH7EC4076_5731; phage(gi24111655) 2e-44 Click
13complement(4010335..4011225) PROPHAGE_Escher_Sakai: putative transposase; ECH7EC4076_5732; phage(gi15834498) 5e-172 Click
14complement(4011222..4011548) PHAGE_Stx2_c_II: putative transposase; ECH7EC4076_5733; phage(gi302393161) 1e-58 Click
154011605..4012267 PROPHAGE_Escher_CFT073: putative prophage integrase; ECH7EC4076_5734; phage(gi26250313) 3e-76 Click
164018313..4018324 attR    TTATATGGTTTA 0.0 Click

Region 13, total : 56 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14831215..4831235 attL    GTCGGATAAGGCGTTCACGCC 0.0 Click
24845010..4845831 PHAGE_Cronob_vB_CsaM_GAP32: putative Sir2-like protein; ECH7EC4076_4013; phage(gi414087036) 4e-19 Click
3complement(4845987..4847033) spermidine/putrescine ABC transporter, periplasmic spermidine/putrescine-binding protein; ECH7EC4076_4014 0.0 Click
4complement(4847030..4847824) spermidine/putrescine ABC transporter, permease protein PotC; ECH7EC4076_4015 0.0 Click
5complement(4847991..4849109) PHAGE_Entero_mEp235: integrase; ECH7EC4076_4016; phage(gi428781836) 3e-52 Click
6complement(4849078..4849347) putative excisionase; ECH7EC4076_4017 0.0 Click
7complement(4849409..4849753) PHAGE_Entero_mEp460: putative exonuclease; ECH7EC4076_4018; phage(gi428782342) 5e-34 Click
84849889..4850446 PHAGE_Entero_HK630: HkaP protein; ECH7EC4076_4019; phage(gi428782827) 2e-12 Click
9complement(4850561..4850791) PHAGE_Salico_CGphi29: hypothetical protein; ECH7EC4076_4020; phage(gi472340166) 1e-09 Click
10complement(4851029..4851505) Rac prophage repressor; ECH7EC4076_4021 0.0 Click
114851937..4852362 PHAGE_Pectob_ZF40: putative cII repressor; ECH7EC4076_4022; phage(gi422936652) 2e-05 Click
124852431..4853468 PHAGE_Escher_TL_2011b: hypothetical protein; ECH7EC4076_4023; phage(gi418487646) 4e-48 Click
134853461..4853922 PHAGE_Escher_HK639: replication protein 14; ECH7EC4076_4024; phage(gi356870655) 1e-31 Click
144853956..4854672 conserved hypothetical protein; ECH7EC4076_4025 0.0 Click
154854732..4854986 conserved hypothetical protein; ECH7EC4076_4026 0.0 Click
164854989..4855285 PHAGE_Klebsi_phiKO2: Gp58; ECH7EC4076_4027; phage(gi46402144) 5e-27 Click
174855275..4855592 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp27; ECH7EC4076_4028; phage(gi302393109) 7e-45 Click
184855741..4855863 PHAGE_Salmon_E1: hypothetical protein VIP0051; ECH7EC4076_4029; phage(gi170676326) 1e-05 Click
194855850..4856287 PHAGE_Entero_2008: hypothetical protein YYZ_gp09; ECH7EC4076_4030; phage(gi209427735) 1e-08 Click
204856289..4856480 PHAGE_Salmon_ST160: hypothetical protein; ECH7EC4076_4031; phage(gi318065908) 5e-27 Click
214856483..4857070 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4076_4032; phage(gi428782343) 7e-40 Click
224857141..4857290 conserved hypothetical protein; ECH7EC4076_4033 0.0 Click
234858139..4859188 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4076_4035; phage(gi428782365) 2e-109 Click
244859201..4859458 PHAGE_Escher_HK75: RusA-like protein; ECH7EC4076_4036; phage(gi356870726) 4e-21 Click
254859439..4860731 PHAGE_Stx1_converting: hypothetical protein Stx1_gp75; ECH7EC4076_4037; phage(gi302861197) 1e-179 Click
264860879..4861061 PHAGE_Escher_P13374: hypothetical protein; ECH7EC4076_4038; phage(gi410491643) 3e-18 Click
274861099..4861368 PHAGE_Escher_P13374: hypothetical protein; ECH7EC4076_4039; phage(gi410491644) 1e-26 Click
284861444..4861659 PHAGE_Stx2_c_1717: holin protein S-like protein; ECH7EC4076_4040; phage(gi209447171) 1e-34 Click
294861664..4862008 PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECH7EC4076_4041; phage(gi209427768) 1e-59 Click
304862059..4862592 PHAGE_Entero_2008: putative endolysin; ECH7EC4076_4042; phage(gi209427769) 4e-103 Click
314862863..4863432 PHAGE_Entero_2008: putative antirepressor; ECH7EC4076_4043; phage(gi209427770) 7e-107 Click
324863432..4863578 PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; ECH7EC4076_4044; phage(gi302861202) 2e-20 Click
334863586..4864053 PHAGE_Entero_2008: putative endopeptidase; ECH7EC4076_4045; phage(gi209427771) 5e-63 Click
344864077..4864301 conserved hypothetical protein; ECH7EC4076_4046 0.0 Click
354864449..4864571 hypothetical protein; ECH7EC4076_4047 0.0 Click
364864658..4864798 conserved hypothetical protein; ECH7EC4076_4048 0.0 Click
37complement(4864928..4865113) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECH7EC4076_4049; phage(gi209427772) 8e-19 Click
384865810..4866373 PHAGE_Entero_2008: putative phage terminase; ECH7EC4076_4050; phage(gi209427774) 1e-95 Click
394866370..4868031 PHAGE_Entero_2008: putative phage terminase-like protein large subunit; ECH7EC4076_4051; phage(gi209427775) 0.0 Click
404868095..4870032 PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECH7EC4076_4052; phage(gi209427776) 0.0 Click
414870244..4872745 PHAGE_Entero_2008: putative portal protein; ECH7EC4076_4053; phage(gi209427777) 0.0 Click
424872825..4873151 PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ECH7EC4076_4055; phage(gi209427778) 1e-54 Click
434873161..4873511 PHAGE_Entero_2008: putative head-tail adaptor; ECH7EC4076_4056; phage(gi209427779) 9e-61 Click
444873508..4873954 PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ECH7EC4076_4057; phage(gi209427780) 2e-80 Click
454873951..4874295 PHAGE_Entero_2008: putative prophage structural protein; ECH7EC4076_4058; phage(gi209427781) 6e-60 Click
464875092..4875466 PHAGE_Entero_2008: putative tail assembly protein; ECH7EC4076_4060; phage(gi209427783) 4e-67 Click
474875568..4875771 PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECH7EC4076_4061; phage(gi209427784) 3e-32 Click
484875824..4879066 PHAGE_Entero_2008: putative tail protein; ECH7EC4076_4062; phage(gi209427785) 0.0 Click
494879059..4879400 PHAGE_Entero_2008: putative minor tail protein; ECH7EC4076_4063; phage(gi209427786) 3e-63 Click
504879400..4880098 PHAGE_Entero_2008: putative tail protein; ECH7EC4076_4064; phage(gi209427787) 1e-131 Click
51complement(4880115..4880255) putative regulatory protein; ECH7EC4076_4065 0.0 Click
524880892..4881770 PHAGE_Salmon_vB_SemP_Emek: antirepressor; ECH7EC4076_4066; phage(gi399498814) 2e-94 Click
534881824..4882561 PHAGE_Entero_2008: putative tail component K-like protein; ECH7EC4076_4067; phage(gi209427789) 3e-151 Click
544882558..4882743 PHAGE_Entero_2008: putative tail assembly protein; ECH7EC4076_4068; phage(gi209427790) 4e-11 Click
554882865..4885213 PHAGE_Staphy_SA11: putative pentapeptide repeat protein; ECH7EC4076_4069; phage(gi422935631) 2e-05 Click
564886433..4887275 PHAGE_Aeromo_vB_AsaM_56: putative methylase; ECH7EC4076_5027; phage(gi422937523) 7e-12 Click
57complement(4887424..4887513) tRNA 0.0 Click
584887746..4888684 PHAGE_Acanth_1: hypothetical protein ATCV1_Z295L; ECH7EC4076_5029; phage(gi155371242) 8e-06 Click
594903346..4903366 attR    GTCGGATAAGGCGTTCACGCC 0.0 Click

Region 14, total : 51 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14934444..4934455 attL    TAACTGCCTGAA 0.0 Click
2complement(4944710..4945288) PHAGE_Entero_4795: putative tail component; ECH7EC4076_1218; phage(gi157166056) 5e-100 Click
3complement(4945285..4945920) PHAGE_Entero_4795: putative tail fiber component; ECH7EC4076_1219; phage(gi157166055) 8e-125 Click
4complement(4946039..4946737) PHAGE_Entero_4795: putative tail fiber component; ECH7EC4076_1220; phage(gi157166054) 2e-129 Click
5complement(4946737..4947066) PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4076_1221; phage(gi15832202) 3e-60 Click
6complement(4947063..4949708) PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; ECH7EC4076_1222; phage(gi15832203) 0.0 Click
7complement(4949752..4950060) PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4076_1223; phage(gi15832204) 2e-56 Click
8complement(4950087..4950509) PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4076_1224; phage(gi15832205) 3e-75 Click
9complement(4950523..4951275) PHAGE_Entero_HK630: major tail protein V; ECH7EC4076_1225; phage(gi428782800) 1e-112 Click
10complement(4951283..4951681) PROPHAGE_Escher_Sakai: putative minor tail protein U; ECH7EC4076_1226; phage(gi15832207) 1e-72 Click
11complement(4951694..4952317) PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4076_1227; phage(gi15832208) 6e-112 Click
12complement(4952320..4952568) PHAGE_Entero_mEp213: hypothetical protein; ECH7EC4076_1228; phage(gi428782596) 6e-20 Click
13complement(4952594..4952920) PHAGE_Entero_mEp213: hypothetical protein; ECH7EC4076_1229; phage(gi428782595) 1e-32 Click
14complement(4953008..4954963) PHAGE_Entero_mEp213: head maturation protease; ECH7EC4076_1230; phage(gi428782594) 0.0 Click
15complement(4954977..4956479) PROPHAGE_Escher_Sakai: putative portal protein; ECH7EC4076_1231; phage(gi15832215) 0.0 Click
16complement(4956479..4956691) PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4076_1232; phage(gi428782319) 9e-24 Click
17complement(4956688..4958811) PROPHAGE_Escher_Sakai: putative terminase large subunit; ECH7EC4076_1233; phage(gi15832217) 0.0 Click
18complement(4958808..4959284) PHAGE_Salmon_1: bacteriophage terminase, small subunit; ECH7EC4076_1234; phage(gi169257184) 3e-47 Click
19complement(4959739..4960206) PHAGE_Entero_4795: putative endopeptidase Rz; ECH7EC4076_1236; phage(gi157166036) 2e-82 Click
20complement(4960214..4960360) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF50; ECH7EC4076_1237; phage(gi157166035) 2e-20 Click
21complement(4960360..4960929) PHAGE_Stx2_c_II: putative antirepressor protein Ant; ECH7EC4076_1238; phage(gi302393166) 7e-107 Click
22complement(4961200..4961733) PHAGE_Stx2_c_II: endolysin; ECH7EC4076_1239; phage(gi302393165) 1e-103 Click
23complement(4961738..4961953) PHAGE_Stx2_c_II: holin; ECH7EC4076_1240; phage(gi302393164) 2e-35 Click
24complement(4962634..4964580) PHAGE_Entero_4795: hypothetical protein YjhS; ECH7EC4076_1242; phage(gi157166028) 0.0 Click
25complement(4965092..4965168) tRNA 0.0 Click
26complement(4965181..4965259) tRNA 0.0 Click
27complement(4965268..4965343) tRNA 0.0 Click
28complement(4965788..4966222) PHAGE_Stx2_c_I: Q protein; ECH7EC4076_1248; phage(gi20065938) 3e-80 Click
29complement(4966308..4966445) PHAGE_Entero_mEp237: hypothetical protein; ECH7EC4076_1249; phage(gi435439319) 4e-10 Click
30complement(4966445..4966807) PHAGE_Entero_mEp237: Holliday junction resolvase RusA; ECH7EC4076_1250; phage(gi435439318) 5e-62 Click
31complement(4966804..4967094) PHAGE_Entero_mEp237: hypothetical protein; ECH7EC4076_1251; phage(gi435439317) 5e-49 Click
32complement(4967257..4967712) PHAGE_Cronob_phiES15: hypothetical protein; ECH7EC4076_1252; phage(gi401817579) 9e-62 Click
33complement(4967927..4968724) transcriptional regulator, AraC family; ECH7EC4076_1253 0.0 Click
34complement(4968734..4969285) putative phosphatidylethanolamine-binding protein; ECH7EC4076_1254 0.0 Click
35complement(4969750..4971276) PHAGE_Bacill_WBeta: putative site-specific recombinase; ECH7EC4076_1255; phage(gi85701406) 5e-09 Click
36complement(4971533..4971865) PHAGE_Acinet_Acj61: putative quaternary ammonium compound-resistance protein qacE; ECH7EC4076_1256; phage(gi311992758) 9e-11 Click
37complement(4971933..4972235) PHAGE_Entero_4795: putative Ren protein; ECH7EC4076_1257; phage(gi157166013) 6e-44 Click
38complement(4972232..4972669) PHAGE_Entero_4795: putative replication protein P; ECH7EC4076_1258; phage(gi157166012) 5e-80 Click
394972724..4973050 PHAGE_Entero_4795: putative transposase OrfA protein of IS629; ECH7EC4076_1259; phage(gi157166062) 1e-58 Click
404973047..4973937 PROPHAGE_Escher_Sakai: putative transposase; ECH7EC4076_1260; phage(gi15834498) 2e-173 Click
414974106..4974117 attR    TAACTGCCTGAA 0.0 Click
42complement(4974243..4975262) PHAGE_Entero_4795: putative replication protein O; ECH7EC4076_1262; phage(gi157166011) 3e-114 Click
43complement(4975259..4975798) PHAGE_Entero_mEp237: CII protein; ECH7EC4076_1263; phage(gi435439306) 1e-63 Click
44complement(4975868..4976098) PHAGE_Escher_HK639: cro; ECH7EC4076_1264; phage(gi356870651) 3e-20 Click
454976203..4976892 PHAGE_Entero_ST104: CI; ECH7EC4076_1265; phage(gi46358671) 7e-94 Click
464976973..4978034 PHAGE_Lactob_Lj965: hypothetical protein Ljo_0304; ECH7EC4076_1266; phage(gi41179236) 4e-66 Click
474978804..4978815 attL    CCACCGCCTGAA 0.0 Click
484978870..4979076 PHAGE_Entero_HK225: Kil protein; ECH7EC4076_1267; phage(gi428782413) 6e-30 Click
494979152..4979448 PHAGE_Entero_4795: putative host-nuclease inhibitor protein Gam; ECH7EC4076_1268; phage(gi157165999) 9e-53 Click
504979454..4980239 PHAGE_Stx2_c_I: Bet protein; ECH7EC4076_1269; phage(gi20065900) 2e-151 Click
514980236..4980913 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip102; ECH7EC4076_1270; phage(gi20065897) 4e-132 Click
524981146..4981259 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip099; ECH7EC4076_1271; phage(gi20065894) 4e-14 Click
534981336..4981551 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; ECH7EC4076_1272; phage(gi20065893) 5e-35 Click
544981868..4982815 PHAGE_Entero_2008: hypothetical protein YYZ_gp09; ECH7EC4076_1273; phage(gi209427735) 0.0 Click
554984229..4984372 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF4; ECH7EC4076_1277; phage(gi157165989) 8e-15 Click
564984643..4984783 PHAGE_Entero_4795: putative excisionase; ECH7EC4076_1278; phage(gi157165987) 8e-23 Click
574984817..4986103 PHAGE_Entero_4795: putative integrase; ECH7EC4076_1279; phage(gi157165986) 0.0 Click
585000879..5000890 attR    CCACCGCCTGAA 0.0 Click

Region 15, total : 38 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15002215..5003264 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp51; ECH7EC4076_3524; phage(gi148609433) 4e-101 Click
25003277..5003651 PHAGE_Escher_HK75: RusA-like protein; ECH7EC4076_3525; phage(gi356870726) 3e-35 Click
35003648..5004469 PHAGE_Entero_HK225: late gene regulator Q; ECH7EC4076_3526; phage(gi428782441) 2e-93 Click
45004696..5004893 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp55; ECH7EC4076_3527; phage(gi148609437) 8e-09 Click
55005044..5006102 PHAGE_Entero_cdtI: putative DNA methylase; ECH7EC4076_3528; phage(gi148609438) 4e-175 Click
65006144..5006218 tRNA 0.0 Click
7complement(5006310..5006456) conserved hypothetical protein; ECH7EC4076_3530 0.0 Click
85006697..5008643 PHAGE_Stx1_converting: hypothetical protein Stx1_gp75; ECH7EC4076_3531; phage(gi302861197) 0.0 Click
95008640..5008765 PHAGE_Escher_TL_2011c: hypothetical protein; ECH7EC4076_3532; phage(gi418487096) 7e-19 Click
105008778..5008957 PHAGE_Escher_P13374: hypothetical protein; ECH7EC4076_3533; phage(gi410491643) 2e-28 Click
115008998..5009243 PHAGE_Escher_P13374: hypothetical protein; ECH7EC4076_3534; phage(gi410491644) 6e-39 Click
125009321..5009536 PHAGE_Escher_P13374: lysis protein, holin; ECH7EC4076_3535; phage(gi410491645) 2e-35 Click
135009540..5010097 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp05; ECH7EC4076_3536; phage(gi116221997) 1e-49 Click
145010134..5010667 PHAGE_Escher_TL_2011c: lysozyme; ECH7EC4076_3537; phage(gi418487070) 3e-101 Click
155010966..5011433 PHAGE_Entero_4795: putative endopeptidase Rz; ECH7EC4076_3538; phage(gi157166036) 3e-78 Click
165011846..5012322 PHAGE_Entero_mEp460: terminase small subunit; ECH7EC4076_3539; phage(gi428782317) 2e-46 Click
175012319..5014442 PHAGE_Entero_cdtI: putative large terminase subunit; ECH7EC4076_3540; phage(gi148609384) 0.0 Click
185014439..5014651 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp03; ECH7EC4076_3541; phage(gi148609385) 2e-24 Click
195014651..5016153 PHAGE_Entero_cdtI: putative portal protein; ECH7EC4076_3542; phage(gi148609386) 0.0 Click
205016167..5018122 PHAGE_Entero_cdtI: putative protease/scaffold protein; ECH7EC4076_3543; phage(gi148609387) 0.0 Click
215018210..5018536 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp06; ECH7EC4076_3544; phage(gi148609388) 2e-22 Click
225018562..5018810 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp07; ECH7EC4076_3545; phage(gi148609389) 7e-13 Click
235018813..5019436 PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4076_3546; phage(gi15832208) 3e-111 Click
245019449..5019847 PROPHAGE_Escher_Sakai: putative minor tail protein U; ECH7EC4076_3547; phage(gi15832207) 1e-72 Click
255019855..5020607 PHAGE_Entero_HK630: major tail protein V; ECH7EC4076_3548; phage(gi428782800) 1e-112 Click
265020621..5021043 PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4076_3549; phage(gi15832205) 1e-74 Click
275021094..5021417 PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4076_3550; phage(gi15832204) 8e-51 Click
285021423..5024068 PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; ECH7EC4076_3551; phage(gi15832203) 0.0 Click
295024065..5024394 PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4076_3552; phage(gi15832202) 3e-60 Click
305024394..5025092 PHAGE_Entero_4795: putative tail fiber component; ECH7EC4076_3553; phage(gi157166054) 8e-132 Click
315025211..5025846 PHAGE_Entero_cdtI: putative tail protein; ECH7EC4076_3554; phage(gi148609398) 1e-112 Click
325025843..5026421 PHAGE_Stx2_c_1717: putative tail component; ECH7EC4076_3555; phage(gi209447195) 2e-102 Click
335026467..5026586 hypothetical protein; ECH7EC4076_3556 0.0 Click
345026662..5030138 PHAGE_Entero_cdtI: putative tail tip assembly protein; ECH7EC4076_3557; phage(gi148609400) 0.0 Click
355030206..5030805 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; ECH7EC4076_3558; phage(gi148609401) 2e-108 Click
365030870..5032183 PHAGE_Entero_cdtI: putative tail fiber protein; ECH7EC4076_3559; phage(gi148609402) 0.0 Click
375032185..5032454 PHAGE_Stx2_c_II: putative tail fiber protein; ECH7EC4076_3560; phage(gi302393091) 9e-43 Click
385033016..5033411 PROPHAGE_Escher_MG1655: IS1 transposase B; ECH7EC4076_3562; phage(gi16131317) 1e-66 Click
395033587..5034177 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp23; ECH7EC4076_3563; phage(gi148609405) 4e-09 Click

Region 16, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(5346545..5346748) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp66; ECH7EC4076_0959; phage(gi209447189) 3e-19 Click
2complement(5346850..5347224) PHAGE_Stx2_c_1717: putative tail assembly chaperone; ECH7EC4076_0960; phage(gi209447188) 6e-67 Click
3complement(5347230..5347946) PHAGE_Stx2_c_1717: putative major tail subunit; ECH7EC4076_0961; phage(gi209447187) 2e-134 Click
4complement(5348005..5348349) PHAGE_Cronob_ENT39118: putative minor tail protein; ECH7EC4076_0962; phage(gi431811079) 5e-34 Click
5complement(5348346..5348792) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp63; ECH7EC4076_0963; phage(gi209447186) 6e-79 Click
6complement(5348789..5349139) PHAGE_Stx2_c_1717: bacteriophage head-tail adaptor; ECH7EC4076_0964; phage(gi209447185) 9e-61 Click
7complement(5349149..5349475) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp61; ECH7EC4076_0965; phage(gi209447184) 8e-54 Click
8complement(5352001..5352162) PHAGE_Entero_2008: hypothetical protein YYZ_gp53; ECH7EC4076_0967; phage(gi209427801) 2e-25 Click
9complement(5352267..5354204) PHAGE_Stx2_c_1717: phage head maturation protease; ECH7EC4076_0968; phage(gi209447181) 0.0 Click
10complement(5354268..5355929) PHAGE_Entero_4795: putative large subunit terminase; ECH7EC4076_0969; phage(gi157166040) 0.0 Click
11complement(5355926..5356489) PHAGE_Stx2_c_1717: phage terminase, small subunit; ECH7EC4076_0970; phage(gi209447178) 3e-100 Click
12complement(5356781..5357146) PHAGE_Stx2_c_1717: restriction endonuclease; ECH7EC4076_0971; phage(gi209447177) 1e-64 Click
135357248..5357415 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECH7EC4076_0972; phage(gi209427772) 7e-26 Click
14complement(5357878..5358060) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp50; ECH7EC4076_0973; phage(gi209447175) 2e-28 Click
15complement(5358132..5358629) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp49; ECH7EC4076_0974; phage(gi209447174) 5e-96 Click
16complement(5358832..5359269) PHAGE_Stx2_c_1717: putative Rz lysis protein; ECH7EC4076_0975; phage(gi209447173) 3e-77 Click
17complement(5359266..5359763) PHAGE_Stx2_c_1717: phage-related lysozyme; ECH7EC4076_0976; phage(gi209447172) 1e-94 Click
18complement(5359763..5359978) PHAGE_Stx2_c_1717: holin protein S-like protein; ECH7EC4076_0977; phage(gi209447171) 3e-35 Click
19complement(5360055..5360327) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp45; ECH7EC4076_0978; phage(gi209447170) 1e-43 Click
20complement(5360368..5360547) PHAGE_Escher_P13374: hypothetical protein; ECH7EC4076_0979; phage(gi410491643) 2e-28 Click
21complement(5360684..5362621) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp44; ECH7EC4076_0980; phage(gi209447169) 0.0 Click
22complement(5363084..5363197) hypothetical protein; ECH7EC4076_0981 0.0 Click
23complement(5363485..5363754) PHAGE_Stx2_c_1717: verocytotoxin 2 variant 2c subunit B; ECH7EC4076_0982; phage(gi209447167) 2e-46 Click
24complement(5363766..5364548) PHAGE_Stx2_c_1717: verocytotoxin 2 variant 2c subunit A; ECH7EC4076_0983; phage(gi209447166) 5e-146 Click
25complement(5364817..5364895) tRNA 0.0 Click
26complement(5364907..5364985) tRNA 0.0 Click
27complement(5364986..5365061) tRNA 0.0 Click
28complement(5365375..5365863) PHAGE_Stx2_c_1717: antiterminator Q protein; ECH7EC4076_0987; phage(gi209447165) 5e-91 Click

Region 17, total : 58 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15428274..5428438 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECH7EC4076_1683; phage(gi209427772) 1e-08 Click
25428837..5428950 conserved hypothetical protein; ECH7EC4076_1684 0.0 Click
3complement(5429076..5429216) conserved hypothetical protein; ECH7EC4076_1685 0.0 Click
4complement(5429299..5429766) PHAGE_Entero_2008: putative endopeptidase; ECH7EC4076_1686; phage(gi209427771) 7e-67 Click
5complement(5429918..5430064) conserved hypothetical protein; ECH7EC4076_1687 0.0 Click
6complement(5430256..5430789) PHAGE_Entero_2008: putative endolysin; ECH7EC4076_1688; phage(gi209427769) 2e-99 Click
7complement(5430840..5431184) PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECH7EC4076_1689; phage(gi209427768) 6e-60 Click
8complement(5431189..5431395) PHAGE_Entero_2008: lysis protein; ECH7EC4076_1690; phage(gi209427767) 1e-32 Click
95431715..5432041 PHAGE_Stx2_c_II: putative transposase; ECH7EC4076_1691; phage(gi302393161) 1e-58 Click
105432038..5432928 PROPHAGE_Escher_Sakai: putative transposase; ECH7EC4076_1692; phage(gi15834498) 2e-173 Click
11complement(5433008..5433544) PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECH7EC4076_1693; phage(gi209427766) 3e-99 Click
12complement(5435174..5435341) PHAGE_Entero_P1: TciB; ECH7EC4076_1696; phage(gi46401695) 3e-08 Click
13complement(5435939..5436017) tRNA 0.0 Click
14complement(5436029..5436107) tRNA 0.0 Click
15complement(5436114..5436189) tRNA 0.0 Click
16complement(5436247..5436369) hypothetical protein; ECH7EC4076_1701 0.0 Click
17complement(5436400..5437089) PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECH7EC4076_1702; phage(gi169257244) 9e-80 Click
18complement(5437086..5437445) PHAGE_Escher_HK75: RusA-like protein; ECH7EC4076_1703; phage(gi356870726) 1e-37 Click
19complement(5437458..5438507) PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4076_1704; phage(gi428782365) 4e-111 Click
205438728..5438913 hypothetical bacteriophage protein; ECH7EC4076_1705 0.0 Click
21complement(5439354..5439503) conserved hypothetical protein; ECH7EC4076_1706 0.0 Click
22complement(5439568..5440131) PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4076_1707; phage(gi428782343) 5e-41 Click
23complement(5440258..5440569) PHAGE_Entero_mEp213: hypothetical protein; ECH7EC4076_1708; phage(gi428782634) 2e-24 Click
24complement(5440751..5441107) PHAGE_Entero_HK629: hypothetical protein; ECH7EC4076_1709; phage(gi428782046) 9e-16 Click
25complement(5441350..5442048) conserved hypothetical protein; ECH7EC4076_1710 0.0 Click
26complement(5442083..5442544) PHAGE_Escher_HK639: replication protein 14; ECH7EC4076_1711; phage(gi356870655) 6e-31 Click
27complement(5442537..5443574) PHAGE_Escher_TL_2011b: hypothetical protein; ECH7EC4076_1712; phage(gi418487646) 1e-46 Click
28complement(5443643..5444068) PHAGE_Pectob_ZF40: putative cII repressor; ECH7EC4076_1713; phage(gi422936652) 4e-06 Click
295444375..5445034 PHAGE_Entero_mEp390: prophage repressor; ECH7EC4076_1714; phage(gi428782701) 2e-25 Click
305445309..5445461 PHAGE_Salico_CGphi29: hypothetical protein; ECH7EC4076_1715; phage(gi472340166) 1e-08 Click
315447186..5447261 tRNA 0.0 Click
325447341..5447419 tRNA 0.0 Click
335449127..5449471 PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECH7EC4076_3501; phage(gi209427768) 9e-61 Click
345449522..5450055 PHAGE_Entero_2008: putative endolysin; ECH7EC4076_3502; phage(gi209427769) 3e-104 Click
355450326..5450895 PHAGE_Entero_2008: putative antirepressor; ECH7EC4076_3503; phage(gi209427770) 7e-107 Click
365450895..5451041 PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; ECH7EC4076_3504; phage(gi302861202) 2e-20 Click
375451049..5451516 PHAGE_Entero_2008: putative endopeptidase; ECH7EC4076_3505; phage(gi209427771) 2e-75 Click
385451599..5451739 conserved hypothetical protein; ECH7EC4076_3506 0.0 Click
395451765..5451932 hypothetical protein; ECH7EC4076_3507 0.0 Click
40complement(5452376..5452540) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECH7EC4076_3508; phage(gi209427772) 5e-08 Click
415452987..5453532 PHAGE_Entero_HK630: terminase small subunit nu1; ECH7EC4076_3510; phage(gi428782788) 2e-82 Click
425453507..5455432 PHAGE_Entero_HK630: terminase large subunit A; ECH7EC4076_3511; phage(gi428782789) 0.0 Click
435455429..5455635 PHAGE_Entero_HK630: head-tail connector W; ECH7EC4076_3512; phage(gi428782790) 1e-31 Click
445455632..5457233 PHAGE_Entero_HK630: portal protein B; ECH7EC4076_3513; phage(gi428782791) 0.0 Click
455457214..5458533 PHAGE_Entero_HK630: head maturation protease C; ECH7EC4076_3514; phage(gi428782792) 0.0 Click
465458543..5458875 PHAGE_Entero_HK630: head decoration protein D; ECH7EC4076_3515; phage(gi428782794) 7e-58 Click
475458904..5459956 PHAGE_Entero_HK630: major head subunit E; ECH7EC4076_3516; phage(gi428782795) 0.0 Click
485459998..5460396 PHAGE_Entero_HK225: head assembly protein Fi; ECH7EC4076_3517; phage(gi428782384) 7e-21 Click
495460408..5460761 PHAGE_Entero_HK630: head-tail connector Fii; ECH7EC4076_3518; phage(gi428782797) 2e-58 Click
505460776..5461309 PHAGE_Entero_HK630: minor tail protein Z; ECH7EC4076_3519; phage(gi428782798) 2e-65 Click
515461306..5461701 PHAGE_Entero_HK630: minor tail protein U; ECH7EC4076_3520; phage(gi428782799) 6e-59 Click
52complement(5464266..5464409) hypothetical protein; ECH7EC4076_2492 0.0 Click
53complement(5464387..5464824) PHAGE_Entero_2008: putative tail protein; ECH7EC4076_2493; phage(gi209427787) 3e-62 Click
54complement(5464824..5465165) PHAGE_Entero_2008: putative minor tail protein; ECH7EC4076_2494; phage(gi209427786) 4e-64 Click
55complement(5465158..5468400) PHAGE_Entero_2008: putative tail protein; ECH7EC4076_2495; phage(gi209427785) 0.0 Click
56complement(5468448..5468651) PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECH7EC4076_2496; phage(gi209427784) 6e-33 Click
57complement(5468753..5469127) PHAGE_Entero_2008: putative tail assembly protein; ECH7EC4076_2497; phage(gi209427783) 4e-67 Click
58complement(5469924..5470268) PHAGE_Entero_2008: putative prophage structural protein; ECH7EC4076_2499; phage(gi209427781) 6e-60 Click
59complement(5470265..5470711) PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ECH7EC4076_2500; phage(gi209427780) 2e-80 Click
60complement(5470708..5471058) PHAGE_Entero_2008: putative head-tail adaptor; ECH7EC4076_2501; phage(gi209427779) 8e-62 Click
61complement(5471068..5471394) PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ECH7EC4076_2502; phage(gi209427778) 3e-55 Click
62complement(5471397..5473976) PHAGE_Entero_2008: putative portal protein; ECH7EC4076_2503; phage(gi209427777) 0.0 Click
63complement(5474188..5476125) PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECH7EC4076_2504; phage(gi209427776) 0.0 Click

Region 18, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15543947..5543959 attL    GGTGGTGGTGGCA 0.0 Click
2complement(5557556..5557954) PHAGE_Entero_HK629: DNA packaging protein Fi; ECH7EC4076_6048; phage(gi428782020) 3e-67 Click
3complement(5557996..5559048) PHAGE_Entero_HK629: major head subunit; ECH7EC4076_6049; phage(gi428782019) 0.0 Click
4complement(5559077..5559409) PHAGE_Entero_HK629: head decoration protein; ECH7EC4076_6050; phage(gi428782018) 7e-58 Click
5complement(5559419..5560738) PHAGE_Entero_HK629: head maturation protease; ECH7EC4076_6051; phage(gi428782016) 0.0 Click
6complement(5560719..5562320) PHAGE_Entero_HK629: portal protein; ECH7EC4076_6052; phage(gi428782015) 0.0 Click
7complement(5562317..5562523) PHAGE_Entero_HK629: head-tail connector; ECH7EC4076_6053; phage(gi428782014) 1e-31 Click
8complement(5563430..5563548) conserved hypothetical protein; ECH7EC4076_0996 0.0 Click
9complement(5563554..5564600) PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4076_0997; phage(gi428782365) 2e-109 Click
105564802..5564933 hypothetical protein; ECH7EC4076_0998 0.0 Click
11complement(5564950..5565207) conserved hypothetical protein; ECH7EC4076_0999 0.0 Click
12complement(5565919..5566665) porcine attaching-effacing associated protein; ECH7EC4076_1000 0.0 Click
13complement(5567376..5567501) conserved hypothetical protein; ECH7EC4076_1001 0.0 Click
145569585..5569863 PHAGE_Entero_2008: hypothetical protein YYZ_gp30; ECH7EC4076_4397; phage(gi209427755) 2e-51 Click
155570096..5570458 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp32; ECH7EC4076_4398; phage(gi209447157) 2e-67 Click
165570313..5570861 PHAGE_Stx2_c_1717: NinB protein; ECH7EC4076_4399; phage(gi209447158) 4e-105 Click
175570858..5571385 PHAGE_Stx2_c_1717: putative DNA N-6-adenine-methyltransferase of bacteriophage; ECH7EC4076_4400; phage(gi209447159) 1e-101 Click
185571839..5572597 PHAGE_Escher_TL_2011c: hypothetical protein; ECH7EC4076_4401; phage(gi418487090) 2e-87 Click
195572853..5573533 PHAGE_Entero_Min27: hypothetical protein; ECH7EC4076_4402; phage(gi170783645) 2e-103 Click
205575125..5576255 PHAGE_Entero_HK629: integrase; ECH7EC4076_2262; phage(gi428782041) 5e-50 Click
215590681..5590693 attR    GGTGGTGGTGGCA 0.0 Click