Escherichia coli O157:H7 str. EC4113 , whole [asmbl_id: NC_000000].5655847, GC%: 50.60%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 35 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11074559..1074570 attL    CGCTTTTCCTTG 0.0 Click
2complement(1074914..1075915) PHAGE_Salmon_RE_2010: integrase; ECH7EC4113_3165; phage(gi418489683) 5e-100 Click
3complement(1075921..1076268) conserved hypothetical protein; ECH7EC4113_3166 0.0 Click
4complement(1076298..1076948) conserved hypothetical protein; ECH7EC4113_3167 0.0 Click
5complement(1076964..1077368) PHAGE_Burkho_BcepMu: gp17; ECH7EC4113_3168; phage(gi48696927) 4e-25 Click
61077667..1077870 PHAGE_Vibrio_kappa: putative regulator; ECH7EC4113_3169; phage(gi165970239) 6e-10 Click
71077892..1078242 conserved hypothetical protein; ECH7EC4113_3170 0.0 Click
81078253..1078531 conserved hypothetical protein; ECH7EC4113_3171 0.0 Click
91078543..1078785 conserved hypothetical protein; ECH7EC4113_3172 0.0 Click
101078782..1078895 hypothetical protein; ECH7EC4113_3173 0.0 Click
111078988..1079404 conserved hypothetical protein; ECH7EC4113_3174 0.0 Click
121079428..1079631 conserved hypothetical protein; ECH7EC4113_3175 0.0 Click
131079628..1079894 conserved hypothetical protein; ECH7EC4113_3176 0.0 Click
141079891..1080190 PHAGE_Entero_mEp213: hypothetical protein; ECH7EC4113_3177; phage(gi428782624) 9e-08 Click
151080513..1080743 conserved domain protein; ECH7EC4113_3178 0.0 Click
161080816..1081181 conserved hypothetical protein; ECH7EC4113_3179 0.0 Click
171081188..1084010 PHAGE_Salmon_RE_2010: replication protein; ECH7EC4113_3180; phage(gi418489692) 2e-170 Click
181084087..1085046 plasmid segregation protein ParM; ECH7EC4113_3181 0.0 Click
19complement(1085385..1086074) PROPHAGE_Escher_EDL933: transposase for IS629; ECH7EC4113_3182; phage(gi15801145) 3e-129 Click
20complement(1086074..1086400) PHAGE_Entero_4795: putative transposase OrfA protein of IS629; ECH7EC4113_3183; phage(gi157166066) 9e-58 Click
211086571..1086987 PHAGE_Salmon_RE_2010: tail fiber assembly protein; ECH7EC4113_3184; phage(gi418489714) 2e-41 Click
22complement(1087031..1087507) putative serine acetlyltransferase of prophage CP-933T; ECH7EC4113_3185 0.0 Click
23complement(1087760..1088248) PHAGE_Salmon_RE_2010: tail protein; ECH7EC4113_3186; phage(gi418489725) 2e-38 Click
24complement(1091051..1091206) PHAGE_Entero_P2: gpE+E'; ECH7EC4113_3189; phage(gi9630352) 7e-08 Click
25complement(1091215..1091580) PROPHAGE_Salmon_Ty2: putative phage tail protein; ECH7EC4113_3190; phage(gi29143760) 2e-06 Click
26complement(1091635..1092147) PHAGE_Salmon_RE_2010: major tail tube protein; ECH7EC4113_3191; phage(gi418489721) 8e-36 Click
27complement(1092147..1093331) PHAGE_Erwini_ENT90: tail sheath protein; ECH7EC4113_3192; phage(gi431810939) 7e-101 Click
281093311..1093442 hypothetical protein; ECH7EC4113_3193 0.0 Click
291093489..1093812 PHAGE_Salmon_RE_2010: gene D protein; ECH7EC4113_3195; phage(gi418489726) 4e-18 Click
30complement(1093763..1094827) PROPHAGE_Escher_MG1655: IS30 transposase; ECH7EC4113_3194; phage(gi16132105) 0.0 Click
311094789..1095115 PHAGE_Entero_4795: putative transposase OrfA protein of IS629; ECH7EC4113_3196; phage(gi157166066) 5e-57 Click
321095115..1096002 PROPHAGE_Escher_EDL933: transposase for IS629; ECH7EC4113_3197; phage(gi15801145) 9e-172 Click
33complement(1096042..1096188) PROPHAGE_Escher_EDL933: partial putative transposase; ECH7EC4113_3198; phage(gi15801060) 8e-22 Click
34complement(1097189..1097275) tRNA 0.0 Click
35complement(1097288..1097361) tRNA 0.0 Click
36complement(1097415..1097490) tRNA 0.0 Click
37complement(1097701..1098246) PHAGE_Ectoca_1: EsV-1-139; ECH7EC4113_3202; phage(gi13242610) 2e-17 Click
381098341..1099393 ribosome small subunit-dependent GTPase A; ECH7EC4113_3203 0.0 Click
391100479..1103802 PHAGE_Human__8: LANA; ECH7EC4113_3205; phage(gi139472804) 5e-07 Click
401111519..1111530 attR    CGCTTTTCCTTG 0.0 Click

Region 2, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11212292..1212305 attL    AATATTGCGGCTAA 0.0 Click
2complement(1224686..1226101) PHAGE_Entero_P1: Ban; ECH7EC4113_3324; phage(gi46401697) 0.0 Click
31226184..1227167 quinone oxidoreductase; ECH7EC4113_3325 0.0 Click
4complement(1227333..1227575) phage shock protein G; ECH7EC4113_3326 0.0 Click
5complement(1227709..1228746) tRNA-dihydrouridine synthase A; ECH7EC4113_3327 0.0 Click
61228835..1229932 PHAGE_Entero_mEp460: integrase; ECH7EC4113_3328; phage(gi428782338) 0.0 Click
71229994..1230242 PHAGE_Entero_2008: putative DNA damage-inducible protein; ECH7EC4113_3329; phage(gi209427797) 2e-40 Click
8complement(1230403..1231044) PHAGE_Entero_2008: hypothetical protein YYZ_gp73; ECH7EC4113_3330; phage(gi209427796) 2e-117 Click
9complement(1231126..1231527) PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECH7EC4113_3331; phage(gi209427795) 2e-72 Click
10complement(1231828..1232400) PHAGE_Entero_2008: hypothetical protein YYZ_gp73; ECH7EC4113_3332; phage(gi209427796) 8e-20 Click
11complement(1232512..1232781) PHAGE_Stx2_c_II: putative tail fiber protein; ECH7EC4113_3333; phage(gi302393091) 8e-44 Click
121236059..1236072 attR    AATATTGCGGCTAA 0.0 Click

Region 3, total : 89 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11327251..1327262 attL    CTCTTTTGCCAG 0.0 Click
2complement(1328264..1329529) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp22; ECH7EC4113_3897; phage(gi302393102) 0.0 Click
3complement(1329540..1329833) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp21; ECH7EC4113_3898; phage(gi302393101) 2e-32 Click
4complement(1329843..1330289) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp20; ECH7EC4113_3899; phage(gi302393100) 9e-78 Click
5complement(1330292..1330948) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp19; ECH7EC4113_3900; phage(gi302393099) 8e-121 Click
6complement(1331043..1331420) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp18; ECH7EC4113_3901; phage(gi302393098) 4e-67 Click
7complement(1331501..1331641) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp17; ECH7EC4113_3902; phage(gi302393097) 1e-21 Click
8complement(1331872..1332606) PHAGE_Stx2_c_II: outer membrane protein Lom precursor; ECH7EC4113_3903; phage(gi302393096) 8e-139 Click
9complement(1332697..1333314) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp15; ECH7EC4113_3904; phage(gi302393095) 4e-122 Click
10complement(1333320..1333598) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp14; ECH7EC4113_3905; phage(gi302393094) 5e-51 Click
11complement(1333613..1334827) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp13; ECH7EC4113_3906; phage(gi302393093) 0.0 Click
12complement(1334878..1336503) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp12; ECH7EC4113_3907; phage(gi302393092) 0.0 Click
13complement(1336618..1336731) hypothetical protein; ECH7EC4113_3908 0.0 Click
14complement(1337125..1337394) PHAGE_Stx2_c_II: putative tail fiber protein; ECH7EC4113_3910; phage(gi302393091) 4e-47 Click
15complement(1337396..1339333) PHAGE_Stx2_c_II: putative tail fiber protein; ECH7EC4113_3911; phage(gi302393090) 0.0 Click
16complement(1339330..1339980) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp09; ECH7EC4113_3912; phage(gi302393089) 9e-122 Click
17complement(1339980..1340543) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp08; ECH7EC4113_3913; phage(gi302393088) 2e-104 Click
18complement(1340527..1340988) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp07; ECH7EC4113_3914; phage(gi302393087) 2e-82 Click
19complement(1341038..1341427) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp06; ECH7EC4113_3915; phage(gi302393086) 2e-66 Click
20complement(1341483..1342697) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp05; ECH7EC4113_3916; phage(gi302393085) 0.0 Click
21complement(1342721..1343137) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp04; ECH7EC4113_3917; phage(gi302393084) 3e-73 Click
221343268..1343594 PHAGE_Stx2_c_II: putative transposase; ECH7EC4113_3918; phage(gi302393161) 1e-58 Click
231343591..1344481 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp77; ECH7EC4113_3919; phage(gi302393160) 2e-173 Click
24complement(1344484..1345041) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp04; ECH7EC4113_3920; phage(gi302393084) 5e-94 Click
25complement(1345199..1347343) PHAGE_Stx2_c_II: portal protein; ECH7EC4113_3921; phage(gi302393083) 0.0 Click
26complement(1347343..1349004) PHAGE_Stx2_c_II: terminase, large subunit; ECH7EC4113_3922; phage(gi302393082) 0.0 Click
27complement(1349030..1349836) PHAGE_Stx2_c_II: terminase, small subunit; ECH7EC4113_3923; phage(gi302393081) 3e-151 Click
28complement(1349892..1350005) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip164; ECH7EC4113_3924; phage(gi20065959) 6e-17 Click
291350245..1350538 PHAGE_Stx2_c_II: Bor protein precursor; ECH7EC4113_3925; phage(gi302393169) 2e-50 Click
30complement(1350570..1351034) PHAGE_Stx2_c_II: endopeptidase Rz; ECH7EC4113_3926; phage(gi302393167) 5e-69 Click
31complement(1351042..1351176) PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; ECH7EC4113_3927; phage(gi302861202) 4e-16 Click
32complement(1351191..1351760) PHAGE_Stx2_c_II: putative antirepressor protein Ant; ECH7EC4113_3928; phage(gi302393166) 1e-102 Click
33complement(1352034..1352567) PHAGE_Stx2_c_II: endolysin; ECH7EC4113_3929; phage(gi302393165) 2e-100 Click
34complement(1352572..1352787) PHAGE_Stx2_c_II: holin; ECH7EC4113_3930; phage(gi302393164) 2e-35 Click
35complement(1352864..1353136) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp80; ECH7EC4113_3931; phage(gi302393163) 1e-43 Click
36complement(1353177..1353356) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp79; ECH7EC4113_3932; phage(gi302393162) 2e-28 Click
37complement(1353369..1353494) PHAGE_Escher_TL_2011c: hypothetical protein; ECH7EC4113_3933; phage(gi418487096) 7e-19 Click
38complement(1353491..1355428) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip148; ECH7EC4113_3934; phage(gi20065943) 0.0 Click
39complement(1355915..1356184) PHAGE_Stx2_c_II: Shiga toxin 2 subunit B; ECH7EC4113_3935; phage(gi302393158) 1e-46 Click
40complement(1356196..1357155) PHAGE_Stx2_c_II: Shiga toxin 2 subunit A; ECH7EC4113_3936; phage(gi302393157) 0.0 Click
41complement(1357245..1357323) tRNA 0.0 Click
42complement(1357335..1357413) tRNA 0.0 Click
43complement(1357420..1357495) tRNA 0.0 Click
44complement(1357937..1358371) PHAGE_Stx2_c_II: antitermination protein Q; ECH7EC4113_3941; phage(gi302393156) 8e-83 Click
45complement(1358364..1358558) PHAGE_Stx2_c_II: NinH protein; ECH7EC4113_3942; phage(gi302393155) 2e-32 Click
46complement(1358555..1359160) PHAGE_Stx2_c_II: NinG protein; ECH7EC4113_3943; phage(gi302393154) 3e-118 Click
47complement(1359160..1359882) PHAGE_Stx2_c_86: DNA-binding protein Roi; ECH7EC4113_3944; phage(gi116222069) 3e-132 Click
48complement(1360044..1360445) PHAGE_Stx1_converting: hypothetical protein Stx1_gp68; ECH7EC4113_3945; phage(gi302861190) 8e-76 Click
49complement(1360520..1361194) PHAGE_Stx2_c_II: putative antirepressor-like protein; ECH7EC4113_3946; phage(gi302393152) 2e-113 Click
50complement(1361642..1362169) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip133; ECH7EC4113_3947; phage(gi20065928) 4e-101 Click
51complement(1362195..1362314) hypothetical protein; ECH7EC4113_3948 0.0 Click
521363043..1363156 hypothetical protein; ECH7EC4113_3949 0.0 Click
53complement(1363699..1363977) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp62; ECH7EC4113_3951; phage(gi302393145) 5e-51 Click
54complement(1364048..1364338) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip128; ECH7EC4113_3952; phage(gi20065923) 2e-49 Click
55complement(1364335..1365036) PHAGE_Entero_4795: putative replication protein P; ECH7EC4113_3953; phage(gi157166012) 4e-132 Click
56complement(1365033..1365971) PHAGE_Entero_4795: putative replication protein O; ECH7EC4113_3954; phage(gi157166011) 0.0 Click
57complement(1366004..1366120) PHAGE_Entero_HK629: CII protein; ECH7EC4113_3955; phage(gi428782059) 3e-13 Click
58complement(1366439..1366666) PHAGE_Stx2_c_I: Cro protein; ECH7EC4113_3956; phage(gi20065917) 1e-37 Click
591366745..1367452 PHAGE_Stx2_c_I: CI protein; ECH7EC4113_3957; phage(gi20065916) 2e-134 Click
601367513..1367854 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp61; ECH7EC4113_3958; phage(gi116222054) 2e-64 Click
611368377..1369423 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip116; ECH7EC4113_3959; phage(gi20065911) 0.0 Click
621369426..1369590 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip115; ECH7EC4113_3960; phage(gi20065910) 3e-24 Click
631369818..1369976 hypothetical protein; ECH7EC4113_3961 0.0 Click
641370079..1370462 PHAGE_Stx2_c_I: N protein; ECH7EC4113_3962; phage(gi20065909) 6e-68 Click
651370521..1370991 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip113; ECH7EC4113_3963; phage(gi20065908) 2e-91 Click
661371142..1371510 PHAGE_Stx2_c_I: Ea10 protein; ECH7EC4113_3964; phage(gi20065907) 7e-67 Click
671371716..1371880 PHAGE_Stx2_c_II: Kil protein; ECH7EC4113_3965; phage(gi302393131) 1e-19 Click
681371935..1372231 PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; ECH7EC4113_3966; phage(gi116222045) 3e-52 Click
691372237..1373022 PHAGE_Stx2_c_86: recombination protein Bet; ECH7EC4113_3967; phage(gi116222044) 3e-151 Click
701373019..1373699 PHAGE_Stx2_c_II: exonuclease; ECH7EC4113_3968; phage(gi302393128) 5e-131 Click
711373929..1374042 PHAGE_Entero_HK630: hypothetical protein; ECH7EC4113_3969; phage(gi428782820) 8e-14 Click
721374119..1374334 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp41; ECH7EC4113_3970; phage(gi302393124) 5e-35 Click
731374651..1375598 PHAGE_Entero_2008: hypothetical protein YYZ_gp09; ECH7EC4113_3971; phage(gi209427735) 1e-179 Click
741375600..1376106 PHAGE_Entero_phiV10: hypothetical protein PhiV10p53; ECH7EC4113_3972; phage(gi89152467) 7e-21 Click
751376066..1376281 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp36; ECH7EC4113_3973; phage(gi302393119) 1e-36 Click
761376283..1376501 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp35; ECH7EC4113_3974; phage(gi302393118) 1e-36 Click
771376503..1376790 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp34; ECH7EC4113_3975; phage(gi302393117) 1e-51 Click
781378447..1378674 PHAGE_Stx2_c_II: putative antirepressor protein AntB; ECH7EC4113_3977; phage(gi302393111) 4e-29 Click
791378717..1378884 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp41; ECH7EC4113_3978; phage(gi116222033) 9e-29 Click
801379111..1379737 PHAGE_Escher_P13374: methylase; ECH7EC4113_3979; phage(gi410491602) 4e-122 Click
811379697..1379909 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp43; ECH7EC4113_3980; phage(gi302393126) 2e-09 Click
821379937..1379948 attL    AGAAAAAAATGA 0.0 Click
831379945..1380322 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp38; ECH7EC4113_3981; phage(gi116222030) 1e-63 Click
841380401..1380583 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp37; ECH7EC4113_3983; phage(gi116222029) 4e-29 Click
85complement(1380567..1381811) PHAGE_Stx2_c_86: integrase; ECH7EC4113_3982; phage(gi116222028) 0.0 Click
861381931..1382007 tRNA 0.0 Click
871382132..1383325 PROPHAGE_Escher_Sakai: putative prophage Sf6-like integrase; ECH7EC4113_3985; phage(gi15832485) 0.0 Click
88complement(1383500..1384636) PHAGE_Salmon_vB_SemP_Emek: injection protein; ECH7EC4113_3986; phage(gi399498803) 3e-51 Click
89complement(1384646..1385272) PHAGE_Entero_IME10: DNA transfer protein; ECH7EC4113_3987; phage(gi422934288) 2e-74 Click
90complement(1385313..1385780) PHAGE_Sodali_phiSG1: hypothetical protein SGPHI_0018; ECH7EC4113_3988; phage(gi89885999) 2e-64 Click
91complement(1385780..1386310) PHAGE_Entero_Sf6: gene 9 protein; ECH7EC4113_3989; phage(gi41057287) 9e-92 Click
921386332..1387027 conserved hypothetical protein; ECH7EC4113_3990 0.0 Click
931387228..1387239 attR    AGAAAAAAATGA 0.0 Click
94complement(1387697..1389109) conserved hypothetical protein; ECH7EC4113_3991 0.0 Click
95complement(1389296..1389472) conserved hypothetical protein; ECH7EC4113_3992 0.0 Click
961389775..1390401 PHAGE_Staphy_StB27: integrase; ECH7EC4113_3993; phage(gi431809677) 3e-10 Click
971392602..1392613 attR    CTCTTTTGCCAG 0.0 Click

Region 4, total : 8 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12151342..2151353 attL    CTTTCTGATATT 0.0 Click
2complement(2161947..2162357) PHAGE_Erwini_ENT90: phage tail collar domain protein; ECH7EC4113_4179; phage(gi431810938) 3e-14 Click
32162387..2162941 PHAGE_Entero_2: DNA-invertase; ECH7EC4113_4180; phage(gi169936026) 8e-89 Click
4complement(2162999..2163772) PHAGE_Pseudo_OBP: putative homing nuclease; ECH7EC4113_4181; phage(gi371671534) 2e-38 Click
52164595..2165338 putative AraC-type regulatory protein encoded in prophage CP-933H; ECH7EC4113_4182 0.0 Click
6complement(2165380..2165745) PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; ECH7EC4113_4183; phage(gi24111655) 2e-44 Click
7complement(2166863..2167753) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp77; ECH7EC4113_4184; phage(gi302393160) 5e-172 Click
8complement(2167750..2168076) PHAGE_Stx2_c_II: putative transposase; ECH7EC4113_4185; phage(gi302393161) 1e-58 Click
92168133..2168795 PROPHAGE_Escher_CFT073: putative prophage integrase; ECH7EC4113_4186; phage(gi26250313) 3e-76 Click
102170769..2170780 attR    CTTTCTGATATT 0.0 Click

Region 5, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12740531..2742192 PHAGE_Entero_2008: putative phage terminase-like protein large subunit; ECH7EC4113_4539; phage(gi209427775) 0.0 Click
22742256..2744193 PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECH7EC4113_4540; phage(gi209427776) 0.0 Click
32744405..2746906 PHAGE_Entero_2008: putative portal protein; ECH7EC4113_4541; phage(gi209427777) 0.0 Click
42746986..2747312 PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ECH7EC4113_4542; phage(gi209427778) 1e-54 Click
52747322..2747672 PHAGE_Entero_2008: putative head-tail adaptor; ECH7EC4113_4543; phage(gi209427779) 9e-61 Click
62747669..2748115 PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ECH7EC4113_4544; phage(gi209427780) 2e-80 Click
72748112..2748456 PHAGE_Entero_2008: putative prophage structural protein; ECH7EC4113_4545; phage(gi209427781) 6e-60 Click
82749252..2749626 PHAGE_Entero_2008: putative tail assembly protein; ECH7EC4113_4548; phage(gi209427783) 4e-67 Click
92749728..2749931 PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECH7EC4113_4549; phage(gi209427784) 3e-32 Click
102749984..2753223 PHAGE_Entero_2008: putative tail protein; ECH7EC4113_4550; phage(gi209427785) 0.0 Click
112753216..2753557 PHAGE_Entero_2008: putative minor tail protein; ECH7EC4113_4551; phage(gi209427786) 3e-63 Click
122753557..2754255 PHAGE_Entero_2008: putative tail protein; ECH7EC4113_4552; phage(gi209427787) 1e-131 Click
13complement(2754272..2754412) putative regulatory protein; ECH7EC4113_4553 0.0 Click
142754606..2754746 conserved hypothetical protein; ECH7EC4113_4554 0.0 Click
152755049..2755927 PHAGE_Salmon_vB_SemP_Emek: antirepressor; ECH7EC4113_4555; phage(gi399498814) 2e-94 Click
162755981..2756718 PHAGE_Entero_2008: putative tail component K-like protein; ECH7EC4113_4556; phage(gi209427789) 3e-151 Click
172756715..2756900 PHAGE_Entero_2008: putative tail assembly protein; ECH7EC4113_4557; phage(gi209427790) 4e-11 Click
182757022..2759370 PHAGE_Staphy_SA11: putative pentapeptide repeat protein; ECH7EC4113_4558; phage(gi422935631) 2e-05 Click

Region 6, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12772563..2772583 attL    CGGTGTAGTTAATGGTGTAGT 0.0 Click
22772589..2773839 PHAGE_Salmon_vB_SosS_Oslo: integrase; ECH7EC4113_4571; phage(gi399528791) 2e-59 Click
32774450..2775394 conserved hypothetical protein; ECH7EC4113_4572 0.0 Click
42775387..2775599 hypothetical protein; ECH7EC4113_4573 0.0 Click
52776046..2776279 conserved hypothetical protein; ECH7EC4113_4575 0.0 Click
62776285..2776584 conserved hypothetical protein; ECH7EC4113_4576 0.0 Click
72776581..2777981 PHAGE_Mycoba_PG1: gp59; ECH7EC4113_4577; phage(gi38638462) 8e-30 Click
82778182..2778433 hypothetical bacteriophage protein; ECH7EC4113_4578 0.0 Click
92778430..2778840 PHAGE_Lactoc_Q54: hypothetical protein Q54_gp12; ECH7EC4113_4579; phage(gi115304283) 3e-09 Click
102779080..2779208 hypothetical protein; ECH7EC4113_4580 0.0 Click
112779726..2779932 conserved hypothetical protein; ECH7EC4113_4582 0.0 Click
122779932..2780987 PHAGE_Entero_N15: gp8; ECH7EC4113_4583; phage(gi9630472) 6e-69 Click
132781000..2781335 PHAGE_Entero_N15: gp7; ECH7EC4113_4584; phage(gi9630471) 8e-07 Click
142781348..2781761 conserved hypothetical protein; ECH7EC4113_4585 0.0 Click
152781968..2782510 PHAGE_Entero_N15: gp1; ECH7EC4113_4587; phage(gi9630465) 4e-36 Click
16complement(2782490..2782714) conserved hypothetical protein; ECH7EC4113_4586 0.0 Click
172782766..2783047 hypothetical bacteriophage protein; ECH7EC4113_4588 0.0 Click
182783541..2783561 attR    CGGTGTAGTTAATGGTGTAGT 0.0 Click

Region 7, total : 42 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12783359..2783370 attL    AGGTAAAACCCA 0.0 Click
2complement(2791819..2792961) PHAGE_Entero_mEp235: integrase; ECH7EC4113_4598; phage(gi428781836) 5e-61 Click
32793291..2794115 PHAGE_Entero_lambda: DNA replication protein; ECH7EC4113_4599; phage(gi9626295) 2e-99 Click
42794112..2794813 PHAGE_Entero_lambda: DNA replication protein; ECH7EC4113_4600; phage(gi9626296) 4e-129 Click
52795180..2795512 PHAGE_Acinet_Acj61: putative quaternary ammonium compound-resistance protein qacE; ECH7EC4113_4601; phage(gi311992758) 1e-10 Click
62797781..2798236 PHAGE_Cronob_phiES15: hypothetical protein; ECH7EC4113_4604; phage(gi401817579) 9e-59 Click
72798236..2798406 PHAGE_Escher_HK639: NinE; ECH7EC4113_4605; phage(gi356870663) 1e-14 Click
82798399..2798689 PHAGE_Entero_mEp237: hypothetical protein; ECH7EC4113_4606; phage(gi435439317) 3e-48 Click
92798686..2799048 PHAGE_Entero_mEp237: Holliday junction resolvase RusA; ECH7EC4113_4607; phage(gi435439318) 1e-61 Click
102799048..2799185 PHAGE_Entero_mEp237: hypothetical protein; ECH7EC4113_4608; phage(gi435439319) 1e-11 Click
112799182..2799871 PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECH7EC4113_4609; phage(gi169257244) 4e-84 Click
122800181..2800498 PHAGE_Salmon_ST160: Gp13; ECH7EC4113_4610; phage(gi318065943) 5e-40 Click
132800485..2800961 PHAGE_Escher_HK75: lysozyme; ECH7EC4113_4611; phage(gi356870730) 6e-85 Click
142800958..2801419 PHAGE_Entero_lambda: cell lysis protein; ECH7EC4113_4612; phage(gi9626310) 3e-80 Click
15complement(2801451..2801744) PHAGE_Entero_lambda: Bor protein precursor; ECH7EC4113_4613; phage(gi19263395) 6e-50 Click
16complement(2802036..2802446) PHAGE_Entero_lambda: putative envelope protein; ECH7EC4113_4614; phage(gi19263396) 2e-74 Click
172802732..2802938 PHAGE_Entero_lambda: hypothetical protein lambdap79; ECH7EC4113_4615; phage(gi19263397) 1e-32 Click
182803686..2804231 PHAGE_Entero_lambda: DNA packaging protein; ECH7EC4113_4616; phage(gi9626244) 3e-96 Click
192804206..2806131 PHAGE_Entero_lambda: DNA packaging protein; ECH7EC4113_4617; phage(gi9626245) 0.0 Click
202806128..2806334 PHAGE_Entero_lambda: head-tail joining protein; ECH7EC4113_4618; phage(gi9626246) 1e-31 Click
212806331..2807932 PHAGE_Entero_lambda: capsid component; ECH7EC4113_4619; phage(gi9626247) 0.0 Click
222807913..2809232 PHAGE_Entero_lambda: capsid component; ECH7EC4113_4620; phage(gi9626248) 0.0 Click
232809242..2809574 PHAGE_Entero_lambda: head-DNA stabilization protein; ECH7EC4113_4621; phage(gi9626250) 7e-58 Click
242809603..2810655 PHAGE_Entero_lambda: capsid component; ECH7EC4113_4622; phage(gi9626251) 0.0 Click
252810697..2811095 PHAGE_Entero_lambda: DNA packaging protein; ECH7EC4113_4623; phage(gi9626252) 3e-67 Click
262811107..2811460 PHAGE_Entero_lambda: head-tail joining protein; ECH7EC4113_4624; phage(gi9626253) 3e-62 Click
272811472..2812050 PHAGE_Entero_lambda: tail component; ECH7EC4113_4625; phage(gi9626254) 6e-101 Click
282812047..2812442 PHAGE_Entero_lambda: tail component; ECH7EC4113_4626; phage(gi9626255) 2e-72 Click
292812450..2813190 PHAGE_Entero_lambda: tail component; ECH7EC4113_4627; phage(gi9626256) 3e-133 Click
302813206..2813628 PHAGE_Entero_lambda: tail component; ECH7EC4113_4628; phage(gi9626257) 2e-73 Click
312813610..2814044 PHAGE_Entero_lambda: tail component; ECH7EC4113_4629; phage(gi9626258) 2e-81 Click
322814037..2816586 PHAGE_Entero_lambda: tail component; ECH7EC4113_4630; phage(gi9626259) 0.0 Click
332816583..2816912 PHAGE_Entero_lambda: tail component; ECH7EC4113_4631; phage(gi9626260) 1e-56 Click
342816912..2817610 PHAGE_Entero_lambda: tail component; ECH7EC4113_4632; phage(gi9626261) 5e-134 Click
352817616..2818359 PHAGE_Entero_mEp460: tail fiber component; ECH7EC4113_4633; phage(gi428782332) 2e-149 Click
362818356..2818928 PHAGE_Entero_lambda: tail component; ECH7EC4113_4634; phage(gi9626263) 1e-100 Click
372818989..2822387 PHAGE_Entero_lambda: tail:host specificity protein; ECH7EC4113_4635; phage(gi9626264) 0.0 Click
382822454..2823053 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; ECH7EC4113_4636; phage(gi148609401) 6e-112 Click
39complement(2823054..2823227) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; ECH7EC4113_4637; phage(gi157166059) 2e-29 Click
40complement(2823615..2824352) PHAGE_Entero_lambda: hypothetical protein lambdap90; ECH7EC4113_4638; phage(gi9626267) 1e-52 Click
412824388..2824522 hypothetical protein; ECH7EC4113_4639 0.0 Click
422824483..2826033 PHAGE_Entero_lambda: Tail fiber; ECH7EC4113_4640; phage(gi9626268) 2e-87 Click
432826033..2826614 PHAGE_Entero_lambda: Putative fiber assembly protein; ECH7EC4113_4641; phage(gi9626269) 4e-102 Click
442829911..2829922 attR    AGGTAAAACCCA 0.0 Click

Region 8, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13098361..3098573 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp03; ECH7EC4113_5352; phage(gi148609385) 9e-24 Click
23098573..3100075 PHAGE_Entero_cdtI: putative portal protein; ECH7EC4113_5353; phage(gi148609386) 0.0 Click
33100089..3102044 PHAGE_Entero_cdtI: putative protease/scaffold protein; ECH7EC4113_5354; phage(gi148609387) 0.0 Click
43102132..3102458 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp06; ECH7EC4113_5355; phage(gi148609388) 2e-22 Click
53102484..3102732 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp07; ECH7EC4113_5356; phage(gi148609389) 7e-13 Click
63102735..3103358 PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4113_5357; phage(gi15832208) 6e-112 Click
73103371..3103769 PROPHAGE_Escher_Sakai: putative minor tail protein U; ECH7EC4113_5358; phage(gi15832207) 1e-72 Click
83103777..3104529 PHAGE_Entero_HK630: major tail protein V; ECH7EC4113_5359; phage(gi428782800) 1e-112 Click
93104992..3105300 PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4113_5361; phage(gi15832204) 2e-56 Click
103107982..3108311 PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4113_5364; phage(gi15832202) 3e-60 Click
113108311..3109009 PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4113_5365; phage(gi15832201) 1e-134 Click
123109128..3109763 PHAGE_Entero_cdtI: putative tail protein; ECH7EC4113_5366; phage(gi148609398) 4e-113 Click
133109760..3110338 PROPHAGE_Escher_Sakai: putative tail assembly protein; ECH7EC4113_5367; phage(gi15832199) 2e-105 Click
143110384..3110503 hypothetical protein; ECH7EC4113_5368 0.0 Click
153110579..3114052 PHAGE_Entero_cdtI: putative tail tip assembly protein; ECH7EC4113_5369; phage(gi148609400) 0.0 Click
163114120..3114251 hypothetical protein; ECH7EC4113_5370 0.0 Click
173114782..3116095 PHAGE_Entero_cdtI: putative tail fiber protein; ECH7EC4113_5372; phage(gi148609402) 0.0 Click
183116097..3116366 PHAGE_Stx2_c_II: putative tail fiber protein; ECH7EC4113_5373; phage(gi302393091) 2e-41 Click
19complement(3116734..3116982) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp30; ECH7EC4113_5374; phage(gi148609412) 3e-40 Click

Region 9, total : 10 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13232673..3232687 attL    ACGCCGCATCCGGCA 0.0 Click
2complement(3247296..3248270) PHAGE_Entero_SfV: integrase; ECH7EC4113_0609; phage(gi19549014) 3e-178 Click
3complement(3248733..3249623) PROPHAGE_Escher_Sakai: putative transposase; ECH7EC4113_0610; phage(gi15834498) 2e-173 Click
4complement(3249620..3249946) PHAGE_Stx2_c_II: putative transposase; ECH7EC4113_0611; phage(gi302393161) 1e-58 Click
5complement(3250483..3251196) PHAGE_Entero_lambda: repressor; ECH7EC4113_0612; phage(gi9626292) 4e-132 Click
63251297..3251497 PHAGE_Entero_lambda: antirepressor; ECH7EC4113_0613; phage(gi9626293) 7e-32 Click
73251772..3251909 PHAGE_Entero_lambda: cII protein; ECH7EC4113_0614; phage(gi9626294) 1e-18 Click
83252861..3253172 PHAGE_Entero_lambda: DNA replication protein; ECH7EC4113_0616; phage(gi9626296) 3e-05 Click
93253172..3253882 PHAGE_Erwini_ENT90: phage tail collar domain protein; ECH7EC4113_0617; phage(gi431810938) 4e-15 Click
103254160..3254219 tRNA 0.0 Click
113254271..3254346 tRNA 0.0 Click
123254350..3254425 tRNA 0.0 Click
133254571..3254648 tRNA 0.0 Click
143254934..3255968 quinolinate synthetase complex, A subunit; ECH7EC4113_5275 0.0 Click
153256006..3256725 PHAGE_Vibrio_KVP40: PnuC; ECH7EC4113_5277; phage(gi34419448) 2e-28 Click
163265133..3265147 attR    ACGCCGCATCCGGCA 0.0 Click

Region 10, total : 40 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13280084..3280098 attL    GCTTTTTTATACTAA 0.0 Click
2complement(3280172..3281242) PHAGE_Entero_HK106: integrase; ECH7EC4113_5300; phage(gi428783305) 0.0 Click
33281490..3281660 hypothetical protein; ECH7EC4113_5301 0.0 Click
43281947..3282069 conserved hypothetical protein; ECH7EC4113_5302 0.0 Click
53282341..3282490 conserved hypothetical protein; ECH7EC4113_5303 0.0 Click
6complement(3283021..3283236) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; ECH7EC4113_5304; phage(gi20065893) 3e-34 Click
7complement(3283313..3283426) PHAGE_Entero_HK630: hypothetical protein; ECH7EC4113_5305; phage(gi428782820) 2e-12 Click
8complement(3283656..3284336) PHAGE_Stx2_c_1717: exonuclease; ECH7EC4113_5306; phage(gi209447136) 4e-132 Click
9complement(3284333..3284980) PHAGE_Stx2_c_I: Bet protein; ECH7EC4113_5307; phage(gi20065900) 1e-125 Click
103285373..3285996 PHAGE_Entero_Sf6: gene 54 protein; ECH7EC4113_5308; phage(gi41057342) 2e-114 Click
113285993..3286658 PHAGE_Stx2_c_1717: NinI protein; ECH7EC4113_5309; phage(gi209447164) 3e-130 Click
12complement(3286870..3287829) putative outer membrane protein; ECH7EC4113_5310 0.0 Click
133288304..3288993 PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECH7EC4113_5311; phage(gi169257244) 3e-81 Click
143289204..3289920 conserved hypothetical protein; ECH7EC4113_5312 0.0 Click
153290006..3290164 PHAGE_Entero_P1: TciB; ECH7EC4113_5313; phage(gi46401695) 3e-06 Click
163291001..3291498 PHAGE_Entero_cdtI: lysin; ECH7EC4113_5315; phage(gi148609440) 1e-91 Click
173291495..3291962 PHAGE_Salmon_SPN9CC: endopeptidase; ECH7EC4113_5316; phage(gi389060532) 2e-78 Click
183291950..3292102 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4113_5317; phage(gi428782374) 1e-21 Click
193292777..3293268 PHAGE_Entero_mEp460: terminase small subunit; ECH7EC4113_5318; phage(gi428782317) 5e-74 Click
203293268..3295370 PHAGE_Entero_cdtI: putative large terminase subunit; ECH7EC4113_5319; phage(gi148609384) 0.0 Click
213295367..3295579 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp03; ECH7EC4113_5320; phage(gi148609385) 8e-35 Click
223297102..3299060 PHAGE_Entero_cdtI: putative protease/scaffold protein; ECH7EC4113_5323; phage(gi148609387) 0.0 Click
233299147..3299470 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp06; ECH7EC4113_5324; phage(gi148609388) 2e-54 Click
243299463..3299738 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp07; ECH7EC4113_5325; phage(gi148609389) 6e-39 Click
253299750..3300328 PHAGE_Entero_cdtI: putative tail component; ECH7EC4113_5326; phage(gi148609390) 2e-103 Click
263300325..3300726 PHAGE_Entero_cdtI: putative tail component; ECH7EC4113_5327; phage(gi148609391) 8e-73 Click
273300737..3301480 PHAGE_Entero_cdtI: putative major tail subunit; ECH7EC4113_5328; phage(gi148609392) 4e-137 Click
283301541..3301927 PHAGE_Entero_cdtI: putative tail component; ECH7EC4113_5329; phage(gi148609393) 5e-65 Click
293301948..3302265 PHAGE_Entero_cdtI: putative minor tail protein; ECH7EC4113_5330; phage(gi148609394) 1e-56 Click
303302237..3305302 PHAGE_Entero_cdtI: putative tail protein; ECH7EC4113_5331; phage(gi148609395) 0.0 Click
313305302..3305631 PHAGE_Entero_cdtI: putative minor tail protein; ECH7EC4113_5332; phage(gi148609396) 2e-61 Click
323305641..3306339 PHAGE_Entero_cdtI: putative minor tail protein; ECH7EC4113_5333; phage(gi148609397) 9e-136 Click
333306345..3307088 PHAGE_Entero_cdtI: putative tail protein; ECH7EC4113_5334; phage(gi148609398) 3e-142 Click
343307121..3307633 PHAGE_Entero_cdtI: putative tail component; ECH7EC4113_5335; phage(gi148609399) 7e-86 Click
353307694..3311107 PHAGE_Entero_cdtI: putative tail tip assembly protein; ECH7EC4113_5336; phage(gi148609400) 0.0 Click
363311178..3311777 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; ECH7EC4113_5337; phage(gi148609401) 3e-104 Click
373311837..3313153 PHAGE_Entero_cdtI: putative tail fiber protein; ECH7EC4113_5338; phage(gi148609402) 0.0 Click
383313155..3313424 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp22; ECH7EC4113_5339; phage(gi148609404) 1e-46 Click
393313601..3314581 PHAGE_Salmon_ST64B: hypothetical protein sb26; ECH7EC4113_5340; phage(gi23505470) 3e-90 Click
403314642..3315634 non-LEE encoded type III effector C; ECH7EC4113_5341 0.0 Click
413316462..3317343 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp23; ECH7EC4113_5342; phage(gi148609405) 9e-156 Click
423318674..3318688 attR    GCTTTTTTATACTAA 0.0 Click

Region 11, total : 28 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13459290..3459301 attL    AAATCAGATATG 0.0 Click
2complement(3460470..3460904) PHAGE_Stx2_c_I: Q protein; ECH7EC4113_1467; phage(gi20065938) 3e-80 Click
3complement(3460990..3461127) PHAGE_Entero_mEp237: hypothetical protein; ECH7EC4113_1468; phage(gi435439319) 4e-10 Click
4complement(3461127..3461489) PHAGE_Entero_mEp237: Holliday junction resolvase RusA; ECH7EC4113_1469; phage(gi435439318) 5e-62 Click
5complement(3461486..3461776) PHAGE_Entero_mEp237: hypothetical protein; ECH7EC4113_1470; phage(gi435439317) 5e-49 Click
6complement(3461939..3462394) PHAGE_Cronob_phiES15: hypothetical protein; ECH7EC4113_1471; phage(gi401817579) 9e-62 Click
7complement(3462609..3463406) transcriptional regulator, AraC family; ECH7EC4113_1472 0.0 Click
8complement(3463416..3463967) putative phosphatidylethanolamine-binding protein; ECH7EC4113_1473 0.0 Click
9complement(3464432..3465958) PHAGE_Bacill_WBeta: putative site-specific recombinase; ECH7EC4113_1474; phage(gi85701406) 5e-09 Click
10complement(3466215..3466547) PHAGE_Acinet_Acj61: putative quaternary ammonium compound-resistance protein qacE; ECH7EC4113_1475; phage(gi311992758) 9e-11 Click
11complement(3466615..3466917) PHAGE_Entero_4795: putative Ren protein; ECH7EC4113_1476; phage(gi157166013) 6e-44 Click
12complement(3466914..3467351) PHAGE_Entero_4795: putative replication protein P; ECH7EC4113_1477; phage(gi157166012) 5e-80 Click
133467406..3467732 PHAGE_Entero_4795: putative transposase OrfA protein of IS629; ECH7EC4113_1478; phage(gi157166062) 1e-58 Click
143467729..3468619 PROPHAGE_Escher_Sakai: putative transposase; ECH7EC4113_1479; phage(gi15834498) 2e-173 Click
15complement(3468925..3469929) PHAGE_Entero_4795: putative replication protein O; ECH7EC4113_1481; phage(gi157166011) 3e-114 Click
16complement(3469941..3470480) PHAGE_Entero_mEp237: CII protein; ECH7EC4113_1482; phage(gi435439306) 1e-63 Click
17complement(3470550..3470780) PHAGE_Escher_HK639: cro; ECH7EC4113_1483; phage(gi356870651) 3e-20 Click
183470885..3471574 PHAGE_Entero_ST104: CI; ECH7EC4113_1484; phage(gi46358671) 7e-94 Click
193471655..3472716 PHAGE_Lactob_Lj965: hypothetical protein Ljo_0304; ECH7EC4113_1485; phage(gi41179236) 4e-66 Click
203473552..3473758 PHAGE_Entero_HK225: Kil protein; ECH7EC4113_1486; phage(gi428782413) 6e-30 Click
213473834..3474130 PHAGE_Entero_4795: putative host-nuclease inhibitor protein Gam; ECH7EC4113_1487; phage(gi157165999) 9e-53 Click
223474136..3474921 PHAGE_Stx2_c_I: Bet protein; ECH7EC4113_1488; phage(gi20065900) 2e-151 Click
233474918..3475595 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip102; ECH7EC4113_1489; phage(gi20065897) 4e-132 Click
243475828..3475941 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip099; ECH7EC4113_1490; phage(gi20065894) 4e-14 Click
253476018..3476233 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; ECH7EC4113_1491; phage(gi20065893) 5e-35 Click
263476550..3477497 PHAGE_Entero_2008: hypothetical protein YYZ_gp09; ECH7EC4113_1492; phage(gi209427735) 0.0 Click
273478911..3479054 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF4; ECH7EC4113_1496; phage(gi157165989) 8e-15 Click
283479325..3479465 PHAGE_Entero_4795: putative excisionase; ECH7EC4113_1497; phage(gi157165987) 8e-23 Click
293479499..3480785 PHAGE_Entero_4795: putative integrase; ECH7EC4113_1498; phage(gi157165986) 0.0 Click
303495018..3495029 attR    AAATCAGATATG 0.0 Click

Region 12, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13828546..3828557 attL    AAACGCATCTGT 0.0 Click
2complement(3839899..3840246) PHAGE_Stx2_c_1717: transposase; ECH7EC4113_6012; phage(gi209447152) 2e-62 Click
3complement(3840699..3840929) PHAGE_Entero_2008: putative endolysin; ECH7EC4113_6013; phage(gi209427769) 4e-35 Click
4complement(3840980..3841324) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF47; ECH7EC4113_6014; phage(gi157166032) 3e-60 Click
5complement(3841329..3841544) PHAGE_Stx2_c_1717: holin protein S-like protein; ECH7EC4113_6015; phage(gi209447171) 7e-35 Click
6complement(3841694..3843547) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp44; ECH7EC4113_6016; phage(gi209447169) 0.0 Click
7complement(3843955..3844122) PHAGE_Entero_P1: TciB; ECH7EC4113_6017; phage(gi46401695) 1e-06 Click
8complement(3844208..3844924) conserved hypothetical protein; ECH7EC4113_6018 0.0 Click
9complement(3845017..3845133) hypothetical protein; ECH7EC4113_6019 0.0 Click
10complement(3845204..3845827) PHAGE_Entero_mEpX1: late gene regulator Q; ECH7EC4113_6020; phage(gi428781929) 7e-116 Click
11complement(3845824..3846489) PHAGE_Stx2_c_1717: NinI protein; ECH7EC4113_6021; phage(gi209447164) 3e-130 Click
12complement(3846486..3847097) PHAGE_Stx2_c_1717: NinG protein; ECH7EC4113_6022; phage(gi209447163) 5e-101 Click
133848004..3848759 PROPHAGE_Escher_MG1655: IS30 transposase; ECH7EC4113_6023; phage(gi16132105) 2e-141 Click
143848819..3849097 conserved hypothetical protein; ECH7EC4113_6024 0.0 Click
15complement(3849173..3850237) PHAGE_Cafete_BV_PW1: hypothetical protein; ECH7EC4113_6025; phage(gi310831380) 4e-15 Click
16complement(3850777..3851247) conserved hypothetical protein; ECH7EC4113_6026 0.0 Click
17complement(3851288..3851509) conserved hypothetical protein; ECH7EC4113_6027 0.0 Click
18complement(3851687..3853318) conserved DNA-binding protein; ECH7EC4113_6028 0.0 Click
19complement(3853315..3854628) site-specific recombinase, phage integrase family protein; ECH7EC4113_6029 0.0 Click
203863930..3863941 attR    AAACGCATCTGT 0.0 Click

Region 13, total : 34 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14073383..4073580 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp55; ECH7EC4113_0457; phage(gi148609437) 8e-09 Click
24073731..4074789 PHAGE_Entero_cdtI: putative DNA methylase; ECH7EC4113_0458; phage(gi148609438) 4e-175 Click
34074831..4074905 tRNA 0.0 Click
44075384..4077330 PHAGE_Stx1_converting: hypothetical protein Stx1_gp75; ECH7EC4113_0460; phage(gi302861197) 0.0 Click
54077327..4077452 PHAGE_Escher_TL_2011c: hypothetical protein; ECH7EC4113_0461; phage(gi418487096) 7e-19 Click
64077465..4077644 PHAGE_Escher_P13374: hypothetical protein; ECH7EC4113_0462; phage(gi410491643) 2e-28 Click
74077685..4077930 PHAGE_Escher_P13374: hypothetical protein; ECH7EC4113_0463; phage(gi410491644) 6e-39 Click
84078008..4078223 PHAGE_Escher_P13374: lysis protein, holin; ECH7EC4113_0464; phage(gi410491645) 2e-35 Click
94078227..4078784 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp05; ECH7EC4113_0465; phage(gi116221997) 1e-49 Click
104078821..4079354 PHAGE_Escher_TL_2011c: lysozyme; ECH7EC4113_0466; phage(gi418487070) 3e-101 Click
114079653..4080120 PHAGE_Entero_4795: putative endopeptidase Rz; ECH7EC4113_0467; phage(gi157166036) 3e-78 Click
124080533..4081009 PHAGE_Entero_mEp460: terminase small subunit; ECH7EC4113_0468; phage(gi428782317) 2e-46 Click
134081006..4083129 PHAGE_Entero_cdtI: putative large terminase subunit; ECH7EC4113_0469; phage(gi148609384) 0.0 Click
144083126..4083338 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp03; ECH7EC4113_0470; phage(gi148609385) 2e-24 Click
154083338..4084840 PHAGE_Entero_cdtI: putative portal protein; ECH7EC4113_0471; phage(gi148609386) 0.0 Click
164084854..4086809 PHAGE_Entero_cdtI: putative protease/scaffold protein; ECH7EC4113_0472; phage(gi148609387) 0.0 Click
174086897..4087223 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp06; ECH7EC4113_0473; phage(gi148609388) 2e-22 Click
184087249..4087497 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp07; ECH7EC4113_0474; phage(gi148609389) 7e-13 Click
194087500..4088123 PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4113_0475; phage(gi15832208) 3e-111 Click
204088136..4088534 PROPHAGE_Escher_Sakai: putative minor tail protein U; ECH7EC4113_0476; phage(gi15832207) 1e-72 Click
214088542..4089294 PHAGE_Entero_HK630: major tail protein V; ECH7EC4113_0477; phage(gi428782800) 1e-112 Click
224089308..4089730 PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4113_0478; phage(gi15832205) 1e-74 Click
234089781..4090065 PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4113_0479; phage(gi15832204) 4e-52 Click
244090109..4092754 PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; ECH7EC4113_0480; phage(gi15832203) 0.0 Click
254092751..4093080 PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4113_0481; phage(gi15832202) 3e-60 Click
264093080..4093778 PHAGE_Entero_4795: putative tail fiber component; ECH7EC4113_0482; phage(gi157166054) 8e-132 Click
274093897..4094532 PHAGE_Entero_cdtI: putative tail protein; ECH7EC4113_0483; phage(gi148609398) 1e-112 Click
284094529..4095107 PHAGE_Stx2_c_1717: putative tail component; ECH7EC4113_0484; phage(gi209447195) 2e-102 Click
294095153..4095272 hypothetical protein; ECH7EC4113_0485 0.0 Click
304095348..4098824 PHAGE_Entero_cdtI: putative tail tip assembly protein; ECH7EC4113_0486; phage(gi148609400) 0.0 Click
314098892..4099491 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; ECH7EC4113_0487; phage(gi148609401) 2e-108 Click
324099556..4100869 PHAGE_Entero_cdtI: putative tail fiber protein; ECH7EC4113_0488; phage(gi148609402) 0.0 Click
334100871..4101140 PHAGE_Stx2_c_II: putative tail fiber protein; ECH7EC4113_0489; phage(gi302393091) 9e-43 Click
344101702..4102097 PROPHAGE_Escher_MG1655: IS1 transposase B; ECH7EC4113_0491; phage(gi16131317) 1e-66 Click
354102273..4102863 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp23; ECH7EC4113_0492; phage(gi148609405) 4e-09 Click

Region 14, total : 86 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4188811..4189158) PHAGE_Stx2_c_1717: transposase; ECH7EC4113_3638; phage(gi209447152) 2e-62 Click
2complement(4189611..4189886) conserved hypothetical protein; ECH7EC4113_3639 0.0 Click
3complement(4190468..4190629) conserved hypothetical protein; ECH7EC4113_3640 0.0 Click
44190637..4190843 PHAGE_Entero_2008: lysis protein; ECH7EC4113_3641; phage(gi209427767) 3e-31 Click
5complement(4191099..4191413) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp06; ECH7EC4113_3642; phage(gi116221998) 4e-18 Click
64191531..4192064 PHAGE_Entero_2008: putative endolysin; ECH7EC4113_3643; phage(gi209427769) 2e-99 Click
74192285..4192398 hypothetical protein; ECH7EC4113_3644 0.0 Click
84192400..4192867 PHAGE_Entero_2008: putative endopeptidase; ECH7EC4113_3645; phage(gi209427771) 1e-71 Click
94192950..4193090 conserved hypothetical protein; ECH7EC4113_3646 0.0 Click
104193197..4193210 attL    AGGTGATTATTTTT 0.0 Click
11complement(4194738..4195064) PHAGE_Stx2_c_II: putative transposase; ECH7EC4113_3649; phage(gi302393161) 1e-58 Click
12complement(4195240..4197090) PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECH7EC4113_3650; phage(gi209427766) 0.0 Click
13complement(4197579..4197657) tRNA 0.0 Click
14complement(4197669..4197747) tRNA 0.0 Click
15complement(4197754..4197829) tRNA 0.0 Click
16complement(4197858..4198445) putative envelope protein encoded within prophage CP-933N; ECH7EC4113_3654 0.0 Click
174198462..4198602 hypothetical protein; ECH7EC4113_3655 0.0 Click
18complement(4199192..4200010) CAAX amino terminal protease family; ECH7EC4113_3657 0.0 Click
19complement(4200162..4200533) PHAGE_Entero_2008: antitermination protein Q; ECH7EC4113_3658; phage(gi209427762) 4e-54 Click
20complement(4200523..4200894) PHAGE_Escher_HK75: RusA-like protein; ECH7EC4113_3659; phage(gi356870726) 1e-36 Click
21complement(4200907..4201956) PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4113_3660; phage(gi428782365) 8e-112 Click
224203164..4203937 conserved hypothetical protein; ECH7EC4113_3662 0.0 Click
23complement(4204289..4204702) conserved hypothetical protein; ECH7EC4113_3663 0.0 Click
24complement(4204718..4205488) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp38; ECH7EC4113_3664; phage(gi116222030) 1e-05 Click
25complement(4205510..4206256) PHAGE_Gifsy_2: bacteriophage DNA replication protein; ECH7EC4113_3665; phage(gi169257280) 8e-75 Click
26complement(4206263..4207471) PHAGE_Entero_phiP27: hypothetical protein P27p17; ECH7EC4113_3666; phage(gi18249881) 1e-29 Click
27complement(4207578..4208135) conserved hypothetical protein; ECH7EC4113_3667 0.0 Click
28complement(4208101..4208499) PHAGE_Pectob_ZF40: putative cII repressor; ECH7EC4113_3668; phage(gi422936652) 1e-05 Click
29complement(4208510..4208638) PHAGE_Salmon_SPN3UB: putative Cro; ECH7EC4113_3669; phage(gi423262425) 7e-07 Click
304209044..4209292 conserved hypothetical protein; ECH7EC4113_3670 0.0 Click
314209320..4209511 conserved hypothetical protein; ECH7EC4113_3671 0.0 Click
324210233..4210361 conserved hypothetical protein; ECH7EC4113_3673 0.0 Click
334210373..4210762 PHAGE_Escher_TL_2011c: hypothetical protein; ECH7EC4113_3674; phage(gi418487085) 3e-07 Click
34complement(4210949..4211134) conserved hypothetical protein; ECH7EC4113_3675 0.0 Click
354211708..4211896 DicB protein; ECH7EC4113_3676 0.0 Click
364211893..4212084 conserved hypothetical protein; ECH7EC4113_3677 0.0 Click
374212178..4214649 PHAGE_Salmon_ST64B: Endodeoxyribonuclease; ECH7EC4113_3678; phage(gi23505474) 1e-55 Click
384216351..4217010 PHAGE_Camelp_virus: CMLV006; ECH7EC4113_3681; phage(gi18640240) 3e-12 Click
394217101..4217430 sulfurtransferase tusE; ECH7EC4113_3683 0.0 Click
40complement(4217427..4217705) acylphosphatase; ECH7EC4113_3682 0.0 Click
414217800..4218990 conserved hypothetical protein; ECH7EC4113_3684 0.0 Click
424219048..4219365 hemimethylated DNA-binding protein; ECH7EC4113_3685 0.0 Click
43complement(4219410..4219823) putative CoA-binding protein; ECH7EC4113_3686 0.0 Click
444219786..4219956 hypothetical protein; ECH7EC4113_3687 0.0 Click
454219996..4220658 conserved hypothetical protein; ECH7EC4113_3688 0.0 Click
464220754..4221212 methylglyoxal synthase; ECH7EC4113_3689 0.0 Click
47complement(4221244..4223298) PHAGE_Bacill_36: PcrA helicase; ECH7EC4113_3690; phage(gi156564011) 8e-24 Click
484223421..4223867 putative membrane protein; ECH7EC4113_3691 0.0 Click
49complement(4225995..4226624) TfoX family protein; ECH7EC4113_3693 0.0 Click
504226843..4227352 cell division inhibitor SulA; ECH7EC4113_3695 0.0 Click
51complement(4229646..4231583) PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECH7EC4113_3471; phage(gi209427776) 0.0 Click
52complement(4231647..4233308) PHAGE_Entero_2008: putative phage terminase-like protein large subunit; ECH7EC4113_3472; phage(gi209427775) 0.0 Click
53complement(4233305..4233868) PHAGE_Entero_2008: putative phage terminase; ECH7EC4113_3473; phage(gi209427774) 1e-95 Click
54complement(4234158..4234361) PHAGE_Entero_2008: putative DNAse; ECH7EC4113_3474; phage(gi209427773) 3e-34 Click
554234625..4234750 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECH7EC4113_3475; phage(gi209427772) 7e-08 Click
56complement(4234880..4235020) conserved hypothetical protein; ECH7EC4113_3476 0.0 Click
57complement(4235107..4235229) hypothetical protein; ECH7EC4113_3477 0.0 Click
584235360..4235473 hypothetical protein; ECH7EC4113_3478 0.0 Click
59complement(4235625..4236092) PHAGE_Entero_2008: putative endopeptidase; ECH7EC4113_3479; phage(gi209427771) 5e-63 Click
60complement(4236100..4236246) PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; ECH7EC4113_3480; phage(gi302861202) 2e-20 Click
61complement(4236246..4236815) PHAGE_Entero_2008: putative antirepressor; ECH7EC4113_3481; phage(gi209427770) 7e-107 Click
62complement(4237086..4237619) PHAGE_Entero_2008: putative endolysin; ECH7EC4113_3482; phage(gi209427769) 4e-103 Click
63complement(4237670..4238014) PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECH7EC4113_3483; phage(gi209427768) 1e-59 Click
64complement(4238019..4238234) PHAGE_Stx2_c_1717: holin protein S-like protein; ECH7EC4113_3484; phage(gi209447171) 1e-34 Click
65complement(4238310..4238579) PHAGE_Escher_P13374: hypothetical protein; ECH7EC4113_3485; phage(gi410491644) 1e-26 Click
66complement(4238617..4238799) PHAGE_Escher_P13374: hypothetical protein; ECH7EC4113_3486; phage(gi410491643) 3e-18 Click
67complement(4238947..4240239) PHAGE_Stx1_converting: hypothetical protein Stx1_gp75; ECH7EC4113_3487; phage(gi302861197) 1e-179 Click
68complement(4240220..4240477) PHAGE_Escher_HK75: RusA-like protein; ECH7EC4113_3488; phage(gi356870726) 4e-21 Click
69complement(4240490..4241539) PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4113_3489; phage(gi428782365) 2e-109 Click
70complement(4242388..4242537) conserved hypothetical protein; ECH7EC4113_3491 0.0 Click
71complement(4242608..4243195) PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4113_3492; phage(gi428782343) 7e-40 Click
72complement(4243198..4243389) PHAGE_Salmon_ST160: hypothetical protein; ECH7EC4113_3493; phage(gi318065908) 5e-27 Click
73complement(4243391..4243828) PHAGE_Entero_2008: hypothetical protein YYZ_gp09; ECH7EC4113_3494; phage(gi209427735) 1e-08 Click
74complement(4243815..4243937) PHAGE_Salmon_E1: hypothetical protein VIP0051; ECH7EC4113_3495; phage(gi170676326) 1e-05 Click
754244122..4244304 hypothetical protein; ECH7EC4113_3496 0.0 Click
76complement(4244393..4244689) PHAGE_Klebsi_phiKO2: Gp58; ECH7EC4113_3497; phage(gi46402144) 5e-27 Click
77complement(4244692..4244946) conserved hypothetical protein; ECH7EC4113_3498 0.0 Click
78complement(4245006..4245722) conserved hypothetical protein; ECH7EC4113_3499 0.0 Click
79complement(4245756..4246178) PHAGE_Escher_HK639: replication protein 14; ECH7EC4113_3500; phage(gi356870655) 8e-32 Click
80complement(4246210..4247247) PHAGE_Escher_TL_2011b: hypothetical protein; ECH7EC4113_3501; phage(gi418487646) 4e-48 Click
81complement(4247316..4247741) PHAGE_Pectob_ZF40: putative cII repressor; ECH7EC4113_3502; phage(gi422936652) 2e-05 Click
824248173..4248649 Rac prophage repressor; ECH7EC4113_3503 0.0 Click
834248887..4249117 PHAGE_Salico_CGphi29: hypothetical protein; ECH7EC4113_3504; phage(gi472340166) 1e-09 Click
84complement(4249232..4249747) PHAGE_Entero_HK630: HkaP protein; ECH7EC4113_3505; phage(gi428782827) 2e-12 Click
854249925..4250269 PHAGE_Entero_mEp460: putative exonuclease; ECH7EC4113_3506; phage(gi428782342) 5e-34 Click
864250331..4250600 putative excisionase; ECH7EC4113_3507 0.0 Click
874250569..4251687 PHAGE_Entero_mEp235: integrase; ECH7EC4113_3508; phage(gi428781836) 3e-52 Click
884251854..4252648 spermidine/putrescine ABC transporter, permease protein PotC; ECH7EC4113_3509 0.0 Click
894252645..4253691 spermidine/putrescine ABC transporter, periplasmic spermidine/putrescine-binding protein; ECH7EC4113_3510 0.0 Click
90complement(4253847..4254668) PHAGE_Cronob_vB_CsaM_GAP32: putative Sir2-like protein; ECH7EC4113_3511; phage(gi414087036) 4e-19 Click
914265302..4265315 attR    AGGTGATTATTTTT 0.0 Click

Region 15, total : 48 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14407783..4407794 attL    AGCGTCTCCTGA 0.0 Click
24414777..4415310 PHAGE_Entero_2008: putative endolysin; ECH7EC4113_5840; phage(gi209427769) 3e-104 Click
34415581..4416150 PHAGE_Entero_2008: putative antirepressor; ECH7EC4113_5841; phage(gi209427770) 7e-107 Click
44416150..4416266 PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; ECH7EC4113_5842; phage(gi302861202) 3e-15 Click
54416304..4416771 PHAGE_Entero_2008: putative endopeptidase; ECH7EC4113_5843; phage(gi209427771) 1e-82 Click
6complement(4417134..4417301) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECH7EC4113_5844; phage(gi209427772) 7e-26 Click
74417403..4417768 PHAGE_Entero_2008: putative DNAse; ECH7EC4113_5845; phage(gi209427773) 3e-58 Click
84418058..4418621 PHAGE_Entero_2008: putative phage terminase; ECH7EC4113_5846; phage(gi209427774) 1e-95 Click
94418618..4420279 PHAGE_Entero_2008: putative phage terminase-like protein large subunit; ECH7EC4113_5847; phage(gi209427775) 0.0 Click
104420343..4422280 PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECH7EC4113_5848; phage(gi209427776) 0.0 Click
114422492..4425071 PHAGE_Entero_2008: putative portal protein; ECH7EC4113_5849; phage(gi209427777) 0.0 Click
124425074..4425400 PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ECH7EC4113_5850; phage(gi209427778) 3e-55 Click
134425410..4425760 PHAGE_Entero_2008: putative head-tail adaptor; ECH7EC4113_5851; phage(gi209427779) 8e-62 Click
144425757..4426203 PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ECH7EC4113_5852; phage(gi209427780) 2e-80 Click
154426200..4426544 PHAGE_Entero_2008: putative prophage structural protein; ECH7EC4113_5853; phage(gi209427781) 6e-60 Click
164427341..4427715 PHAGE_Entero_2008: putative tail assembly protein; ECH7EC4113_5855; phage(gi209427783) 4e-67 Click
174427817..4428020 PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECH7EC4113_5856; phage(gi209427784) 6e-33 Click
184428068..4431310 PHAGE_Entero_2008: putative tail protein; ECH7EC4113_5857; phage(gi209427785) 0.0 Click
194431303..4431644 PHAGE_Entero_2008: putative minor tail protein; ECH7EC4113_5858; phage(gi209427786) 4e-64 Click
204431644..4432081 PHAGE_Entero_2008: putative tail protein; ECH7EC4113_5859; phage(gi209427787) 3e-62 Click
214432059..4432202 hypothetical protein; ECH7EC4113_5860 0.0 Click
224435815..4436414 PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECH7EC4113_5863; phage(gi209427792) 6e-114 Click
234436479..4437702 PHAGE_Entero_2008: putative tail protein; ECH7EC4113_5864; phage(gi209427793) 0.0 Click
244437704..4437973 PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ECH7EC4113_5865; phage(gi209427794) 5e-45 Click
254438087..4438662 PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECH7EC4113_5866; phage(gi209427795) 3e-21 Click
264438953..4439099 conserved hypothetical protein; ECH7EC4113_5867 0.0 Click
274439373..4440023 PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECH7EC4113_5868; phage(gi209427795) 3e-21 Click
284440173..4440595 PROPHAGE_Escher_CFT073: transposase; ECH7EC4113_5869; phage(gi26246249) 9e-39 Click
29complement(4440606..4442144) PHAGE_Stx2_c_1717: transposase; ECH7EC4113_5870; phage(gi209447153) 0.0 Click
30complement(4442194..4442541) PHAGE_Stx2_c_1717: transposase; ECH7EC4113_5871; phage(gi209447152) 2e-62 Click
314442962..4443831 PROPHAGE_Escher_CFT073: transposase; ECH7EC4113_5872; phage(gi26246249) 1e-126 Click
32complement(4443881..4444087) PHAGE_Entero_2008: putative DNA damage-inducible protein; ECH7EC4113_5873; phage(gi209427797) 5e-28 Click
334443924..4443935 attR    AGCGTCTCCTGA 0.0 Click
34complement(4444301..4444852) PHAGE_Entero_2008: putative integrase; ECH7EC4113_5874; phage(gi209427727) 2e-61 Click
35complement(4446170..4446358) conserved hypothetical protein; ECH7EC4113_5877 0.0 Click
36complement(4446355..4446543) conserved domain protein; ECH7EC4113_5878 0.0 Click
374447108..4447317 hypothetical protein; ECH7EC4113_5879 0.0 Click
38complement(4447318..4447956) PHAGE_Escher_TL_2011c: hypothetical protein; ECH7EC4113_5880; phage(gi418487085) 6e-09 Click
39complement(4447968..4448201) PHAGE_Salico_CGphi29: hypothetical protein; ECH7EC4113_5881; phage(gi472340166) 5e-09 Click
40complement(4448413..4449012) PHAGE_Pectob_ZF40: putative cI repressor; ECH7EC4113_5882; phage(gi422936650) 2e-17 Click
414449143..4449385 PHAGE_Pectob_ZF40: putative cro anti-repressor; ECH7EC4113_5883; phage(gi422936651) 5e-09 Click
424449396..4449794 conserved hypothetical protein; ECH7EC4113_5884 0.0 Click
434449863..4450906 PHAGE_Escher_TL_2011b: hypothetical protein; ECH7EC4113_5885; phage(gi418487646) 3e-48 Click
444450899..4451360 PHAGE_Escher_HK639: replication protein 14; ECH7EC4113_5886; phage(gi356870655) 5e-29 Click
454451394..4452110 conserved hypothetical protein; ECH7EC4113_5887 0.0 Click
464452170..4452424 conserved hypothetical protein; ECH7EC4113_5888 0.0 Click
474452421..4452648 PHAGE_Salmon_1: hypothetical protein STM0896.1n.Fels1; ECH7EC4113_5889; phage(gi169257161) 2e-16 Click
484452641..4452952 PHAGE_Entero_mEp213: hypothetical protein; ECH7EC4113_5890; phage(gi428782634) 9e-21 Click
494453080..4453298 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip090; ECH7EC4113_5891; phage(gi20065885) 3e-24 Click
504453300..4453857 PHAGE_Escher_TL_2011c: hypothetical protein; ECH7EC4113_5892; phage(gi418487081) 6e-28 Click

Region 16, total : 15 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14549738..4549752 attL    GGCCGTACTGGTTGG 0.0 Click
24558777..4559955 PHAGE_Stx2_c_1717: integrase; ECH7EC4113_4089; phage(gi209447127) 0.0 Click
3complement(4559936..4560127) PHAGE_Entero_mEp234: hypothetical protein; ECH7EC4113_4088; phage(gi428782280) 8e-33 Click
4complement(4560205..4560549) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp03; ECH7EC4113_4090; phage(gi209447128) 2e-61 Click
5complement(4560737..4560997) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp04; ECH7EC4113_4091; phage(gi209447129) 1e-48 Click
6complement(4561952..4562899) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp07; ECH7EC4113_4094; phage(gi209447132) 0.0 Click
7complement(4563216..4563431) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp09; ECH7EC4113_4095; phage(gi209447134) 5e-35 Click
8complement(4563508..4563621) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp10; ECH7EC4113_4096; phage(gi209447135) 5e-14 Click
9complement(4563851..4564240) PHAGE_Stx2_c_1717: exonuclease; ECH7EC4113_4097; phage(gi209447136) 1e-72 Click
104564333..4564659 PHAGE_Stx2_c_1717: putative transposase; ECH7EC4113_4098; phage(gi209447180) 1e-58 Click
114564656..4565546 PROPHAGE_Escher_Sakai: putative transposase; ECH7EC4113_4099; phage(gi15834498) 2e-173 Click
12complement(4565841..4566626) PHAGE_Stx2_c_1717: Bet recombination protein; ECH7EC4113_4100; phage(gi209447137) 1e-150 Click
134566461..4566475 attR    GGCCGTACTGGTTGG 0.0 Click
14complement(4566632..4566928) PHAGE_Stx2_c_1717: Gam; ECH7EC4113_4101; phage(gi209447138) 5e-53 Click
15complement(4567003..4567146) PHAGE_Stx2_c_1717: Kil protein; ECH7EC4113_4102; phage(gi209447139) 2e-20 Click
16complement(4567352..4567720) PHAGE_Stx2_c_1717: putative single-stranded DNA binding protein; ECH7EC4113_4103; phage(gi209447141) 2e-68 Click
17complement(4567903..4568154) PHAGE_Entero_mEp234: hypothetical protein; ECH7EC4113_4104; phage(gi428782288) 2e-44 Click

Region 17, total : 37 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14641218..4641490 PHAGE_Gifsy_2: hypothetical protein STM1021.1n.Gifsy2; ECH7EC4113_0408; phage(gi169257287) 5e-14 Click
24641492..4642541 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4113_0409; phage(gi428782365) 2e-112 Click
34642922..4643476 PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; ECH7EC4113_0411; phage(gi399528832) 9e-07 Click
44643701..4643898 PHAGE_Entero_phiP27: hypothetical protein P27p23; ECH7EC4113_0412; phage(gi18249887) 7e-29 Click
5complement(4644003..4644143) hypothetical protein; ECH7EC4113_0413 0.0 Click
64644160..4644747 putative transcriptional regulator; ECH7EC4113_0414 0.0 Click
74644776..4644851 tRNA 0.0 Click
84644951..4645029 tRNA 0.0 Click
94645198..4645629 PHAGE_Pseudo_AF: putative tellurite resistance protein; ECH7EC4113_0417; phage(gi431810338) 1e-28 Click
104645626..4645793 PHAGE_Entero_P1: TciB; ECH7EC4113_0418; phage(gi46401695) 1e-08 Click
114646107..4647957 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECH7EC4113_0420; phage(gi209427766) 0.0 Click
12complement(4648236..4648397) conserved hypothetical protein; ECH7EC4113_0421 0.0 Click
134648405..4648611 PHAGE_Entero_2008: lysis protein; ECH7EC4113_0422; phage(gi209427767) 6e-33 Click
144648616..4649023 PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECH7EC4113_0423; phage(gi209427768) 9e-54 Click
154648989..4649522 PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECH7EC4113_0424; phage(gi209427776) 1e-92 Click
164649567..4649788 PHAGE_Entero_2008: hypothetical protein YYZ_gp53; ECH7EC4113_0425; phage(gi209427801) 5e-35 Click
174651829..4652155 PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ECH7EC4113_0428; phage(gi209427778) 6e-54 Click
184652165..4652515 PHAGE_Entero_2008: putative head-tail adaptor; ECH7EC4113_0429; phage(gi209427779) 9e-61 Click
194652512..4652958 PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ECH7EC4113_0430; phage(gi209427780) 2e-80 Click
204652955..4653299 PHAGE_Entero_2008: putative prophage structural protein; ECH7EC4113_0431; phage(gi209427781) 6e-60 Click
214653358..4654074 PHAGE_Entero_2008: putative tail protein; ECH7EC4113_0432; phage(gi209427782) 5e-122 Click
224654080..4654454 PHAGE_Entero_2008: putative tail assembly protein; ECH7EC4113_0433; phage(gi209427783) 2e-65 Click
234654556..4654759 PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECH7EC4113_0434; phage(gi209427784) 3e-32 Click
244654811..4658053 PHAGE_Entero_2008: putative tail protein; ECH7EC4113_0435; phage(gi209427785) 0.0 Click
25complement(4656209..4656370) hypothetical protein; ECH7EC4113_5579 0.0 Click
264658046..4658387 PHAGE_Entero_2008: putative minor tail protein; ECH7EC4113_0436; phage(gi209427786) 4e-64 Click
274658387..4659085 PHAGE_Entero_2008: putative tail protein; ECH7EC4113_0437; phage(gi209427787) 4e-126 Click
284659096..4659839 PHAGE_Entero_2008: putative tail component K-like protein; ECH7EC4113_0438; phage(gi209427789) 3e-138 Click
294659836..4660417 PHAGE_Entero_2008: putative tail assembly protein; ECH7EC4113_0439; phage(gi209427790) 2e-101 Click
304660759..4662327 PHAGE_Entero_2008: phage-related tail protein; ECH7EC4113_0440; phage(gi209427791) 0.0 Click
314664899..4665498 PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECH7EC4113_0442; phage(gi209427792) 2e-114 Click
324666878..4667147 PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ECH7EC4113_0445; phage(gi209427794) 5e-46 Click
334667501..4667836 PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECH7EC4113_0446; phage(gi209427795) 2e-19 Click
344668137..4668538 PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECH7EC4113_0447; phage(gi209427795) 6e-71 Click
354668767..4669261 PHAGE_Entero_2008: hypothetical protein YYZ_gp73; ECH7EC4113_0448; phage(gi209427796) 3e-89 Click
36complement(4669423..4669629) PHAGE_Entero_2008: putative DNA damage-inducible protein; ECH7EC4113_0449; phage(gi209427797) 5e-28 Click
374669797..4671080 PHAGE_Burkho_phi1026b: gp59; ECH7EC4113_0450; phage(gi38707949) 2e-33 Click
384671169..4672629 PHAGE_Microm_MpV1: hypothetical protein; ECH7EC4113_0451; phage(gi313768442) 4e-41 Click
39complement(4672665..4672868) PHAGE_Salmon_SSU5: putative selenium-binding protein YdfZ; ECH7EC4113_0452; phage(gi410491512) 1e-13 Click

Region 18, total : 29 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4787472..4788362) PROPHAGE_Escher_Sakai: putative transposase; ECH7EC4113_0071; phage(gi15834498) 2e-173 Click
2complement(4788359..4788685) PHAGE_Stx2_c_II: putative transposase; ECH7EC4113_0072; phage(gi302393161) 1e-58 Click
34789005..4789211 PHAGE_Stx2_c_1717: holin protein S-like protein; ECH7EC4113_0073; phage(gi209447171) 1e-32 Click
44789216..4789560 PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECH7EC4113_0074; phage(gi209427768) 6e-60 Click
54789611..4790144 PHAGE_Entero_4795: putative R protein; ECH7EC4113_0075; phage(gi157166033) 9e-100 Click
64790336..4790482 conserved hypothetical protein; ECH7EC4113_0076 0.0 Click
74790634..4791101 PHAGE_Entero_4795: putative endopeptidase Rz; ECH7EC4113_0077; phage(gi157166036) 6e-69 Click
84791184..4791324 conserved hypothetical protein; ECH7EC4113_0078 0.0 Click
9complement(4791450..4791563) conserved hypothetical protein; ECH7EC4113_0079 0.0 Click
10complement(4791962..4792126) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECH7EC4113_0080; phage(gi209427772) 1e-08 Click
114792581..4793090 PHAGE_Entero_HK630: terminase small subunit nu1; ECH7EC4113_0081; phage(gi428782788) 8e-18 Click
124794975..4795181 PHAGE_Entero_HK630: head-tail connector W; ECH7EC4113_0084; phage(gi428782790) 1e-11 Click
134795178..4796770 PHAGE_Entero_HK630: portal protein B; ECH7EC4113_0085; phage(gi428782791) 0.0 Click
144798301..4798648 PHAGE_Entero_HK630: head decoration protein D; ECH7EC4113_0088; phage(gi428782794) 6e-25 Click
154798706..4798972 PHAGE_Entero_HK630: major head subunit E; ECH7EC4113_0089; phage(gi428782795) 2e-20 Click
164799032..4799694 PHAGE_Entero_HK630: major tail protein V; ECH7EC4113_0090; phage(gi428782800) 5e-97 Click
174799708..4800094 PHAGE_Entero_HK630: minor tail protein G; ECH7EC4113_0091; phage(gi428782801) 2e-44 Click
184803125..4803454 PHAGE_Entero_HK630: minor tail protein M; ECH7EC4113_0094; phage(gi428782804) 4e-45 Click
194803454..4804152 PHAGE_Entero_HK630: minor tail protein L; ECH7EC4113_0095; phage(gi428782805) 1e-105 Click
204806041..4806349 PHAGE_Entero_HK630: tail assembly protein GT; ECH7EC4113_4510; phage(gi428782802) 1e-35 Click
214806393..4809038 PHAGE_Entero_HK630: tail length tape measure protein H; ECH7EC4113_4511; phage(gi428782803) 0.0 Click
224809035..4809364 PHAGE_Entero_HK630: minor tail protein M; ECH7EC4113_4512; phage(gi428782804) 5e-46 Click
234809364..4810062 PHAGE_Entero_HK630: minor tail protein L; ECH7EC4113_4513; phage(gi428782805) 1e-105 Click
244810813..4811391 PHAGE_Entero_4795: putative tail component; ECH7EC4113_4515; phage(gi157166056) 3e-103 Click
254811437..4811556 hypothetical protein; ECH7EC4113_4516 0.0 Click
264811632..4814487 PHAGE_Stx2_c_1717: putative tail fiber component J; ECH7EC4113_4517; phage(gi209447196) 0.0 Click
274814555..4815154 PHAGE_Stx2_c_1717: outer membrane protein Lom precursor; ECH7EC4113_4518; phage(gi209447197) 2e-96 Click
284815306..4816610 PHAGE_Stx2_c_1717: putative tail fiber protein; ECH7EC4113_4519; phage(gi209447198) 0.0 Click
294816612..4816881 PHAGE_Stx2_c_II: putative tail fiber protein; ECH7EC4113_4520; phage(gi302393091) 1e-41 Click

Region 19, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15160408..5162375 PHAGE_Melano_entomopoxvirus: ORF MSV156 hypothetical protein; ECH7EC4113_5786; phage(gi9631364) 7e-09 Click
25162493..5162654 hypothetical protein; ECH7EC4113_5787 0.0 Click
3complement(5162693..5163727) PHAGE_Yersin_413C: gpQ; ECH7EC4113_5788; phage(gi30065705) 0.0 Click
4complement(5163727..5165499) PHAGE_Yersin_413C: gpP; ECH7EC4113_5789; phage(gi30065706) 0.0 Click
55165673..5166527 PHAGE_Yersin_413C: gpO; ECH7EC4113_5790; phage(gi30065707) 3e-160 Click
65166586..5167659 PHAGE_Yersin_413C: gpN; ECH7EC4113_5791; phage(gi30065708) 0.0 Click
75167663..5168406 PHAGE_Yersin_413C: gpM; ECH7EC4113_5792; phage(gi30065709) 7e-135 Click
85168542..5169015 PHAGE_Yersin_413C: gpL; ECH7EC4113_5793; phage(gi30065710) 5e-85 Click
95169015..5169218 PHAGE_Yersin_413C: gpX; ECH7EC4113_5794; phage(gi30065711) 2e-32 Click
105169222..5169503 PHAGE_Yersin_413C: gpY; ECH7EC4113_5795; phage(gi30065712) 3e-46 Click
115169503..5170000 PHAGE_Yersin_413C: gpK; ECH7EC4113_5796; phage(gi30065713) 3e-94 Click
125170015..5170440 PHAGE_Yersin_413C: LysA; ECH7EC4113_5797; phage(gi30065714) 4e-68 Click
135170428..5170853 PHAGE_Yersin_413C: LysB; ECH7EC4113_5798; phage(gi30065715) 1e-68 Click
145170840..5170998 PHAGE_Erwini_ENT90: putative host lysis-related protein; ECH7EC4113_5799; phage(gi431810968) 2e-10 Click
155170961..5171428 PHAGE_Yersin_413C: gpR; ECH7EC4113_5800; phage(gi30065716) 2e-83 Click
165171421..5171873 PHAGE_Yersin_413C: gpS; ECH7EC4113_5801; phage(gi30065717) 1e-77 Click
175171940..5172575 PHAGE_Yersin_413C: gpV; ECH7EC4113_5802; phage(gi30065718) 4e-117 Click
185172572..5172919 PHAGE_Yersin_413C: gpW; ECH7EC4113_5803; phage(gi30065719) 2e-59 Click
195172924..5173832 PHAGE_Yersin_413C: gpJ; ECH7EC4113_5804; phage(gi30065720) 3e-166 Click
205173825..5174436 PHAGE_Yersin_413C: gpI; ECH7EC4113_5805; phage(gi30065721) 3e-82 Click
215174433..5175632 PHAGE_Erwini_ENT90: phage tail collar domain protein; ECH7EC4113_5806; phage(gi431810938) 1e-122 Click

Region 20, total : 51 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15214430..5214636 PHAGE_Entero_HK630: head-tail connector W; ECH7EC4113_0839; phage(gi428782790) 1e-31 Click
25216216..5217535 PHAGE_Entero_HK630: head maturation protease C; ECH7EC4113_0842; phage(gi428782792) 0.0 Click
35217545..5217877 PHAGE_Entero_HK630: head decoration protein D; ECH7EC4113_0843; phage(gi428782794) 7e-58 Click
45218996..5219394 PHAGE_Entero_HK225: head assembly protein Fi; ECH7EC4113_0845; phage(gi428782384) 7e-21 Click
55219406..5219759 PHAGE_Entero_HK630: head-tail connector Fii; ECH7EC4113_0846; phage(gi428782797) 2e-58 Click
65219774..5220307 PHAGE_Entero_HK630: minor tail protein Z; ECH7EC4113_0847; phage(gi428782798) 2e-65 Click
75220304..5220699 PHAGE_Entero_HK630: minor tail protein U; ECH7EC4113_0848; phage(gi428782799) 6e-59 Click
85220707..5221459 PHAGE_Entero_HK630: major tail protein V; ECH7EC4113_0849; phage(gi428782800) 1e-112 Click
95221922..5222230 PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4113_0851; phage(gi15832204) 2e-56 Click
105224911..5225240 PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4113_0854; phage(gi15832202) 3e-60 Click
11complement(5226153..5227019) spermidine synthase; ECH7EC4113_2741 0.0 Click
12complement(5227125..5227472) conserved hypothetical protein; ECH7EC4113_2742 0.0 Click
135227638..5229188 copper oxidase CueO; ECH7EC4113_2743 0.0 Click
14complement(5229229..5229366) enterobactin synthetase component D; ECH7EC4113_2744 0.0 Click
155231984..5232520 hypoxanthine phosphoribosyltransferase; ECH7EC4113_2746 0.0 Click
16complement(5232561..5233223) carbonic anhydrase; ECH7EC4113_2747 0.0 Click
175233332..5234258 PHAGE_Plankt_PaV_LD: ABC transporter; ECH7EC4113_2748; phage(gi371496158) 2e-19 Click
185234255..5235025 ABC transporter, permease protein; ECH7EC4113_2749 0.0 Click
195235130..5235570 PTS system IIA component domain protein; ECH7EC4113_2750 0.0 Click
205235634..5236863 polysaccharide deacetylase domain protein; ECH7EC4113_2751 0.0 Click
21complement(5236867..5237247) aspartate 1-decarboxylase; ECH7EC4113_2752 0.0 Click
225237215..5237409 hypothetical protein; ECH7EC4113_2753 0.0 Click
235237521..5238417 PROPHAGE_Escher_MG1655: predicted transposase; ECH7EC4113_2754; phage(gi16131287) 3e-76 Click
24complement(5238716..5239567) pantoate--beta-alanine ligase; ECH7EC4113_2755 0.0 Click
25complement(5239579..5240373) PHAGE_Ostreo_OlV5: 3-methyl-2-oxobutanoate hydroxymethyltransferase; ECH7EC4113_2756; phage(gi472341345) 3e-45 Click
26complement(5241544..5242239) aquaporin Z; ECH7EC4113_0706 0.0 Click
275242665..5244323 PHAGE_Entero_P2: Old; ECH7EC4113_0708; phage(gi9630369) 6e-06 Click
28complement(5244320..5245312) conserved hypothetical protein; ECH7EC4113_0707 0.0 Click
295245427..5246542 macrolide-specific efflux protein MacA; ECH7EC4113_0709 0.0 Click
305246539..5248485 PHAGE_Plankt_PaV_LD: ABC transporter; ECH7EC4113_0710; phage(gi371496158) 4e-40 Click
31complement(5248558..5248782) PHAGE_Lactoc_bIL312: Csp; ECH7EC4113_0711; phage(gi13095918) 3e-14 Click
325249105..5249425 PHAGE_Cronob_vB_CsaM_GAP32: ATP-dependent Clp protease; ECH7EC4113_0712; phage(gi414087232) 2e-05 Click
335249456..5251732 PROPHAGE_Escher_EDL933: ATP-dependent Clp protease ATP-binding subunit; ECH7EC4113_0713; phage(gi15800640) 0.0 Click
34complement(5252077..5252166) tRNA 0.0 Click
35complement(5252419..5252637) translation initiation factor IF-1; ECH7EC4113_0715 0.0 Click
36complement(5256126..5256506) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp19; ECH7EC4113_5141; phage(gi209447144) 8e-67 Click
37complement(5256870..5257004) hypothetical protein; ECH7EC4113_5142 0.0 Click
38complement(5257149..5257844) PHAGE_Stx2_c_1717: repressor; ECH7EC4113_5143; phage(gi209447145) 2e-126 Click
395258457..5258573 PHAGE_Stx2_c_1717: CII protein; ECH7EC4113_5144; phage(gi209447147) 4e-15 Click
405258606..5258767 PHAGE_Escher_HK75: hypothetical protein; ECH7EC4113_5145; phage(gi356870717) 2e-24 Click
415258754..5259575 PHAGE_Stx2_c_1717: bacteriophage DNA replication protein O; ECH7EC4113_5146; phage(gi209447149) 4e-156 Click
425259572..5260948 PHAGE_Stx2_c_1717: DnaB helicase; ECH7EC4113_5147; phage(gi209447150) 0.0 Click
435261019..5261297 PHAGE_Entero_2008: hypothetical protein YYZ_gp30; ECH7EC4113_5148; phage(gi209427755) 2e-51 Click
445261530..5261892 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp32; ECH7EC4113_5149; phage(gi209447157) 2e-67 Click
455261747..5262295 PHAGE_Stx2_c_1717: NinB protein; ECH7EC4113_5150; phage(gi209447158) 4e-105 Click
465262292..5262819 PHAGE_Stx2_c_1717: putative DNA N-6-adenine-methyltransferase of bacteriophage; ECH7EC4113_5151; phage(gi209447159) 1e-101 Click
475263273..5264031 PHAGE_Stx2_c_1717: putative Ant antirepressor protein; ECH7EC4113_5152; phage(gi209447161) 2e-78 Click
485264287..5264967 PHAGE_Stx2_c_1717: putative Ant antirepressor protein; ECH7EC4113_5154; phage(gi209447161) 5e-102 Click
495265042..5265764 PHAGE_Stx2_c_1717: putative DNA-binding protein Roi of bacteriophage; ECH7EC4113_5155; phage(gi209447162) 4e-132 Click
505265764..5266369 PHAGE_Stx2_c_1717: NinG protein; ECH7EC4113_5156; phage(gi209447163) 2e-118 Click
515266366..5267037 PHAGE_Stx2_c_1717: NinI protein; ECH7EC4113_5157; phage(gi209447164) 1e-132 Click
525267028..5267516 PHAGE_Stx2_c_1717: antiterminator Q protein; ECH7EC4113_5158; phage(gi209447165) 5e-91 Click