Escherichia coli O157:H7 str. EC4206 , whole [asmbl_id: NC_000000].5629932, GC%: 50.47%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 49 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(179..505) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp61; ECH7EC4206_A1136; phage(gi209447184) 8e-54 Click
2complement(585..3086) PHAGE_Stx2_c_1717: putative phage portal protein; ECH7EC4206_A1137; phage(gi209447182) 0.0 Click
3complement(3298..5235) PHAGE_Stx2_c_1717: phage head maturation protease; ECH7EC4206_A1138; phage(gi209447181) 0.0 Click
45250..5262 attL    AATAAAAAAACCG 0.0 Click
5complement(5299..6960) PHAGE_Entero_4795: putative large subunit terminase; ECH7EC4206_A1139; phage(gi157166040) 0.0 Click
6complement(6957..7520) PHAGE_Stx2_c_1717: phage terminase, small subunit; ECH7EC4206_A1140; phage(gi209447178) 3e-100 Click
7complement(7812..8177) PHAGE_Stx2_c_1717: restriction endonuclease; ECH7EC4206_A1141; phage(gi209447177) 1e-64 Click
88279..8446 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECH7EC4206_A1142; phage(gi209427772) 7e-26 Click
9complement(8909..9091) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp50; ECH7EC4206_A1143; phage(gi209447175) 2e-28 Click
10complement(9163..9660) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp49; ECH7EC4206_A1144; phage(gi209447174) 5e-96 Click
11complement(9863..10300) PHAGE_Stx2_c_1717: putative Rz lysis protein; ECH7EC4206_A1145; phage(gi209447173) 3e-77 Click
12complement(10297..10794) PHAGE_Stx2_c_1717: phage-related lysozyme; ECH7EC4206_A1146; phage(gi209447172) 1e-94 Click
13complement(10794..11009) PHAGE_Stx2_c_1717: holin protein S-like protein; ECH7EC4206_A1147; phage(gi209447171) 3e-35 Click
14complement(11086..11358) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp45; ECH7EC4206_A1148; phage(gi209447170) 1e-43 Click
15complement(11399..11578) PHAGE_Escher_P13374: hypothetical protein; ECH7EC4206_A1149; phage(gi410491643) 2e-28 Click
16complement(11715..13652) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp44; ECH7EC4206_A1150; phage(gi209447169) 0.0 Click
17complement(14516..14785) PHAGE_Stx2_c_1717: verocytotoxin 2 variant 2c subunit B; ECH7EC4206_A1151; phage(gi209447167) 2e-46 Click
18complement(14797..15579) PHAGE_Stx2_c_1717: verocytotoxin 2 variant 2c subunit A; ECH7EC4206_A1152; phage(gi209447166) 5e-146 Click
19complement(15848..15926) tRNA 0.0 Click
20complement(15938..16016) tRNA 0.0 Click
21complement(16017..16092) tRNA 0.0 Click
22complement(16406..16894) PHAGE_Stx2_c_1717: antiterminator Q protein; ECH7EC4206_A1156; phage(gi209447165) 5e-91 Click
23complement(16885..17556) PHAGE_Stx2_c_1717: NinI protein; ECH7EC4206_A1157; phage(gi209447164) 1e-132 Click
24complement(17553..18158) PHAGE_Stx2_c_1717: NinG protein; ECH7EC4206_A1158; phage(gi209447163) 2e-118 Click
25complement(18158..18880) PHAGE_Stx2_c_1717: putative DNA-binding protein Roi of bacteriophage; ECH7EC4206_A1159; phage(gi209447162) 4e-132 Click
26complement(18955..19635) PHAGE_Stx2_c_1717: putative Ant antirepressor protein; ECH7EC4206_A1160; phage(gi209447161) 5e-102 Click
27complement(19891..20649) PHAGE_Stx2_c_1717: putative Ant antirepressor protein; ECH7EC4206_A1161; phage(gi209447161) 2e-78 Click
28complement(21103..21630) PHAGE_Stx2_c_1717: putative DNA N-6-adenine-methyltransferase of bacteriophage; ECH7EC4206_A1162; phage(gi209447159) 1e-101 Click
29complement(21627..22175) PHAGE_Stx2_c_1717: NinB protein; ECH7EC4206_A1163; phage(gi209447158) 4e-105 Click
30complement(22030..22392) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp32; ECH7EC4206_A1164; phage(gi209447157) 2e-67 Click
31complement(22625..22903) PHAGE_Entero_2008: hypothetical protein YYZ_gp30; ECH7EC4206_A1165; phage(gi209427755) 2e-51 Click
32complement(22974..24350) PHAGE_Stx2_c_1717: DnaB helicase; ECH7EC4206_A1166; phage(gi209447150) 0.0 Click
33complement(24347..25168) PHAGE_Stx2_c_1717: bacteriophage DNA replication protein O; ECH7EC4206_A1167; phage(gi209447149) 4e-156 Click
34complement(25155..25316) PHAGE_Escher_HK75: hypothetical protein; ECH7EC4206_A1168; phage(gi356870717) 2e-24 Click
35complement(25349..25645) PHAGE_Stx2_c_1717: CII protein; ECH7EC4206_A1169; phage(gi209447147) 2e-50 Click
3626078..26773 PHAGE_Stx2_c_1717: repressor; ECH7EC4206_A1170; phage(gi209447145) 2e-126 Click
3726918..27052 hypothetical protein; ECH7EC4206_A1171 0.0 Click
3827416..27796 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp19; ECH7EC4206_A1172; phage(gi209447144) 8e-67 Click
3928856..29107 PHAGE_Entero_mEp234: hypothetical protein; ECH7EC4206_A1173; phage(gi428782288) 2e-44 Click
4029290..29658 PHAGE_Stx2_c_1717: putative single-stranded DNA binding protein; ECH7EC4206_A1174; phage(gi209447141) 2e-68 Click
4129864..30007 PHAGE_Stx2_c_1717: Kil protein; ECH7EC4206_A1175; phage(gi209447139) 2e-20 Click
4230082..30378 PHAGE_Stx2_c_1717: Gam; ECH7EC4206_A1176; phage(gi209447138) 5e-53 Click
4330384..31169 PHAGE_Stx2_c_1717: Bet recombination protein; ECH7EC4206_A1177; phage(gi209447137) 1e-150 Click
44complement(31464..32354) PROPHAGE_Escher_Sakai: putative transposase; ECH7EC4206_A1178; phage(gi15834498) 2e-173 Click
45complement(32351..32677) PHAGE_Stx2_c_1717: putative transposase; ECH7EC4206_A1179; phage(gi209447180) 1e-58 Click
4632770..33159 PHAGE_Stx2_c_1717: exonuclease; ECH7EC4206_A1180; phage(gi209447136) 1e-72 Click
4733389..33502 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp10; ECH7EC4206_A1181; phage(gi209447135) 5e-14 Click
4833579..33794 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp09; ECH7EC4206_A1182; phage(gi209447134) 5e-35 Click
4934111..35058 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp07; ECH7EC4206_A1183; phage(gi209447132) 0.0 Click
5035923..36273 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp04; ECH7EC4206_A1186; phage(gi209447129) 1e-67 Click
5136461..36805 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp03; ECH7EC4206_A1187; phage(gi209447128) 2e-61 Click
5236883..37074 PHAGE_Entero_mEp234: hypothetical protein; ECH7EC4206_A1188; phage(gi428782280) 8e-33 Click
53complement(37055..38233) PHAGE_Stx2_c_1717: integrase; ECH7EC4206_A1189; phage(gi209447127) 0.0 Click
5441302..41314 attR    AATAAAAAAACCG 0.0 Click

Region 2, total : 31 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(125886..126140) PHAGE_Yersin_413C: Ogr; ECH7EC4206_A1269; phage(gi30065732) 2e-45 Click
2complement(126186..127349) PHAGE_Yersin_413C: gpD; ECH7EC4206_A1270; phage(gi30065731) 0.0 Click
3complement(127349..127828) PHAGE_Yersin_413C: gpU; ECH7EC4206_A1271; phage(gi30065730) 4e-85 Click
4complement(127843..130290) PHAGE_Yersin_413C: gpT; ECH7EC4206_A1272; phage(gi30065729) 0.0 Click
5complement(130767..131285) PHAGE_Yersin_413C: FII; ECH7EC4206_A1275; phage(gi30065726) 6e-93 Click
6complement(131298..132488) PHAGE_Yersin_413C: gpFI; ECH7EC4206_A1276; phage(gi30065725) 0.0 Click
7complement(132548..133141) PHAGE_Entero_2: DNA-invertase; ECH7EC4206_A1277; phage(gi169936026) 9e-88 Click
8133172..133582 PHAGE_Erwini_ENT90: phage tail collar domain protein; ECH7EC4206_A1278; phage(gi431810938) 1e-13 Click
9133603..134046 PHAGE_Entero_mEp213: tail fiber assembly protein; ECH7EC4206_A1279; phage(gi428782612) 2e-26 Click
10complement(134018..134620) PHAGE_Entero_HK106: tail fiber assembly protein; ECH7EC4206_A1280; phage(gi428783304) 1e-95 Click
11complement(134620..135939) PHAGE_Salmon_RE_2010: tail fiber protein; ECH7EC4206_A1281; phage(gi418489713) 2e-108 Click
12complement(135936..136547) PHAGE_Yersin_413C: gpI; ECH7EC4206_A1282; phage(gi30065721) 3e-82 Click
13complement(136540..137448) PHAGE_Yersin_413C: gpJ; ECH7EC4206_A1283; phage(gi30065720) 3e-166 Click
14complement(137453..137800) PHAGE_Yersin_413C: gpW; ECH7EC4206_A1284; phage(gi30065719) 2e-59 Click
15complement(137797..138432) PHAGE_Yersin_413C: gpV; ECH7EC4206_A1285; phage(gi30065718) 4e-117 Click
16complement(138499..138951) PHAGE_Yersin_413C: gpS; ECH7EC4206_A1286; phage(gi30065717) 1e-77 Click
17complement(138944..139411) PHAGE_Yersin_413C: gpR; ECH7EC4206_A1287; phage(gi30065716) 2e-83 Click
18complement(139374..139532) PHAGE_Erwini_ENT90: putative host lysis-related protein; ECH7EC4206_A1288; phage(gi431810968) 2e-10 Click
19complement(139519..139944) PHAGE_Yersin_413C: LysB; ECH7EC4206_A1289; phage(gi30065715) 1e-68 Click
20complement(139932..140357) PHAGE_Yersin_413C: LysA; ECH7EC4206_A1290; phage(gi30065714) 4e-68 Click
21complement(140372..140869) PHAGE_Yersin_413C: gpK; ECH7EC4206_A1291; phage(gi30065713) 3e-94 Click
22complement(140869..141150) PHAGE_Yersin_413C: gpY; ECH7EC4206_A1292; phage(gi30065712) 3e-46 Click
23complement(141154..141357) PHAGE_Yersin_413C: gpX; ECH7EC4206_A1293; phage(gi30065711) 2e-32 Click
24complement(141357..141830) PHAGE_Yersin_413C: gpL; ECH7EC4206_A1294; phage(gi30065710) 5e-85 Click
25complement(141966..142709) PHAGE_Yersin_413C: gpM; ECH7EC4206_A1295; phage(gi30065709) 7e-135 Click
26complement(142713..143786) PHAGE_Yersin_413C: gpN; ECH7EC4206_A1296; phage(gi30065708) 0.0 Click
27complement(143845..144699) PHAGE_Yersin_413C: gpO; ECH7EC4206_A1297; phage(gi30065707) 3e-160 Click
28144873..146645 PHAGE_Yersin_413C: gpP; ECH7EC4206_A1298; phage(gi30065706) 0.0 Click
29146645..147679 PHAGE_Yersin_413C: gpQ; ECH7EC4206_A1299; phage(gi30065705) 0.0 Click
30complement(147718..147879) hypothetical protein; ECH7EC4206_A1300 0.0 Click
31complement(147997..149964) PHAGE_Melano_entomopoxvirus: ORF MSV156 hypothetical protein; ECH7EC4206_A1301; phage(gi9631364) 7e-09 Click

Region 3, total : 46 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1125757..125784 attL    AATCTCCCTTACACGGGCTTATTTTTTA 0.0 Click
2complement(125886..126140) PHAGE_Yersin_413C: Ogr; ECH7EC4206_A1269; phage(gi30065732) 2e-45 Click
3complement(126186..127349) PHAGE_Yersin_413C: gpD; ECH7EC4206_A1270; phage(gi30065731) 0.0 Click
4complement(127349..127828) PHAGE_Yersin_413C: gpU; ECH7EC4206_A1271; phage(gi30065730) 4e-85 Click
5complement(127843..130290) PHAGE_Yersin_413C: gpT; ECH7EC4206_A1272; phage(gi30065729) 0.0 Click
6complement(130767..131285) PHAGE_Yersin_413C: FII; ECH7EC4206_A1275; phage(gi30065726) 6e-93 Click
7complement(131298..132488) PHAGE_Yersin_413C: gpFI; ECH7EC4206_A1276; phage(gi30065725) 0.0 Click
8complement(132548..133141) PHAGE_Entero_2: DNA-invertase; ECH7EC4206_A1277; phage(gi169936026) 9e-88 Click
9133172..133582 PHAGE_Erwini_ENT90: phage tail collar domain protein; ECH7EC4206_A1278; phage(gi431810938) 1e-13 Click
10133603..134046 PHAGE_Entero_mEp213: tail fiber assembly protein; ECH7EC4206_A1279; phage(gi428782612) 2e-26 Click
11complement(134018..134620) PHAGE_Entero_HK106: tail fiber assembly protein; ECH7EC4206_A1280; phage(gi428783304) 1e-95 Click
12complement(134620..135939) PHAGE_Salmon_RE_2010: tail fiber protein; ECH7EC4206_A1281; phage(gi418489713) 2e-108 Click
13complement(135936..136547) PHAGE_Yersin_413C: gpI; ECH7EC4206_A1282; phage(gi30065721) 3e-82 Click
14complement(136540..137448) PHAGE_Yersin_413C: gpJ; ECH7EC4206_A1283; phage(gi30065720) 3e-166 Click
15complement(137453..137800) PHAGE_Yersin_413C: gpW; ECH7EC4206_A1284; phage(gi30065719) 2e-59 Click
16complement(137797..138432) PHAGE_Yersin_413C: gpV; ECH7EC4206_A1285; phage(gi30065718) 4e-117 Click
17complement(138499..138951) PHAGE_Yersin_413C: gpS; ECH7EC4206_A1286; phage(gi30065717) 1e-77 Click
18complement(138944..139411) PHAGE_Yersin_413C: gpR; ECH7EC4206_A1287; phage(gi30065716) 2e-83 Click
19complement(139374..139532) PHAGE_Erwini_ENT90: putative host lysis-related protein; ECH7EC4206_A1288; phage(gi431810968) 2e-10 Click
20complement(139519..139944) PHAGE_Yersin_413C: LysB; ECH7EC4206_A1289; phage(gi30065715) 1e-68 Click
21complement(139932..140357) PHAGE_Yersin_413C: LysA; ECH7EC4206_A1290; phage(gi30065714) 4e-68 Click
22complement(140372..140869) PHAGE_Yersin_413C: gpK; ECH7EC4206_A1291; phage(gi30065713) 3e-94 Click
23complement(140869..141150) PHAGE_Yersin_413C: gpY; ECH7EC4206_A1292; phage(gi30065712) 3e-46 Click
24complement(141154..141357) PHAGE_Yersin_413C: gpX; ECH7EC4206_A1293; phage(gi30065711) 2e-32 Click
25complement(141357..141830) PHAGE_Yersin_413C: gpL; ECH7EC4206_A1294; phage(gi30065710) 5e-85 Click
26complement(141966..142709) PHAGE_Yersin_413C: gpM; ECH7EC4206_A1295; phage(gi30065709) 7e-135 Click
27complement(142713..143786) PHAGE_Yersin_413C: gpN; ECH7EC4206_A1296; phage(gi30065708) 0.0 Click
28complement(143845..144699) PHAGE_Yersin_413C: gpO; ECH7EC4206_A1297; phage(gi30065707) 3e-160 Click
29144873..146645 PHAGE_Yersin_413C: gpP; ECH7EC4206_A1298; phage(gi30065706) 0.0 Click
30146645..147679 PHAGE_Yersin_413C: gpQ; ECH7EC4206_A1299; phage(gi30065705) 0.0 Click
31complement(147718..147879) hypothetical protein; ECH7EC4206_A1300 0.0 Click
32complement(147997..149964) PHAGE_Melano_entomopoxvirus: ORF MSV156 hypothetical protein; ECH7EC4206_A1301; phage(gi9631364) 7e-09 Click
33complement(149964..150476) hypothetical protein; ECH7EC4206_A1302 0.0 Click
34complement(150463..151686) conserved hypothetical protein; ECH7EC4206_A1303 0.0 Click
35complement(151776..154058) PHAGE_Yersin_413C: gpA; ECH7EC4206_A1304; phage(gi30065742) 0.0 Click
36complement(154048..154323) PHAGE_Yersin_413C: hypothetical protein L-413Cp37; ECH7EC4206_A1305; phage(gi30065741) 1e-46 Click
37complement(154320..154544) PHAGE_Yersin_413C: hypothetical protein L-413Cp36; ECH7EC4206_A1306; phage(gi30065740) 9e-35 Click
38complement(154547..154846) PHAGE_Yersin_413C: hypothetical protein L-413Cp35; ECH7EC4206_A1307; phage(gi30065739) 8e-49 Click
39complement(154846..155070) PHAGE_Yersin_413C: hypothetical protein L-413Cp34; ECH7EC4206_A1308; phage(gi30065738) 1e-32 Click
40complement(155134..155634) PHAGE_Yersin_413C: gpB; ECH7EC4206_A1309; phage(gi30065737) 8e-94 Click
41complement(155631..155801) PHAGE_Yersin_413C: hypothetical protein L-413Cp32; ECH7EC4206_A1310; phage(gi30065736) 1e-26 Click
42complement(155812..155997) PHAGE_Yersin_413C: Cox; ECH7EC4206_A1311; phage(gi30065735) 1e-12 Click
43156624..157637 PHAGE_Yersin_413C: Int; ECH7EC4206_A1312; phage(gi30065733) 1e-91 Click
44157717..157744 attR    AATCTCCCTTACACGGGCTTATTTTTTA 0.0 Click
45complement(157902..158234) conserved hypothetical protein; ECH7EC4206_A1313 0.0 Click
46158625..159524 diacylglycerol kinase catalytic domain protein; ECH7EC4206_A1314 0.0 Click
47complement(159606..160385) galactitol utilization operon repressor; ECH7EC4206_A1315 0.0 Click
48complement(160485..161525) PHAGE_Synech_S_SM2: zinc-containing alcohol dehydrogenase superfamily protein; ECH7EC4206_A1316; phage(gi326781942) 8e-11 Click

Region 4, total : 62 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1200291..200303 attL    AAGGAGCGCAACA 0.0 Click
2204046..204060 attL    GCACTGGCATCGCTG 0.0 Click
3complement(209077..210762) PHAGE_Entero_2008: putative 2-component sensor protein YehU; ECH7EC4206_A1362; phage(gi209427798) 0.0 Click
4210851..210979 hypothetical protein; ECH7EC4206_A1363 0.0 Click
5211021..211161 hypothetical protein; ECH7EC4206_A1364 0.0 Click
6211277..211525 PHAGE_Entero_4795: putative damage-inducible protein DinI; ECH7EC4206_A1365; phage(gi157166070) 4e-25 Click
7complement(211893..212162) PHAGE_Stx2_c_II: putative tail fiber protein; ECH7EC4206_A1366; phage(gi302393091) 2e-41 Click
8complement(212164..212442) PROPHAGE_Escher_Sakai: putative tail fiber protein; ECH7EC4206_A1368; phage(gi15832195) 5e-50 Click
9213413..213541 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; ECH7EC4206_A1369; phage(gi157166059) 4e-18 Click
10complement(213542..214141) PHAGE_Entero_4795: outer membrane protein Lom precursor; ECH7EC4206_A1370; phage(gi157166058) 8e-98 Click
11complement(214209..217682) PHAGE_Entero_4795: putative tail component; ECH7EC4206_A1371; phage(gi157166057) 0.0 Click
12complement(217758..217877) hypothetical protein; ECH7EC4206_A1372 0.0 Click
13complement(217923..218501) PHAGE_Entero_4795: putative tail component; ECH7EC4206_A1373; phage(gi157166056) 5e-100 Click
14complement(218498..219133) PHAGE_Entero_4795: putative tail fiber component; ECH7EC4206_A1374; phage(gi157166055) 8e-125 Click
15complement(219252..219950) PHAGE_Entero_4795: putative tail fiber component; ECH7EC4206_A1375; phage(gi157166054) 2e-129 Click
16complement(219950..220279) PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4206_A1376; phage(gi15832202) 3e-60 Click
17complement(220276..222921) PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; ECH7EC4206_A1377; phage(gi15832203) 0.0 Click
18complement(222965..223273) PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4206_A1378; phage(gi15832204) 2e-56 Click
19complement(223736..224488) PHAGE_Entero_HK630: major tail protein V; ECH7EC4206_A1380; phage(gi428782800) 1e-112 Click
20complement(224496..224894) PROPHAGE_Escher_Sakai: putative minor tail protein U; ECH7EC4206_A1381; phage(gi15832207) 1e-72 Click
21complement(224907..225530) PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4206_A1382; phage(gi15832208) 3e-111 Click
22complement(225533..225781) PHAGE_Entero_mEp213: hypothetical protein; ECH7EC4206_A1383; phage(gi428782596) 6e-20 Click
23complement(225807..226133) PHAGE_Entero_mEp213: hypothetical protein; ECH7EC4206_A1384; phage(gi428782595) 1e-32 Click
24complement(226221..228176) PHAGE_Entero_mEp213: head maturation protease; ECH7EC4206_A1385; phage(gi428782594) 0.0 Click
25complement(228190..229692) PROPHAGE_Escher_Sakai: putative portal protein; ECH7EC4206_A1386; phage(gi15832215) 0.0 Click
26complement(229692..229904) PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4206_A1387; phage(gi428782319) 9e-24 Click
27complement(229901..232024) PROPHAGE_Escher_Sakai: putative terminase large subunit; ECH7EC4206_A1388; phage(gi15832217) 0.0 Click
28complement(232021..232497) PHAGE_Salmon_1: bacteriophage terminase, small subunit; ECH7EC4206_A1389; phage(gi169257184) 3e-47 Click
29complement(232952..233419) PHAGE_Entero_4795: putative endopeptidase Rz; ECH7EC4206_A1391; phage(gi157166036) 2e-82 Click
30complement(233427..233573) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF50; ECH7EC4206_A1392; phage(gi157166035) 2e-20 Click
31complement(233573..234142) PHAGE_Stx2_c_II: putative antirepressor protein Ant; ECH7EC4206_A1393; phage(gi302393166) 7e-107 Click
32complement(234413..234946) PHAGE_Stx2_c_II: endolysin; ECH7EC4206_A1394; phage(gi302393165) 1e-103 Click
33complement(234951..235166) PHAGE_Stx2_c_II: holin; ECH7EC4206_A1395; phage(gi302393164) 2e-35 Click
34complement(235244..235489) PHAGE_Escher_P13374: hypothetical protein; ECH7EC4206_A1396; phage(gi410491644) 6e-39 Click
35complement(235530..235709) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF44; ECH7EC4206_A1397; phage(gi157166029) 1e-27 Click
36complement(235846..237792) PHAGE_Entero_4795: hypothetical protein YjhS; ECH7EC4206_A1398; phage(gi157166028) 0.0 Click
37complement(238304..238380) tRNA 0.0 Click
38complement(238393..238471) tRNA 0.0 Click
39complement(238480..238555) tRNA 0.0 Click
40complement(239000..239434) PHAGE_Stx2_c_I: Q protein; ECH7EC4206_A1404; phage(gi20065938) 3e-80 Click
41complement(239520..239657) PHAGE_Entero_mEp237: hypothetical protein; ECH7EC4206_A1405; phage(gi435439319) 4e-10 Click
42complement(239657..240019) PHAGE_Entero_mEp237: Holliday junction resolvase RusA; ECH7EC4206_A1406; phage(gi435439318) 5e-62 Click
43complement(240016..240306) PHAGE_Entero_mEp237: hypothetical protein; ECH7EC4206_A1407; phage(gi435439317) 5e-49 Click
44complement(240469..240924) PHAGE_Cronob_phiES15: hypothetical protein; ECH7EC4206_A1408; phage(gi401817579) 9e-62 Click
45complement(241139..241936) transcriptional regulator, AraC family; ECH7EC4206_A1409 0.0 Click
46242113..242235 conserved hypothetical protein; ECH7EC4206_A1410 0.0 Click
47complement(242962..244488) PHAGE_Bacill_WBeta: putative site-specific recombinase; ECH7EC4206_A1411; phage(gi85701406) 5e-09 Click
48complement(244745..245077) PHAGE_Acinet_Acj61: putative quaternary ammonium compound-resistance protein qacE; ECH7EC4206_A1412; phage(gi311992758) 9e-11 Click
49complement(245145..245447) PHAGE_Entero_4795: putative Ren protein; ECH7EC4206_A1413; phage(gi157166013) 6e-44 Click
50complement(245444..245881) PHAGE_Entero_4795: putative replication protein P; ECH7EC4206_A1414; phage(gi157166012) 5e-80 Click
51245936..246262 PHAGE_Entero_4795: putative transposase OrfA protein of IS629; ECH7EC4206_A1415; phage(gi157166062) 1e-58 Click
52246259..247149 PROPHAGE_Escher_Sakai: putative transposase; ECH7EC4206_A1416; phage(gi15834498) 2e-173 Click
53complement(247455..248474) PHAGE_Entero_4795: putative replication protein O; ECH7EC4206_A1418; phage(gi157166011) 3e-114 Click
54complement(248471..249010) PHAGE_Entero_mEp237: CII protein; ECH7EC4206_A1419; phage(gi435439306) 1e-63 Click
55complement(249080..249310) PHAGE_Escher_HK639: cro; ECH7EC4206_A1420; phage(gi356870651) 3e-20 Click
56249490..250104 PHAGE_Entero_ST104: CI; ECH7EC4206_A1421; phage(gi46358671) 5e-89 Click
57250185..251246 PHAGE_Lactob_Lj965: hypothetical protein Ljo_0304; ECH7EC4206_A1422; phage(gi41179236) 4e-66 Click
58252082..252288 PHAGE_Entero_HK225: Kil protein; ECH7EC4206_A1423; phage(gi428782413) 6e-30 Click
59252364..252660 PHAGE_Entero_4795: putative host-nuclease inhibitor protein Gam; ECH7EC4206_A1424; phage(gi157165999) 9e-53 Click
60252666..253451 PHAGE_Stx2_c_I: Bet protein; ECH7EC4206_A1425; phage(gi20065900) 2e-151 Click
61253448..254125 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip102; ECH7EC4206_A1426; phage(gi20065897) 4e-132 Click
62254358..254471 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip099; ECH7EC4206_A1427; phage(gi20065894) 4e-14 Click
63254548..254763 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; ECH7EC4206_A1428; phage(gi20065893) 5e-35 Click
64255080..256027 PHAGE_Entero_2008: hypothetical protein YYZ_gp09; ECH7EC4206_A1429; phage(gi209427735) 0.0 Click
65256638..256652 attR    GCACTGGCATCGCTG 0.0 Click
66257441..257584 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF4; ECH7EC4206_A1433; phage(gi157165989) 8e-15 Click
67257855..257995 PHAGE_Entero_4795: putative excisionase; ECH7EC4206_A1434; phage(gi157165987) 8e-23 Click
68258029..259315 PHAGE_Entero_4795: putative integrase; ECH7EC4206_A1435; phage(gi157165986) 0.0 Click
69273867..273879 attR    AAGGAGCGCAACA 0.0 Click

Region 5, total : 89 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1515195..515206 attL    AACGACCACCAC 0.0 Click
2complement(517574..518839) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp22; ECH7EC4206_A1680; phage(gi302393102) 0.0 Click
3complement(518850..519143) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp21; ECH7EC4206_A1681; phage(gi302393101) 2e-32 Click
4complement(519153..519599) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp20; ECH7EC4206_A1682; phage(gi302393100) 9e-78 Click
5complement(519602..520258) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp19; ECH7EC4206_A1683; phage(gi302393099) 8e-121 Click
6complement(520353..520730) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp18; ECH7EC4206_A1684; phage(gi302393098) 4e-67 Click
7complement(520811..520951) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp17; ECH7EC4206_A1685; phage(gi302393097) 1e-21 Click
8complement(521182..521916) PHAGE_Stx2_c_II: outer membrane protein Lom precursor; ECH7EC4206_A1686; phage(gi302393096) 8e-139 Click
9complement(522007..522624) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp15; ECH7EC4206_A1687; phage(gi302393095) 4e-122 Click
10complement(522630..522908) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp14; ECH7EC4206_A1688; phage(gi302393094) 5e-51 Click
11complement(522923..524137) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp13; ECH7EC4206_A1689; phage(gi302393093) 0.0 Click
12complement(524188..525813) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp12; ECH7EC4206_A1690; phage(gi302393092) 0.0 Click
13complement(526435..526704) PHAGE_Stx2_c_II: putative tail fiber protein; ECH7EC4206_A1692; phage(gi302393091) 4e-47 Click
14complement(526706..528643) PHAGE_Stx2_c_II: putative tail fiber protein; ECH7EC4206_A1693; phage(gi302393090) 0.0 Click
15complement(528640..529290) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp09; ECH7EC4206_A1694; phage(gi302393089) 9e-122 Click
16complement(529290..529853) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp08; ECH7EC4206_A1695; phage(gi302393088) 2e-104 Click
17complement(529837..530298) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp07; ECH7EC4206_A1696; phage(gi302393087) 2e-82 Click
18complement(530348..530737) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp06; ECH7EC4206_A1697; phage(gi302393086) 2e-66 Click
19complement(530793..532007) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp05; ECH7EC4206_A1698; phage(gi302393085) 0.0 Click
20complement(532031..532447) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp04; ECH7EC4206_A1699; phage(gi302393084) 3e-73 Click
21532578..532904 PHAGE_Stx2_c_II: putative transposase; ECH7EC4206_A1700; phage(gi302393161) 1e-58 Click
22532901..533791 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp77; ECH7EC4206_A1701; phage(gi302393160) 2e-173 Click
23complement(533794..534351) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp04; ECH7EC4206_A1702; phage(gi302393084) 5e-94 Click
24complement(534509..536653) PHAGE_Stx2_c_II: portal protein; ECH7EC4206_A1703; phage(gi302393083) 0.0 Click
25complement(536653..538359) PHAGE_Stx2_c_II: terminase, large subunit; ECH7EC4206_A1705; phage(gi302393082) 0.0 Click
26complement(538340..539146) PHAGE_Stx2_c_II: terminase, small subunit; ECH7EC4206_A1706; phage(gi302393081) 3e-151 Click
27complement(539202..539405) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip164; ECH7EC4206_A1707; phage(gi20065959) 5e-36 Click
28539555..539848 PHAGE_Stx2_c_II: Bor protein precursor; ECH7EC4206_A1708; phage(gi302393169) 2e-50 Click
29complement(539880..540344) PHAGE_Stx2_c_II: endopeptidase Rz; ECH7EC4206_A1709; phage(gi302393167) 5e-69 Click
30complement(540352..540486) PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; ECH7EC4206_A1710; phage(gi302861202) 4e-16 Click
31complement(540501..541070) PHAGE_Stx2_c_II: putative antirepressor protein Ant; ECH7EC4206_A1711; phage(gi302393166) 1e-102 Click
32complement(541344..541877) PHAGE_Stx2_c_II: endolysin; ECH7EC4206_A1712; phage(gi302393165) 2e-100 Click
33complement(541882..542097) PHAGE_Stx2_c_II: holin; ECH7EC4206_A1713; phage(gi302393164) 2e-35 Click
34complement(542174..542446) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp80; ECH7EC4206_A1714; phage(gi302393163) 1e-43 Click
35complement(542487..542666) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp79; ECH7EC4206_A1715; phage(gi302393162) 2e-28 Click
36complement(542679..542804) PHAGE_Escher_TL_2011c: hypothetical protein; ECH7EC4206_A1716; phage(gi418487096) 7e-19 Click
37complement(542801..544738) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip148; ECH7EC4206_A1717; phage(gi20065943) 0.0 Click
38complement(545225..545494) PHAGE_Stx2_c_II: Shiga toxin 2 subunit B; ECH7EC4206_A1718; phage(gi302393158) 1e-46 Click
39complement(545506..546465) PHAGE_Stx2_c_II: Shiga toxin 2 subunit A; ECH7EC4206_A1719; phage(gi302393157) 0.0 Click
40complement(546555..546633) tRNA 0.0 Click
41complement(546645..546723) tRNA 0.0 Click
42complement(546730..546805) tRNA 0.0 Click
43complement(547247..547438) PHAGE_Stx2_c_II: antitermination protein Q; ECH7EC4206_A1725; phage(gi302393156) 6e-31 Click
44547418..547561 hypothetical protein; ECH7EC4206_A1724 0.0 Click
45547512..547628 hypothetical protein; ECH7EC4206_A1726 0.0 Click
46complement(547674..547868) PHAGE_Stx2_c_II: NinH protein; ECH7EC4206_A1727; phage(gi302393155) 2e-32 Click
47complement(547865..548470) PHAGE_Stx2_c_II: NinG protein; ECH7EC4206_A1728; phage(gi302393154) 3e-118 Click
48complement(548470..549192) PHAGE_Stx2_c_86: DNA-binding protein Roi; ECH7EC4206_A1729; phage(gi116222069) 3e-132 Click
49complement(549354..549755) PHAGE_Stx1_converting: hypothetical protein Stx1_gp68; ECH7EC4206_A1730; phage(gi302861190) 8e-76 Click
50complement(549830..550504) PHAGE_Stx2_c_II: putative antirepressor-like protein; ECH7EC4206_A1731; phage(gi302393152) 2e-113 Click
51complement(550952..551479) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip133; ECH7EC4206_A1732; phage(gi20065928) 4e-101 Click
52complement(551505..551624) hypothetical protein; ECH7EC4206_A1733 0.0 Click
53552353..552466 hypothetical protein; ECH7EC4206_A1734 0.0 Click
54complement(553009..553287) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp62; ECH7EC4206_A1736; phage(gi302393145) 5e-51 Click
55complement(553358..553648) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip128; ECH7EC4206_A1737; phage(gi20065923) 2e-49 Click
56complement(553645..554346) PHAGE_Entero_4795: putative replication protein P; ECH7EC4206_A1738; phage(gi157166012) 4e-132 Click
57complement(554343..555281) PHAGE_Entero_4795: putative replication protein O; ECH7EC4206_A1739; phage(gi157166011) 0.0 Click
58complement(555314..555610) PHAGE_Entero_Min27: regulatory protein CII; ECH7EC4206_A1740; phage(gi170783637) 4e-46 Click
59complement(555749..555976) PHAGE_Stx2_c_I: Cro protein; ECH7EC4206_A1741; phage(gi20065917) 1e-37 Click
60556055..556762 PHAGE_Stx2_c_I: CI protein; ECH7EC4206_A1742; phage(gi20065916) 2e-134 Click
61556840..556851 attL    TGAATATCAAGC 0.0 Click
62557689..558735 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip116; ECH7EC4206_A1744; phage(gi20065911) 0.0 Click
63558738..558902 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip115; ECH7EC4206_A1745; phage(gi20065910) 3e-24 Click
64559130..559288 hypothetical protein; ECH7EC4206_A1746 0.0 Click
65559391..559774 PHAGE_Stx2_c_I: N protein; ECH7EC4206_A1747; phage(gi20065909) 6e-68 Click
66559833..560303 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip113; ECH7EC4206_A1748; phage(gi20065908) 2e-91 Click
67560454..560822 PHAGE_Stx2_c_I: Ea10 protein; ECH7EC4206_A1749; phage(gi20065907) 7e-67 Click
68561028..561192 PHAGE_Stx2_c_II: Kil protein; ECH7EC4206_A1750; phage(gi302393131) 1e-19 Click
69561247..561543 PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; ECH7EC4206_A1751; phage(gi116222045) 3e-52 Click
70561549..562334 PHAGE_Stx2_c_86: recombination protein Bet; ECH7EC4206_A1752; phage(gi116222044) 3e-151 Click
71562331..563011 PHAGE_Stx2_c_II: exonuclease; ECH7EC4206_A1753; phage(gi302393128) 5e-131 Click
72563205..563354 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF10; ECH7EC4206_A1754; phage(gi157165995) 5e-21 Click
73563431..563646 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp41; ECH7EC4206_A1755; phage(gi302393124) 5e-35 Click
74563963..564910 PHAGE_Entero_2008: hypothetical protein YYZ_gp09; ECH7EC4206_A1756; phage(gi209427735) 1e-179 Click
75564912..565418 PHAGE_Entero_phiV10: hypothetical protein PhiV10p53; ECH7EC4206_A1757; phage(gi89152467) 7e-21 Click
76565378..565593 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp36; ECH7EC4206_A1758; phage(gi302393119) 1e-36 Click
77565595..565813 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp35; ECH7EC4206_A1759; phage(gi302393118) 1e-36 Click
78565815..566102 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp34; ECH7EC4206_A1760; phage(gi302393117) 1e-51 Click
79567333..567986 PHAGE_Stx2_c_II: putative antirepressor protein AntB; ECH7EC4206_A1762; phage(gi302393111) 3e-87 Click
80568029..568196 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp41; ECH7EC4206_A1763; phage(gi116222033) 9e-29 Click
81568423..569049 PHAGE_Escher_P13374: methylase; ECH7EC4206_A1764; phage(gi410491602) 4e-122 Click
82569009..569221 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp43; ECH7EC4206_A1765; phage(gi302393126) 2e-09 Click
83569257..569634 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp38; ECH7EC4206_A1766; phage(gi116222030) 1e-63 Click
84569713..569895 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp37; ECH7EC4206_A1767; phage(gi116222029) 4e-29 Click
85complement(569879..571048) PHAGE_Stx2_c_86: integrase; ECH7EC4206_A1768; phage(gi116222028) 0.0 Click
86571243..571319 tRNA 0.0 Click
87571361..571372 attR    TGAATATCAAGC 0.0 Click
88571444..572637 PROPHAGE_Escher_Sakai: putative prophage Sf6-like integrase; ECH7EC4206_A1770; phage(gi15832485) 0.0 Click
89complement(572812..573948) PHAGE_Salmon_vB_SemP_Emek: injection protein; ECH7EC4206_A1771; phage(gi399498803) 3e-51 Click
90complement(573958..574638) PHAGE_Sodali_phiSG1: phage DNA transfer protein; ECH7EC4206_A1772; phage(gi89886000) 2e-75 Click
91complement(574625..575092) PHAGE_Sodali_phiSG1: hypothetical protein SGPHI_0018; ECH7EC4206_A1773; phage(gi89885999) 2e-64 Click
92complement(575092..575622) PHAGE_Entero_Sf6: gene 9 protein; ECH7EC4206_A1774; phage(gi41057287) 9e-92 Click
93575644..576339 conserved hypothetical protein; ECH7EC4206_A1775 0.0 Click
94complement(577009..578421) conserved hypothetical protein; ECH7EC4206_A1776 0.0 Click
95complement(578608..578784) conserved hypothetical protein; ECH7EC4206_A1777 0.0 Click
96579087..579713 PHAGE_Staphy_StB27: integrase; ECH7EC4206_A1778; phage(gi431809677) 3e-10 Click
97581465..581476 attR    AACGACCACCAC 0.0 Click

Region 6, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1858008..858020 attL    ACACCAACAAAAA 0.0 Click
2complement(858024..858431) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp78; ECH7EC4206_A2064; phage(gi209447201) 4e-21 Click
3complement(858607..858876) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp76; ECH7EC4206_A2066; phage(gi209447199) 2e-42 Click
4858875..859042 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip026; ECH7EC4206_A2065; phage(gi20065822) 4e-26 Click
5859094..859420 PHAGE_Stx2_c_1717: putative transposase; ECH7EC4206_A2067; phage(gi209447180) 1e-58 Click
6859417..860307 PROPHAGE_Escher_Sakai: putative transposase; ECH7EC4206_A2068; phage(gi15834498) 2e-173 Click
7complement(860808..861155) PHAGE_Stx2_c_1717: transposase; ECH7EC4206_A2069; phage(gi209447152) 2e-62 Click
8complement(861608..861838) PHAGE_Entero_2008: putative endolysin; ECH7EC4206_A2070; phage(gi209427769) 4e-35 Click
9complement(861889..862233) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF47; ECH7EC4206_A2071; phage(gi157166032) 3e-60 Click
10complement(862238..862453) PHAGE_Stx2_c_1717: holin protein S-like protein; ECH7EC4206_A2072; phage(gi209447171) 7e-35 Click
11complement(862603..864456) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp44; ECH7EC4206_A2073; phage(gi209447169) 0.0 Click
12complement(864864..865031) PHAGE_Entero_P1: TciB; ECH7EC4206_A2074; phage(gi46401695) 1e-06 Click
13complement(865117..865833) conserved hypothetical protein; ECH7EC4206_A2075 0.0 Click
14complement(865926..866042) hypothetical protein; ECH7EC4206_A2076 0.0 Click
15complement(866113..866736) PHAGE_Entero_mEpX1: late gene regulator Q; ECH7EC4206_A2077; phage(gi428781929) 7e-116 Click
16complement(866733..867398) PHAGE_Stx2_c_1717: NinI protein; ECH7EC4206_A2078; phage(gi209447164) 3e-130 Click
17complement(867395..868006) PHAGE_Stx2_c_1717: NinG protein; ECH7EC4206_A2079; phage(gi209447163) 5e-101 Click
18868913..869668 PROPHAGE_Escher_MG1655: IS30 transposase; ECH7EC4206_A2080; phage(gi16132105) 2e-141 Click
19869728..870006 conserved hypothetical protein; ECH7EC4206_A2081 0.0 Click
20complement(870082..871290) PHAGE_Cafete_BV_PW1: hypothetical protein; ECH7EC4206_A2082; phage(gi310831380) 5e-15 Click
21complement(871686..872099) conserved hypothetical protein; ECH7EC4206_A2083 0.0 Click
22complement(872197..872418) conserved hypothetical protein; ECH7EC4206_A2084 0.0 Click
23complement(872596..874227) conserved DNA-binding protein; ECH7EC4206_A2085 0.0 Click
24complement(874224..875537) site-specific recombinase, phage integrase family protein; ECH7EC4206_A2086 0.0 Click
25878516..878528 attR    ACACCAACAAAAA 0.0 Click

Region 7, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12443619..2443630 attL    ACTTCTTCTTCA 0.0 Click
22454924..2455460 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4206_A3747; phage(gi428782339) 2e-100 Click
32455657..2455830 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4206_A3748; phage(gi428782340) 4e-26 Click
4complement(2455878..2456171) PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4206_A3749; phage(gi428782341) 7e-51 Click
5complement(2456196..2456312) PHAGE_Entero_mEp460: putative exonuclease; ECH7EC4206_A3750; phage(gi428782342) 2e-16 Click
6complement(2456504..2456701) PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4206_A3751; phage(gi428782343) 1e-13 Click
7complement(2457318..2457647) PHAGE_Escher_P13374: hypothetical protein; ECH7EC4206_A3754; phage(gi410491610) 4e-38 Click
8complement(2457659..2458195) PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4206_A3755; phage(gi428782349) 8e-99 Click
9complement(2458323..2458709) PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4206_A3756; phage(gi428782350) 2e-65 Click
102458796..2459449 PHAGE_Entero_2008: phage-related tail protein; ECH7EC4206_A3757; phage(gi209427791) 1e-78 Click
112459517..2460116 PHAGE_Entero_mEp460: Lom protein; ECH7EC4206_A3758; phage(gi428782335) 2e-106 Click
12complement(2460117..2460245) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; ECH7EC4206_A3759; phage(gi157166059) 8e-19 Click
132461216..2461494 PHAGE_Entero_2008: putative tail protein; ECH7EC4206_A3760; phage(gi209427793) 3e-49 Click
142461496..2461765 PHAGE_Stx2_c_II: putative tail fiber protein; ECH7EC4206_A3762; phage(gi302393091) 8e-44 Click
152461877..2462449 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp78; ECH7EC4206_A3763; phage(gi209447201) 6e-21 Click
162462750..2463151 PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECH7EC4206_A3764; phage(gi209427795) 2e-72 Click
172463233..2463874 PHAGE_Entero_2008: hypothetical protein YYZ_gp73; ECH7EC4206_A3765; phage(gi209427796) 2e-117 Click
18complement(2464035..2464283) PHAGE_Entero_mEp460: DinI-like protein; ECH7EC4206_A3766; phage(gi428782337) 1e-40 Click
19complement(2464345..2465442) PHAGE_Entero_mEp460: integrase; ECH7EC4206_A3767; phage(gi428782338) 0.0 Click
202465531..2466568 tRNA-dihydrouridine synthase A; ECH7EC4206_A3768 0.0 Click
212466702..2466944 phage shock protein G; ECH7EC4206_A3769 0.0 Click
22complement(2467110..2468093) quinone oxidoreductase; ECH7EC4206_A3770 0.0 Click
232468176..2469591 PHAGE_Entero_P1: Ban; ECH7EC4206_A3771; phage(gi46401697) 0.0 Click
242472710..2472721 attR    ACTTCTTCTTCA 0.0 Click

Region 8, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13150226..3150241 attL    GCACCATTTAAATCAA 0.0 Click
2complement(3150246..3151220) PHAGE_Entero_SfV: integrase; ECH7EC4206_A4432; phage(gi19549014) 3e-178 Click
33151641..3151653 attL    TGAACCGCCCCGG 0.0 Click
4complement(3151683..3152573) PROPHAGE_Escher_Sakai: putative transposase; ECH7EC4206_A4433; phage(gi15834498) 2e-173 Click
5complement(3152570..3152896) PHAGE_Stx2_c_II: putative transposase; ECH7EC4206_A4434; phage(gi302393161) 1e-58 Click
6complement(3153433..3154146) PHAGE_Entero_HK106: prophage repressor; ECH7EC4206_A4435; phage(gi428783326) 3e-133 Click
73154247..3154447 PHAGE_Entero_HK106: prophage antirepressor; ECH7EC4206_A4436; phage(gi428783327) 3e-31 Click
83154722..3154859 PHAGE_Entero_lambda: cII protein; ECH7EC4206_A4437; phage(gi9626294) 1e-18 Click
93155811..3156122 PHAGE_Entero_HK140: DNA replication protein P; ECH7EC4206_A4439; phage(gi428781992) 3e-05 Click
103156122..3156916 PHAGE_Entero_HK106: side tail fiber protein; ECH7EC4206_A4440; phage(gi428783303) 9e-22 Click
113156916..3157509 PHAGE_Entero_HK106: tail fiber assembly protein; ECH7EC4206_A4441; phage(gi428783304) 4e-64 Click
12complement(3157481..3157924) PHAGE_Entero_mEp213: tail fiber assembly protein; ECH7EC4206_A4442; phage(gi428782612) 2e-25 Click
13complement(3157945..3158355) PHAGE_Erwini_ENT90: phage tail collar domain protein; ECH7EC4206_A4443; phage(gi431810938) 3e-14 Click
143158385..3158939 PHAGE_Entero_2: DNA-invertase; ECH7EC4206_A4444; phage(gi169936026) 8e-89 Click
15complement(3158997..3159770) PHAGE_Pseudo_OBP: putative homing nuclease; ECH7EC4206_A4445; phage(gi371671534) 2e-38 Click
163160593..3161336 putative AraC-type regulatory protein encoded in prophage CP-933H; ECH7EC4206_A4446 0.0 Click
17complement(3161378..3161743) PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; ECH7EC4206_A4447; phage(gi24111655) 2e-44 Click
18complement(3162861..3163751) PROPHAGE_Escher_Sakai: putative transposase; ECH7EC4206_A4448; phage(gi15834498) 5e-172 Click
19complement(3163748..3164074) PHAGE_Stx2_c_II: putative transposase; ECH7EC4206_A4449; phage(gi302393161) 1e-58 Click
203164131..3164793 PROPHAGE_Escher_CFT073: putative prophage integrase; ECH7EC4206_A4450; phage(gi26250313) 3e-76 Click
213170154..3170166 attR    TGAACCGCCCCGG 0.0 Click
223176329..3176344 attR    GCACCATTTAAATCAA 0.0 Click

Region 9, total : 31 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13743590..3743604 attL    GCTTTTTTATACTAA 0.0 Click
2complement(3743678..3744748) PHAGE_Entero_HK106: integrase; ECH7EC4206_A5026; phage(gi428783305) 0.0 Click
33744996..3745166 hypothetical protein; ECH7EC4206_A5027 0.0 Click
43745394..3745996 conserved hypothetical protein; ECH7EC4206_A5028 0.0 Click
5complement(3746527..3746742) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; ECH7EC4206_A5029; phage(gi20065893) 3e-34 Click
6complement(3746819..3747010) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF10; ECH7EC4206_A5030; phage(gi157165995) 1e-27 Click
7complement(3747162..3747842) PHAGE_Stx2_c_1717: exonuclease; ECH7EC4206_A5031; phage(gi209447136) 4e-132 Click
8complement(3747839..3748486) PHAGE_Stx2_c_I: Bet protein; ECH7EC4206_A5032; phage(gi20065900) 1e-125 Click
93748879..3749502 PHAGE_Entero_Sf6: gene 54 protein; ECH7EC4206_A5033; phage(gi41057342) 2e-114 Click
103749499..3750164 PHAGE_Stx2_c_1717: NinI protein; ECH7EC4206_A5034; phage(gi209447164) 3e-130 Click
11complement(3750376..3751335) putative outer membrane protein; ECH7EC4206_A5035 0.0 Click
123751810..3752499 PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECH7EC4206_A5036; phage(gi169257244) 3e-81 Click
133752710..3753426 conserved hypothetical protein; ECH7EC4206_A5037 0.0 Click
143753512..3753670 PHAGE_Entero_P1: TciB; ECH7EC4206_A5038; phage(gi46401695) 3e-06 Click
153754507..3755004 PHAGE_Entero_cdtI: lysin; ECH7EC4206_A5040; phage(gi148609440) 1e-91 Click
163755001..3755468 PHAGE_Entero_mEp460: Rz lysis protein; ECH7EC4206_A5041; phage(gi428782373) 9e-78 Click
173755456..3755608 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4206_A5042; phage(gi428782374) 1e-21 Click
183756283..3756774 PHAGE_Entero_mEp460: terminase small subunit; ECH7EC4206_A5043; phage(gi428782317) 5e-74 Click
193758873..3759085 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4206_A5047; phage(gi428782319) 8e-35 Click
203760608..3762566 PHAGE_Entero_mEp460: putative protease/scaffold protein; ECH7EC4206_A5050; phage(gi428782321) 0.0 Click
213762653..3762976 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4206_A5051; phage(gi428782322) 1e-54 Click
223762969..3763244 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4206_A5052; phage(gi428782323) 4e-47 Click
233763256..3763834 PHAGE_Entero_mEp460: minor tail protein; ECH7EC4206_A5053; phage(gi428782324) 2e-103 Click
243763831..3764232 PHAGE_Entero_mEp460: minor tail protein; ECH7EC4206_A5054; phage(gi428782325) 1e-72 Click
253764243..3764986 PHAGE_Entero_mEp460: major tail protein; ECH7EC4206_A5055; phage(gi428782326) 4e-137 Click
263765047..3765433 PHAGE_Entero_mEp460: minor tail protein; ECH7EC4206_A5056; phage(gi428782327) 1e-64 Click
273765454..3765771 PHAGE_Entero_mEp460: tail assembly protein; ECH7EC4206_A5057; phage(gi428782328) 1e-56 Click
283765743..3768808 PHAGE_Entero_mEp460: tail length tape measure protein; ECH7EC4206_A5058; phage(gi428782329) 0.0 Click
293768808..3769137 PHAGE_Entero_mEp460: minor tail protein; ECH7EC4206_A5059; phage(gi428782330) 2e-61 Click
303769147..3769845 PHAGE_Entero_mEp460: minor tail protein; ECH7EC4206_A5060; phage(gi428782331) 9e-136 Click
313769851..3770594 PHAGE_Entero_mEp460: tail fiber component; ECH7EC4206_A5061; phage(gi428782332) 2e-149 Click
323770627..3771139 PHAGE_Entero_mEp460: tail assembly protein; ECH7EC4206_A5062; phage(gi428782333) 6e-87 Click
333782181..3782195 attR    GCTTTTTTATACTAA 0.0 Click

Region 10, total : 39 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14027820..4028869 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4206_A5343; phage(gi428782365) 8e-112 Click
24028882..4029253 PHAGE_Escher_HK75: RusA-like protein; ECH7EC4206_A5344; phage(gi356870726) 1e-36 Click
34029243..4029614 PHAGE_Entero_2008: antitermination protein Q; ECH7EC4206_A5345; phage(gi209427762) 4e-54 Click
44029766..4030584 abortive infection protein; ECH7EC4206_A5346 0.0 Click
5complement(4031174..4031314) hypothetical protein; ECH7EC4206_A5348 0.0 Click
6complement(4031289..4031402) hypothetical protein; ECH7EC4206_A5349 0.0 Click
74031529..4031918 putative envelope protein encoded within prophage CP-933N; ECH7EC4206_A5350 0.0 Click
84031947..4032022 tRNA 0.0 Click
94032029..4032107 tRNA 0.0 Click
104032119..4032197 tRNA 0.0 Click
114032686..4034536 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECH7EC4206_A5354; phage(gi209427766) 0.0 Click
124034712..4035038 PHAGE_Stx2_c_II: putative transposase; ECH7EC4206_A5355; phage(gi302393161) 1e-58 Click
134035035..4035925 PROPHAGE_Escher_Sakai: putative transposase; ECH7EC4206_A5356; phage(gi15834498) 2e-173 Click
14complement(4036687..4036827) conserved hypothetical protein; ECH7EC4206_A5357 0.0 Click
15complement(4036910..4037377) PHAGE_Entero_4795: putative endopeptidase Rz; ECH7EC4206_A5358; phage(gi157166036) 1e-73 Click
16complement(4037379..4037492) hypothetical protein; ECH7EC4206_A5359 0.0 Click
17complement(4037713..4038246) PHAGE_Entero_2008: putative endolysin; ECH7EC4206_A5360; phage(gi209427769) 2e-99 Click
184038364..4038678 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp06; ECH7EC4206_A5361; phage(gi116221998) 4e-18 Click
19complement(4038934..4039140) PHAGE_Stx2_c_1717: holin protein S-like protein; ECH7EC4206_A5362; phage(gi209447171) 3e-31 Click
204039148..4039309 conserved hypothetical protein; ECH7EC4206_A5363 0.0 Click
214039891..4040166 conserved hypothetical protein; ECH7EC4206_A5364 0.0 Click
224040619..4040966 PHAGE_Stx2_c_1717: transposase; ECH7EC4206_A5365; phage(gi209447152) 2e-62 Click
234041016..4042554 PHAGE_Stx2_c_1717: transposase; ECH7EC4206_A5366; phage(gi209447153) 0.0 Click
244042604..4042846 PHAGE_Entero_HK630: terminase small subunit nu1; ECH7EC4206_A5367; phage(gi428782788) 2e-13 Click
254044731..4044937 PHAGE_Entero_HK630: head-tail connector W; ECH7EC4206_A5370; phage(gi428782790) 1e-11 Click
264044934..4046526 PHAGE_Entero_HK630: portal protein B; ECH7EC4206_A5371; phage(gi428782791) 0.0 Click
274046516..4048021 PHAGE_Entero_HK630: head maturation protease C; ECH7EC4206_A5372; phage(gi428782792) 4e-108 Click
284048058..4048405 PHAGE_Entero_HK630: head decoration protein D; ECH7EC4206_A5373; phage(gi428782794) 6e-25 Click
294048463..4048729 PHAGE_Entero_HK630: major head subunit E; ECH7EC4206_A5374; phage(gi428782795) 2e-20 Click
304048789..4049451 PHAGE_Entero_HK630: major tail protein V; ECH7EC4206_A5375; phage(gi428782800) 5e-97 Click
314049465..4049896 PHAGE_Entero_HK630: minor tail protein G; ECH7EC4206_A5376; phage(gi428782801) 5e-45 Click
324049947..4050336 PHAGE_Entero_HK630: tail assembly protein GT; ECH7EC4206_A5377; phage(gi428782802) 4e-43 Click
334050317..4052896 PHAGE_Entero_HK630: tail length tape measure protein H; ECH7EC4206_A5378; phage(gi428782803) 0.0 Click
344052893..4053222 PHAGE_Entero_HK630: minor tail protein M; ECH7EC4206_A5379; phage(gi428782804) 4e-45 Click
354053222..4053920 PHAGE_Entero_HK630: minor tail protein L; ECH7EC4206_A5380; phage(gi428782805) 1e-105 Click
364054039..4054674 PROPHAGE_Escher_Sakai: putative tail assembly protein; ECH7EC4206_A5381; phage(gi15832200) 2e-127 Click
374054671..4055252 PHAGE_Stx2_c_1717: putative tail component; ECH7EC4206_A5382; phage(gi209447195) 8e-106 Click
38complement(4055443..4056102) PHAGE_Salmon_1: hypothetical bacteriophage protein; ECH7EC4206_A5383; phage(gi169257202) 4e-61 Click
394056104..4059577 PHAGE_Entero_HK630: tail fiber J; ECH7EC4206_A5384; phage(gi428782808) 0.0 Click
404059645..4060244 PHAGE_Stx2_c_1717: outer membrane protein Lom precursor; ECH7EC4206_A5385; phage(gi209447197) 9e-113 Click
414060266..4061621 PROPHAGE_Escher_Sakai: putative tail fiber protein; ECH7EC4206_A5386; phage(gi15832195) 0.0 Click
424061623..4061892 PHAGE_Stx2_c_II: putative tail fiber protein; ECH7EC4206_A5387; phage(gi302393091) 2e-43 Click

Region 11, total : 55 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14330136..4330957 PHAGE_Cronob_vB_CsaM_GAP32: putative Sir2-like protein; ECH7EC4206_A5704; phage(gi414087036) 4e-19 Click
2complement(4331113..4332159) spermidine/putrescine ABC transporter, periplasmic spermidine/putrescine-binding protein; ECH7EC4206_A5705 0.0 Click
3complement(4332156..4332950) spermidine/putrescine ABC transporter, permease protein PotC; ECH7EC4206_A5706 0.0 Click
44333001..4333015 attL    TTTATTCAATTTTTT 0.0 Click
5complement(4333117..4334235) PHAGE_Entero_mEp235: integrase; ECH7EC4206_A5707; phage(gi428781836) 3e-52 Click
6complement(4334204..4334473) putative excisionase; ECH7EC4206_A5708 0.0 Click
7complement(4334535..4334879) PHAGE_Entero_mEp460: putative exonuclease; ECH7EC4206_A5709; phage(gi428782342) 5e-34 Click
84335057..4335572 PHAGE_Entero_HK630: HkaP protein; ECH7EC4206_A5710; phage(gi428782827) 2e-12 Click
9complement(4335687..4335917) PHAGE_Salico_CGphi29: hypothetical protein; ECH7EC4206_A5711; phage(gi472340166) 1e-09 Click
10complement(4336155..4336631) Rac prophage repressor; ECH7EC4206_A5712 0.0 Click
114337063..4337488 PHAGE_Pectob_ZF40: putative cII repressor; ECH7EC4206_A5713; phage(gi422936652) 2e-05 Click
124337557..4338594 PHAGE_Escher_TL_2011b: hypothetical protein; ECH7EC4206_A5714; phage(gi418487646) 4e-48 Click
134338626..4339048 PHAGE_Escher_HK639: replication protein 14; ECH7EC4206_A5715; phage(gi356870655) 8e-32 Click
144339082..4339798 conserved hypothetical protein; ECH7EC4206_A5716 0.0 Click
154339858..4340112 conserved hypothetical protein; ECH7EC4206_A5717 0.0 Click
164340115..4340411 PHAGE_Klebsi_phiKO2: Gp58; ECH7EC4206_A5718; phage(gi46402144) 5e-27 Click
17complement(4340500..4340682) hypothetical protein; ECH7EC4206_A5719 0.0 Click
184340867..4340989 PHAGE_Salmon_E1: hypothetical protein VIP0051; ECH7EC4206_A5720; phage(gi170676326) 1e-05 Click
194340976..4341413 PHAGE_Entero_2008: hypothetical protein YYZ_gp09; ECH7EC4206_A5721; phage(gi209427735) 1e-08 Click
204341415..4341606 PHAGE_Salmon_ST160: hypothetical protein; ECH7EC4206_A5722; phage(gi318065908) 5e-27 Click
214341609..4342196 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4206_A5723; phage(gi428782343) 7e-40 Click
224342267..4342416 conserved hypothetical protein; ECH7EC4206_A5724 0.0 Click
234343265..4344314 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4206_A5726; phage(gi428782365) 2e-109 Click
244344327..4344584 PHAGE_Escher_HK75: RusA-like protein; ECH7EC4206_A5727; phage(gi356870726) 4e-21 Click
254344565..4345857 PHAGE_Stx1_converting: hypothetical protein Stx1_gp75; ECH7EC4206_A5728; phage(gi302861197) 1e-179 Click
264346005..4346187 PHAGE_Escher_P13374: hypothetical protein; ECH7EC4206_A5729; phage(gi410491643) 3e-18 Click
274346225..4346494 PHAGE_Escher_P13374: hypothetical protein; ECH7EC4206_A5730; phage(gi410491644) 1e-26 Click
284346570..4346785 PHAGE_Stx2_c_1717: holin protein S-like protein; ECH7EC4206_A5731; phage(gi209447171) 1e-34 Click
294346790..4347134 PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECH7EC4206_A5732; phage(gi209427768) 1e-59 Click
304347185..4347718 PHAGE_Entero_2008: putative endolysin; ECH7EC4206_A5733; phage(gi209427769) 4e-103 Click
314347989..4348558 PHAGE_Entero_2008: putative antirepressor; ECH7EC4206_A5734; phage(gi209427770) 7e-107 Click
324348558..4348704 PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; ECH7EC4206_A5735; phage(gi302861202) 2e-20 Click
334348712..4349179 PHAGE_Entero_2008: putative endopeptidase; ECH7EC4206_A5736; phage(gi209427771) 5e-63 Click
344349203..4349427 conserved hypothetical protein; ECH7EC4206_A5737 0.0 Click
354349575..4349697 hypothetical protein; ECH7EC4206_A5738 0.0 Click
364349784..4349924 conserved hypothetical protein; ECH7EC4206_A5739 0.0 Click
37complement(4350054..4350179) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECH7EC4206_A5740; phage(gi209427772) 7e-08 Click
384350936..4351499 PHAGE_Entero_2008: putative phage terminase; ECH7EC4206_A5741; phage(gi209427774) 1e-95 Click
394351496..4353157 PHAGE_Entero_2008: putative phage terminase-like protein large subunit; ECH7EC4206_A5742; phage(gi209427775) 0.0 Click
404353221..4355158 PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECH7EC4206_A5743; phage(gi209427776) 0.0 Click
414355370..4357871 PHAGE_Entero_2008: putative portal protein; ECH7EC4206_A5744; phage(gi209427777) 0.0 Click
424357951..4358277 PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ECH7EC4206_A5746; phage(gi209427778) 1e-54 Click
434358287..4358637 PHAGE_Entero_2008: putative head-tail adaptor; ECH7EC4206_A5747; phage(gi209427779) 9e-61 Click
444358634..4359080 PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ECH7EC4206_A5748; phage(gi209427780) 2e-80 Click
454359077..4359421 PHAGE_Entero_2008: putative prophage structural protein; ECH7EC4206_A5749; phage(gi209427781) 6e-60 Click
464360218..4360592 PHAGE_Entero_2008: putative tail assembly protein; ECH7EC4206_A5751; phage(gi209427783) 4e-67 Click
474360694..4360897 PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECH7EC4206_A5752; phage(gi209427784) 3e-32 Click
484360950..4364192 PHAGE_Entero_2008: putative tail protein; ECH7EC4206_A5753; phage(gi209427785) 0.0 Click
494364185..4364526 PHAGE_Entero_2008: putative minor tail protein; ECH7EC4206_A5754; phage(gi209427786) 3e-63 Click
504364526..4365224 PHAGE_Entero_2008: putative tail protein; ECH7EC4206_A5755; phage(gi209427787) 1e-131 Click
51complement(4365241..4365381) putative regulatory protein; ECH7EC4206_A5756 0.0 Click
524365575..4365715 conserved hypothetical protein; ECH7EC4206_A5757 0.0 Click
534366018..4366896 PHAGE_Salmon_vB_SemP_Emek: antirepressor; ECH7EC4206_A5759; phage(gi399498814) 2e-94 Click
544366950..4367687 PHAGE_Entero_2008: putative tail component K-like protein; ECH7EC4206_A5760; phage(gi209427789) 3e-151 Click
554367684..4367869 PHAGE_Entero_2008: putative tail assembly protein; ECH7EC4206_A5761; phage(gi209427790) 4e-11 Click
564367991..4370339 PHAGE_Staphy_SA11: putative pentapeptide repeat protein; ECH7EC4206_A5762; phage(gi422935631) 2e-05 Click
574380658..4380672 attR    TTTATTCAATTTTTT 0.0 Click

Region 12, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14383532..4383552 attL    CGGTGTAGTTAATGGTGTAGT 0.0 Click
24383561..4384808 PHAGE_Salmon_vB_SosS_Oslo: integrase; ECH7EC4206_A5775; phage(gi399528791) 2e-59 Click
34385419..4386363 conserved hypothetical protein; ECH7EC4206_A5777 0.0 Click
44386356..4386568 hypothetical protein; ECH7EC4206_A5778 0.0 Click
54387015..4387248 conserved hypothetical protein; ECH7EC4206_A5780 0.0 Click
64387254..4387553 conserved hypothetical protein; ECH7EC4206_A5781 0.0 Click
74387550..4388950 PHAGE_Mycoba_PG1: gp59; ECH7EC4206_A5782; phage(gi38638462) 8e-30 Click
84389151..4389402 hypothetical bacteriophage protein; ECH7EC4206_A5783 0.0 Click
94389399..4389809 PHAGE_Lactoc_Q54: hypothetical protein Q54_gp12; ECH7EC4206_A5784; phage(gi115304283) 3e-09 Click
104390049..4390177 hypothetical protein; ECH7EC4206_A5785 0.0 Click
114390695..4390901 conserved hypothetical protein; ECH7EC4206_A5787 0.0 Click
124390901..4391956 PHAGE_Entero_N15: gp8; ECH7EC4206_A5788; phage(gi9630472) 6e-69 Click
134391969..4392304 PHAGE_Entero_N15: gp7; ECH7EC4206_A5789; phage(gi9630471) 8e-07 Click
144392317..4392730 conserved hypothetical protein; ECH7EC4206_A5790 0.0 Click
154392951..4393478 PHAGE_Entero_N15: gp1; ECH7EC4206_A5791; phage(gi9630465) 1e-35 Click
16complement(4393458..4393682) conserved hypothetical protein; ECH7EC4206_A5792 0.0 Click
174393734..4394015 hypothetical bacteriophage protein; ECH7EC4206_A5793 0.0 Click
184394509..4394529 attR    CGGTGTAGTTAATGGTGTAGT 0.0 Click

Region 13, total : 48 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4400127..4400588) PHAGE_Vibrio_KVP40: NMN adenylyl tranferase; ECH7EC4206_A5800; phage(gi34419395) 6e-05 Click
2complement(4400598..4401221) ribosomal large subunit pseudouridine synthase E; ECH7EC4206_A5801 0.0 Click
3complement(4401339..4401452) conserved hypothetical protein; ECH7EC4206_A5803 0.0 Click
44401423..4402673 isocitrate dehydrogenase, NADP-dependent; ECH7EC4206_A5802 0.0 Click
54402655..4402666 attL    GATCATCAAGAA 0.0 Click
6complement(4402787..4403929) PHAGE_Entero_mEp235: integrase; ECH7EC4206_A5804; phage(gi428781836) 5e-61 Click
74404259..4405083 PHAGE_Entero_lambda: DNA replication protein; ECH7EC4206_A5805; phage(gi9626295) 2e-99 Click
84405080..4405781 PHAGE_Entero_lambda: DNA replication protein; ECH7EC4206_A5806; phage(gi9626296) 4e-129 Click
94405778..4406080 PHAGE_Entero_lambda: ren exclusion protein; ECH7EC4206_A5807; phage(gi9626297) 2e-43 Click
104406148..4406480 PHAGE_Acinet_Acj61: putative quaternary ammonium compound-resistance protein qacE; ECH7EC4206_A5808; phage(gi311992758) 1e-10 Click
114408749..4409204 PHAGE_Cronob_phiES15: hypothetical protein; ECH7EC4206_A5811; phage(gi401817579) 9e-59 Click
124409204..4409374 PHAGE_Escher_HK639: NinE; ECH7EC4206_A5812; phage(gi356870663) 1e-14 Click
134409367..4409657 PHAGE_Entero_mEp237: hypothetical protein; ECH7EC4206_A5813; phage(gi435439317) 3e-48 Click
144409654..4410016 PHAGE_Entero_mEp237: Holliday junction resolvase RusA; ECH7EC4206_A5814; phage(gi435439318) 1e-61 Click
154410016..4410153 PHAGE_Entero_mEp237: hypothetical protein; ECH7EC4206_A5815; phage(gi435439319) 1e-11 Click
164410150..4410839 PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECH7EC4206_A5816; phage(gi169257244) 4e-84 Click
174411149..4411466 PHAGE_Salmon_ST160: Gp13; ECH7EC4206_A5817; phage(gi318065943) 5e-40 Click
184411453..4411929 PHAGE_Escher_HK75: lysozyme; ECH7EC4206_A5818; phage(gi356870730) 6e-85 Click
194411926..4412387 PHAGE_Entero_lambda: cell lysis protein; ECH7EC4206_A5819; phage(gi9626310) 3e-80 Click
20complement(4412419..4412712) PHAGE_Entero_lambda: Bor protein precursor; ECH7EC4206_A5820; phage(gi19263395) 6e-50 Click
21complement(4413004..4413414) PHAGE_Entero_lambda: putative envelope protein; ECH7EC4206_A5821; phage(gi19263396) 2e-74 Click
224413700..4413906 PHAGE_Entero_lambda: hypothetical protein lambdap79; ECH7EC4206_A5822; phage(gi19263397) 1e-32 Click
23complement(4414071..4414205) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECH7EC4206_A5823; phage(gi209427772) 5e-09 Click
244414654..4415199 PHAGE_Entero_lambda: DNA packaging protein; ECH7EC4206_A5824; phage(gi9626244) 3e-96 Click
254415174..4417099 PHAGE_Entero_lambda: DNA packaging protein; ECH7EC4206_A5825; phage(gi9626245) 0.0 Click
264417096..4417302 PHAGE_Entero_lambda: head-tail joining protein; ECH7EC4206_A5826; phage(gi9626246) 1e-31 Click
274417299..4418900 PHAGE_Entero_lambda: capsid component; ECH7EC4206_A5827; phage(gi9626247) 0.0 Click
284418881..4420200 PHAGE_Entero_lambda: capsid component; ECH7EC4206_A5828; phage(gi9626248) 0.0 Click
294420210..4420542 PHAGE_Entero_lambda: head-DNA stabilization protein; ECH7EC4206_A5829; phage(gi9626250) 7e-58 Click
304420571..4421623 PHAGE_Entero_lambda: capsid component; ECH7EC4206_A5830; phage(gi9626251) 0.0 Click
314421665..4422063 PHAGE_Entero_lambda: DNA packaging protein; ECH7EC4206_A5831; phage(gi9626252) 3e-67 Click
324422075..4422428 PHAGE_Entero_lambda: head-tail joining protein; ECH7EC4206_A5832; phage(gi9626253) 3e-62 Click
334422440..4423018 PHAGE_Entero_lambda: tail component; ECH7EC4206_A5833; phage(gi9626254) 6e-101 Click
344423015..4423410 PHAGE_Entero_lambda: tail component; ECH7EC4206_A5834; phage(gi9626255) 2e-72 Click
354423418..4424158 PHAGE_Entero_lambda: tail component; ECH7EC4206_A5835; phage(gi9626256) 3e-133 Click
364424174..4424596 PHAGE_Entero_lambda: tail component; ECH7EC4206_A5836; phage(gi9626257) 2e-73 Click
374424578..4425012 PHAGE_Entero_lambda: tail component; ECH7EC4206_A5837; phage(gi9626258) 2e-81 Click
384425005..4427554 PHAGE_Entero_lambda: tail component; ECH7EC4206_A5838; phage(gi9626259) 0.0 Click
394427551..4427880 PHAGE_Entero_lambda: tail component; ECH7EC4206_A5839; phage(gi9626260) 1e-56 Click
404427880..4428578 PHAGE_Entero_lambda: tail component; ECH7EC4206_A5840; phage(gi9626261) 5e-134 Click
414428584..4429327 PHAGE_Entero_mEp460: tail fiber component; ECH7EC4206_A5841; phage(gi428782332) 2e-149 Click
424429324..4429896 PHAGE_Entero_lambda: tail component; ECH7EC4206_A5842; phage(gi9626263) 1e-100 Click
434429957..4433355 PHAGE_Entero_lambda: tail:host specificity protein; ECH7EC4206_A5843; phage(gi9626264) 0.0 Click
444433422..4434021 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; ECH7EC4206_A5844; phage(gi148609401) 6e-112 Click
45complement(4434022..4434195) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; ECH7EC4206_A5845; phage(gi157166059) 2e-29 Click
46complement(4434583..4435320) PHAGE_Entero_lambda: hypothetical protein lambdap90; ECH7EC4206_A5846; phage(gi9626267) 1e-52 Click
474435356..4435490 hypothetical protein; ECH7EC4206_A5847 0.0 Click
484435451..4437001 PHAGE_Entero_lambda: Tail fiber; ECH7EC4206_A5848; phage(gi9626268) 2e-87 Click
494437001..4437582 PHAGE_Entero_lambda: Putative fiber assembly protein; ECH7EC4206_A5849; phage(gi9626269) 4e-102 Click
504449781..4449792 attR    GATCATCAAGAA 0.0 Click

Region 14, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14511586..4511597 attL    ATTGAAATGATA 0.0 Click
2complement(4525646..4526776) PHAGE_Entero_mEp235: integrase; ECH7EC4206_A5953; phage(gi428781836) 4e-56 Click
3complement(4527067..4529538) PHAGE_Entero_mEp460: putative exonuclease; ECH7EC4206_A5954; phage(gi428782342) 3e-58 Click
4complement(4529631..4529822) conserved hypothetical protein; ECH7EC4206_A5955 0.0 Click
54529871..4530146 hypothetical protein; ECH7EC4206_A5956 0.0 Click
64530566..4530799 conserved hypothetical protein; ECH7EC4206_A5957 0.0 Click
7complement(4530777..4531184) PHAGE_Escher_TL_2011c: hypothetical protein; ECH7EC4206_A5958; phage(gi418487085) 5e-12 Click
8complement(4531207..4531425) hypothetical protein; ECH7EC4206_A5959 0.0 Click
9complement(4531498..4531797) conserved hypothetical protein; ECH7EC4206_A5960 0.0 Click
104533657..4533998 PHAGE_Entero_2008: putative minor tail protein; ECH7EC4206_A1132; phage(gi209427786) 4e-64 Click
11complement(4534741..4534959) putative transcriptional regulator; ECH7EC4206_A1129 0.0 Click
124535169..4535342 PHAGE_Salmon_SPN3UB: hypothetical protein; ECH7EC4206_A1128; phage(gi423262397) 4e-24 Click
134535332..4536336 PHAGE_Entero_2008: antirepressor protein Ant; ECH7EC4206_A1127; phage(gi209427788) 4e-177 Click
144536391..4537128 PHAGE_Entero_2008: putative tail component K-like protein; ECH7EC4206_A1126; phage(gi209427789) 3e-145 Click
154537125..4537706 PHAGE_Entero_2008: putative tail assembly protein; ECH7EC4206_A1125; phage(gi209427790) 5e-100 Click
164537815..4537940 hypothetical protein; ECH7EC4206_A1124 0.0 Click
174537945..4541424 PHAGE_Entero_2008: phage-related tail protein; ECH7EC4206_A1123; phage(gi209427791) 0.0 Click
184541492..4542091 PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECH7EC4206_A1122; phage(gi209427792) 6e-114 Click
194542156..4543469 PHAGE_Entero_2008: putative tail protein; ECH7EC4206_A1121; phage(gi209427793) 0.0 Click
204543471..4543740 PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ECH7EC4206_A1120; phage(gi209427794) 4e-43 Click
214543881..4544756 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp77; ECH7EC4206_A1119; phage(gi209447200) 4e-114 Click
22complement(4544980..4545630) PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECH7EC4206_A1118; phage(gi209427795) 3e-21 Click
234545749..4545760 attR    ATTGAAATGATA 0.0 Click
24complement(4546869..4546991) hypothetical protein; ECH7EC4206_A1117 0.0 Click
254546948..4548120 PHAGE_Stx2_c_1717: penicillin-binding protein 6b; ECH7EC4206_A1116; phage(gi209447203) 0.0 Click

Region 15, total : 46 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14589955..4589985 attL    ACCGGGGGTTCAAATCCCCCTCTCTCCGCCA 0.0 Click
2complement(4589994..4591073) PHAGE_Salmon_ST64B: Integrase protein; ECH7EC4206_A1065; phage(gi23505472) 2e-102 Click
3complement(4591073..4591276) conserved hypothetical protein; ECH7EC4206_A1064 0.0 Click
4complement(4591335..4593806) PHAGE_Salmon_ST64B: Endodeoxyribonuclease; ECH7EC4206_A1063; phage(gi23505474) 1e-55 Click
5complement(4593902..4594090) conserved hypothetical protein; ECH7EC4206_A1062 0.0 Click
6complement(4594087..4594275) conserved domain protein; ECH7EC4206_A1061 0.0 Click
7complement(4594756..4594908) PHAGE_Salico_CGphi29: hypothetical protein; ECH7EC4206_A1059; phage(gi472340166) 1e-08 Click
8complement(4595183..4595842) PHAGE_Entero_mEp390: prophage repressor; ECH7EC4206_A1058; phage(gi428782701) 2e-25 Click
94596149..4596574 PHAGE_Pectob_ZF40: putative cII repressor; ECH7EC4206_A1057; phage(gi422936652) 4e-06 Click
104596643..4597680 PHAGE_Escher_TL_2011b: hypothetical protein; ECH7EC4206_A1056; phage(gi418487646) 1e-46 Click
114597712..4598134 PHAGE_Escher_HK639: replication protein 14; ECH7EC4206_A1055; phage(gi356870655) 5e-31 Click
124598169..4598867 conserved hypothetical protein; ECH7EC4206_A1054 0.0 Click
134599110..4599466 PHAGE_Entero_HK629: hypothetical protein; ECH7EC4206_A1053; phage(gi428782046) 9e-16 Click
144599648..4599959 PHAGE_Entero_mEp213: hypothetical protein; ECH7EC4206_A1052; phage(gi428782634) 2e-24 Click
154600086..4600649 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4206_A1051; phage(gi428782343) 5e-41 Click
164600714..4600863 conserved hypothetical protein; ECH7EC4206_A1050 0.0 Click
174601349..4601708 PHAGE_Cronob_phiES15: hypothetical protein; ECH7EC4206_A1049; phage(gi401817580) 1e-13 Click
184601710..4602759 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4206_A1048; phage(gi428782365) 4e-111 Click
194602772..4603131 PHAGE_Escher_HK75: RusA-like protein; ECH7EC4206_A1047; phage(gi356870726) 1e-37 Click
204603128..4603817 PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECH7EC4206_A1046; phage(gi169257244) 9e-80 Click
214603848..4603970 hypothetical protein; ECH7EC4206_A1045 0.0 Click
224604028..4604103 tRNA 0.0 Click
234604110..4604188 tRNA 0.0 Click
244604200..4604278 tRNA 0.0 Click
254604876..4605043 PHAGE_Entero_P1: TciB; ECH7EC4206_A1040; phage(gi46401695) 3e-08 Click
264605357..4607207 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECH7EC4206_A1038; phage(gi209427766) 0.0 Click
27complement(4607289..4608179) PROPHAGE_Escher_Sakai: putative transposase; ECH7EC4206_A1037; phage(gi15834498) 2e-173 Click
28complement(4608176..4608502) PHAGE_Stx2_c_II: putative transposase; ECH7EC4206_A1036; phage(gi302393161) 1e-58 Click
294608822..4609028 PHAGE_Stx2_c_1717: holin protein S-like protein; ECH7EC4206_A1035; phage(gi209447171) 1e-32 Click
304609033..4609377 PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECH7EC4206_A1034; phage(gi209427768) 6e-60 Click
314609428..4609961 PHAGE_Entero_4795: putative R protein; ECH7EC4206_A1033; phage(gi157166033) 9e-100 Click
324610153..4610299 conserved hypothetical protein; ECH7EC4206_A1032 0.0 Click
334610451..4610918 PHAGE_Entero_4795: putative endopeptidase Rz; ECH7EC4206_A1031; phage(gi157166036) 6e-69 Click
344611001..4611141 conserved hypothetical protein; ECH7EC4206_A1030 0.0 Click
35complement(4611267..4611380) conserved hypothetical protein; ECH7EC4206_A1029 0.0 Click
36complement(4611779..4611943) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECH7EC4206_A1028; phage(gi209427772) 1e-08 Click
374612398..4612907 PHAGE_Entero_HK630: terminase small subunit nu1; ECH7EC4206_A1027; phage(gi428782788) 8e-18 Click
384614792..4614998 PHAGE_Entero_HK630: head-tail connector W; ECH7EC4206_A1024; phage(gi428782790) 1e-11 Click
394614995..4616587 PHAGE_Entero_HK630: portal protein B; ECH7EC4206_A1023; phage(gi428782791) 0.0 Click
404616577..4618082 PHAGE_Entero_HK630: head maturation protease C; ECH7EC4206_A1022; phage(gi428782792) 4e-108 Click
414618119..4618466 PHAGE_Entero_HK630: head decoration protein D; ECH7EC4206_A1021; phage(gi428782794) 6e-25 Click
424618524..4618790 PHAGE_Entero_HK630: major head subunit E; ECH7EC4206_A1020; phage(gi428782795) 2e-20 Click
434618850..4619512 PHAGE_Entero_HK630: major tail protein V; ECH7EC4206_A1019; phage(gi428782800) 5e-97 Click
444619526..4619957 PHAGE_Entero_HK630: minor tail protein G; ECH7EC4206_A1018; phage(gi428782801) 5e-45 Click
454620008..4620397 PHAGE_Entero_HK630: tail assembly protein GT; ECH7EC4206_A1017; phage(gi428782802) 4e-43 Click
464620378..4622957 PHAGE_Entero_HK630: tail length tape measure protein H; ECH7EC4206_A1016; phage(gi428782803) 0.0 Click
474622954..4623283 PHAGE_Entero_HK630: minor tail protein M; ECH7EC4206_A1015; phage(gi428782804) 4e-45 Click
484623283..4623981 PHAGE_Entero_HK630: minor tail protein L; ECH7EC4206_A1014; phage(gi428782805) 1e-105 Click
494624100..4624735 PROPHAGE_Escher_Sakai: putative tail assembly protein; ECH7EC4206_A1013; phage(gi15832200) 2e-127 Click
504624732..4625310 PROPHAGE_Escher_Sakai: putative tail assembly protein; ECH7EC4206_A1012; phage(gi15832199) 6e-105 Click
514633998..4634028 attR    ACCGGGGGTTCAAATCCCCCTCTCTCCGCCA 0.0 Click

Region 16, total : 31 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14682871..4682882 attL    ATTTATGTGATA 0.0 Click
24688954..4689100 PROPHAGE_Escher_EDL933: partial putative transposase; ECH7EC4206_A0931; phage(gi15801060) 8e-22 Click
3complement(4689140..4690027) PROPHAGE_Escher_EDL933: transposase for IS629; ECH7EC4206_A0930; phage(gi15801145) 9e-172 Click
4complement(4690027..4690353) PHAGE_Entero_4795: putative transposase OrfA protein of IS629; ECH7EC4206_A0929; phage(gi157166066) 5e-57 Click
54690315..4691379 PROPHAGE_Escher_MG1655: IS30 transposase; ECH7EC4206_A0928; phage(gi16132105) 0.0 Click
6complement(4691701..4691832) hypothetical protein; ECH7EC4206_A0925 0.0 Click
74691812..4692996 PHAGE_Erwini_ENT90: tail sheath protein; ECH7EC4206_A0926; phage(gi431810939) 7e-101 Click
84692996..4693508 PHAGE_Salmon_RE_2010: major tail tube protein; ECH7EC4206_A0924; phage(gi418489721) 8e-36 Click
94693563..4693928 PROPHAGE_Salmon_Ty2: putative phage tail protein; ECH7EC4206_A0923; phage(gi29143760) 2e-06 Click
104693937..4694092 PHAGE_Entero_P2: gpE+E'; ECH7EC4206_A0922; phage(gi9630352) 7e-08 Click
114696895..4697383 PHAGE_Salmon_RE_2010: tail protein; ECH7EC4206_A0919; phage(gi418489725) 2e-38 Click
124697636..4698112 putative serine acetlyltransferase of prophage CP-933T; ECH7EC4206_A0918 0.0 Click
13complement(4698156..4698572) PHAGE_Salmon_RE_2010: tail fiber assembly protein; ECH7EC4206_A0917; phage(gi418489714) 2e-41 Click
144698743..4699069 PHAGE_Entero_4795: putative transposase OrfA protein of IS629; ECH7EC4206_A0916; phage(gi157166066) 9e-58 Click
154699069..4699758 PROPHAGE_Escher_EDL933: transposase for IS629; ECH7EC4206_A0915; phage(gi15801145) 3e-129 Click
16complement(4700097..4701056) plasmid segregation protein ParM; ECH7EC4206_A0914 0.0 Click
17complement(4701133..4703955) PHAGE_Salmon_RE_2010: replication protein; ECH7EC4206_A0913; phage(gi418489692) 2e-170 Click
18complement(4703962..4704327) conserved hypothetical protein; ECH7EC4206_A0912 0.0 Click
19complement(4704400..4704630) conserved domain protein; ECH7EC4206_A0911 0.0 Click
20complement(4704953..4705252) PHAGE_Entero_mEp213: hypothetical protein; ECH7EC4206_A0910; phage(gi428782624) 9e-08 Click
21complement(4705249..4705515) conserved hypothetical protein; ECH7EC4206_A0909 0.0 Click
22complement(4705512..4705715) conserved hypothetical protein; ECH7EC4206_A0908 0.0 Click
23complement(4705739..4706155) conserved hypothetical protein; ECH7EC4206_A0907 0.0 Click
24complement(4706248..4706361) hypothetical protein; ECH7EC4206_A0906 0.0 Click
25complement(4706358..4706600) conserved hypothetical protein; ECH7EC4206_A0905 0.0 Click
26complement(4706612..4706890) conserved hypothetical protein; ECH7EC4206_A0904 0.0 Click
27complement(4706901..4707251) conserved hypothetical protein; ECH7EC4206_A0903 0.0 Click
28complement(4707273..4707476) PHAGE_Vibrio_kappa: putative regulator; ECH7EC4206_A0902; phage(gi165970239) 6e-10 Click
294707775..4708179 PHAGE_Burkho_BcepMu: gp17; ECH7EC4206_A0901; phage(gi48696927) 4e-25 Click
304708195..4708845 conserved hypothetical protein; ECH7EC4206_A0900 0.0 Click
314708875..4709222 conserved hypothetical protein; ECH7EC4206_A0899 0.0 Click
324709206..4709217 attR    ATTTATGTGATA 0.0 Click
334709228..4710229 PHAGE_Salmon_RE_2010: integrase; ECH7EC4206_A0898; phage(gi418489683) 5e-100 Click

Region 17, total : 116 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15033984..5033995 attL    TTAAATATGAAT 0.0 Click
2complement(5046837..5047397) PHAGE_Bacill_SPBc2: hypothetical protein SPBc2p012; ECH7EC4206_A0542; phage(gi9630137) 1e-08 Click
3complement(5047432..5047773) conserved hypothetical protein; ECH7EC4206_A0541 0.0 Click
45047908..5048234 conserved hypothetical protein; ECH7EC4206_A0540 0.0 Click
5complement(5048497..5048703) PHAGE_Entero_2008: putative integrase; ECH7EC4206_A0539; phage(gi209427727) 1e-18 Click
6complement(5049223..5049459) PHAGE_Entero_2008: putative excisionase; ECH7EC4206_A0537; phage(gi209427728) 4e-16 Click
7complement(5049547..5050929) PHAGE_Entero_mEp460: putative exonuclease; ECH7EC4206_A0536; phage(gi428782342) 2e-58 Click
8complement(5050982..5051872) PROPHAGE_Escher_Sakai: putative transposase; ECH7EC4206_A0535; phage(gi15834498) 2e-173 Click
9complement(5051869..5052195) PHAGE_Stx2_c_II: putative transposase; ECH7EC4206_A0534; phage(gi302393161) 1e-58 Click
10complement(5052201..5053331) PHAGE_Pectob_ZF40: putative exonuclease; ECH7EC4206_A0533; phage(gi422936647) 3e-12 Click
11complement(5053424..5053615) conserved hypothetical protein; ECH7EC4206_A0532 0.0 Click
12complement(5053612..5053800) division inhibition protein DicB; ECH7EC4206_A0531 0.0 Click
135053829..5053999 conserved hypothetical protein; ECH7EC4206_A0530 0.0 Click
14complement(5054369..5054587) hypothetical protein; ECH7EC4206_A0529 0.0 Click
15complement(5055591..5055782) conserved hypothetical protein; ECH7EC4206_A0528 0.0 Click
16complement(5055804..5056022) putative repressor protein encoded by cryptic prophage CP-933P; ECH7EC4206_A0527 0.0 Click
175056572..5056997 PHAGE_Entero_mEp237: CII protein; ECH7EC4206_A0526; phage(gi435439306) 3e-05 Click
185057005..5057982 PHAGE_Entero_phiP27: hypothetical protein P27p17; ECH7EC4206_A0525; phage(gi18249881) 3e-32 Click
195057989..5058729 PHAGE_Gifsy_2: bacteriophage DNA replication protein; ECH7EC4206_A0524; phage(gi169257280) 8e-77 Click
205059540..5059935 putative exclusion protein ren of cryptic prophage CP-933P; ECH7EC4206_A0521 0.0 Click
215059992..5060576 PHAGE_Entero_cdtI: Valyl-tRNA synthetase; ECH7EC4206_A0520; phage(gi148609417) 2e-14 Click
225060647..5060796 conserved hypothetical protein; ECH7EC4206_A0519 0.0 Click
235061645..5062694 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4206_A0517; phage(gi428782365) 4e-110 Click
245062707..5063066 PHAGE_Escher_HK75: RusA-like protein; ECH7EC4206_A0516; phage(gi356870726) 1e-38 Click
255063063..5063752 PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECH7EC4206_A0515; phage(gi169257244) 1e-80 Click
265063783..5063905 hypothetical protein; ECH7EC4206_A0514 0.0 Click
275063963..5064038 tRNA 0.0 Click
285064045..5064123 tRNA 0.0 Click
295064135..5064213 tRNA 0.0 Click
305064815..5064982 PHAGE_Entero_P1: TciB; ECH7EC4206_A0509; phage(gi46401695) 1e-08 Click
315065297..5067147 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECH7EC4206_A0507; phage(gi209427766) 0.0 Click
325067596..5067802 PHAGE_Entero_2008: lysis protein; ECH7EC4206_A0505; phage(gi209427767) 6e-33 Click
335067807..5068151 PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECH7EC4206_A0504; phage(gi209427768) 9e-61 Click
345068202..5068735 PHAGE_Entero_2008: putative endolysin; ECH7EC4206_A0503; phage(gi209427769) 3e-104 Click
355069006..5069575 PHAGE_Entero_2008: putative antirepressor; ECH7EC4206_A0502; phage(gi209427770) 7e-107 Click
365069575..5069691 PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; ECH7EC4206_A0501; phage(gi302861202) 3e-15 Click
375069729..5070196 PHAGE_Entero_2008: putative endopeptidase; ECH7EC4206_A0500; phage(gi209427771) 1e-82 Click
38complement(5070559..5070726) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECH7EC4206_A0499; phage(gi209427772) 7e-26 Click
395070828..5071193 PHAGE_Entero_2008: putative DNAse; ECH7EC4206_A0498; phage(gi209427773) 3e-58 Click
405071485..5072048 PHAGE_Entero_2008: putative phage terminase; ECH7EC4206_A0497; phage(gi209427774) 1e-95 Click
415072045..5073706 PHAGE_Entero_2008: putative phage terminase-like protein large subunit; ECH7EC4206_A0496; phage(gi209427775) 0.0 Click
425073770..5075707 PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECH7EC4206_A0495; phage(gi209427776) 0.0 Click
435075919..5078498 PHAGE_Entero_2008: putative portal protein; ECH7EC4206_A0494; phage(gi209427777) 0.0 Click
445078501..5078827 PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ECH7EC4206_A0493; phage(gi209427778) 3e-55 Click
455078837..5079187 PHAGE_Entero_2008: putative head-tail adaptor; ECH7EC4206_A0492; phage(gi209427779) 8e-62 Click
465079184..5079630 PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ECH7EC4206_A0491; phage(gi209427780) 2e-80 Click
475079627..5079971 PHAGE_Entero_2008: putative prophage structural protein; ECH7EC4206_A0490; phage(gi209427781) 6e-60 Click
485080768..5081142 PHAGE_Entero_2008: putative tail assembly protein; ECH7EC4206_A0488; phage(gi209427783) 4e-67 Click
495081244..5081447 PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECH7EC4206_A0487; phage(gi209427784) 6e-33 Click
505081495..5084737 PHAGE_Entero_2008: putative tail protein; ECH7EC4206_A0486; phage(gi209427785) 0.0 Click
515084730..5085071 PHAGE_Entero_2008: putative minor tail protein; ECH7EC4206_A0485; phage(gi209427786) 4e-64 Click
525085071..5085508 PHAGE_Entero_2008: putative tail protein; ECH7EC4206_A0484; phage(gi209427787) 3e-62 Click
535085486..5085629 hypothetical protein; ECH7EC4206_A0483 0.0 Click
545089242..5089841 PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECH7EC4206_A0480; phage(gi209427792) 2e-114 Click
555089906..5091129 PHAGE_Entero_2008: putative tail protein; ECH7EC4206_A0479; phage(gi209427793) 0.0 Click
565091131..5091400 PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ECH7EC4206_A0478; phage(gi209427794) 5e-45 Click
575091514..5092089 PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECH7EC4206_A0477; phage(gi209427795) 3e-21 Click
585092380..5092526 conserved hypothetical protein; ECH7EC4206_A0476 0.0 Click
595092732..5092743 attR    TTAAATATGAAT 0.0 Click
605092800..5093450 PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECH7EC4206_A0475; phage(gi209427795) 3e-21 Click
615093560..5093571 attL    TTTTGATATGTT 0.0 Click
625093600..5094022 PROPHAGE_Escher_CFT073: transposase; ECH7EC4206_A0474; phage(gi26246249) 9e-39 Click
63complement(5094033..5095571) PHAGE_Stx2_c_1717: transposase; ECH7EC4206_A0473; phage(gi209447153) 0.0 Click
64complement(5095621..5095968) PHAGE_Stx2_c_1717: transposase; ECH7EC4206_A0472; phage(gi209447152) 2e-62 Click
655096389..5097258 PROPHAGE_Escher_CFT073: transposase; ECH7EC4206_A0471; phage(gi26246249) 1e-126 Click
66complement(5097308..5097514) PHAGE_Entero_2008: putative DNA damage-inducible protein; ECH7EC4206_A0470; phage(gi209427797) 5e-28 Click
67complement(5097728..5098279) PHAGE_Entero_2008: putative integrase; ECH7EC4206_A0469; phage(gi209427727) 2e-61 Click
68complement(5099599..5099787) conserved hypothetical protein; ECH7EC4206_A0466 0.0 Click
69complement(5099784..5099972) conserved domain protein; ECH7EC4206_A0465 0.0 Click
705100083..5100238 hypothetical protein; ECH7EC4206_A0463 0.0 Click
715100537..5100746 hypothetical protein; ECH7EC4206_A0462 0.0 Click
72complement(5100747..5101385) PHAGE_Escher_TL_2011c: hypothetical protein; ECH7EC4206_A0461; phage(gi418487085) 6e-09 Click
73complement(5101397..5101630) PHAGE_Salico_CGphi29: hypothetical protein; ECH7EC4206_A0460; phage(gi472340166) 5e-09 Click
74complement(5101842..5102441) PHAGE_Pectob_ZF40: putative cI repressor; ECH7EC4206_A0459; phage(gi422936650) 2e-17 Click
755102572..5102814 PHAGE_Pectob_ZF40: putative cro anti-repressor; ECH7EC4206_A0458; phage(gi422936651) 5e-09 Click
765103291..5104334 PHAGE_Escher_TL_2011b: hypothetical protein; ECH7EC4206_A0456; phage(gi418487646) 3e-48 Click
775104327..5104788 PHAGE_Escher_HK639: replication protein 14; ECH7EC4206_A0455; phage(gi356870655) 5e-29 Click
785104822..5105538 conserved hypothetical protein; ECH7EC4206_A0454 0.0 Click
795105598..5105852 conserved hypothetical protein; ECH7EC4206_A0453 0.0 Click
805105849..5106076 PHAGE_Salmon_1: hypothetical protein STM0896.1n.Fels1; ECH7EC4206_A0452; phage(gi169257161) 2e-16 Click
815106069..5106380 PHAGE_Entero_mEp213: hypothetical protein; ECH7EC4206_A0451; phage(gi428782634) 9e-21 Click
825106508..5106726 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip090; ECH7EC4206_A0450; phage(gi20065885) 3e-24 Click
835106728..5107285 PHAGE_Escher_TL_2011c: hypothetical protein; ECH7EC4206_A0449; phage(gi418487081) 6e-28 Click
845107851..5108195 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip070; ECH7EC4206_A0447; phage(gi20065865) 8e-59 Click
855108317..5108589 PHAGE_Gifsy_2: hypothetical protein STM1021.1n.Gifsy2; ECH7EC4206_A0446; phage(gi169257287) 5e-14 Click
865108537..5109640 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4206_A0445; phage(gi428782365) 6e-112 Click
87complement(5111617..5111748) hypothetical protein; ECH7EC4206_A0002 0.0 Click
885111950..5112996 PHAGE_Entero_mEp460: hypothetical protein; ECH7EC4206_A0003; phage(gi428782365) 2e-109 Click
895113009..5113368 PHAGE_Escher_HK75: RusA-like protein; ECH7EC4206_A0004; phage(gi356870726) 6e-36 Click
905113377..5113907 conserved hypothetical protein; ECH7EC4206_A0005 0.0 Click
915114149..5114346 PHAGE_Entero_phiP27: hypothetical protein P27p23; ECH7EC4206_A0006; phage(gi18249887) 1e-29 Click
925114497..5115555 PHAGE_Entero_phiP27: putative DNA methylase; ECH7EC4206_A0007; phage(gi18249888) 0.0 Click
935115596..5115671 tRNA 0.0 Click
945115751..5115829 tRNA 0.0 Click
955117322..5117537 PHAGE_Stx2_c_1717: holin protein S-like protein; ECH7EC4206_A0012; phage(gi209447171) 7e-35 Click
965117542..5117886 PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECH7EC4206_A0013; phage(gi209427768) 9e-61 Click
975117937..5118470 PHAGE_Entero_2008: putative endolysin; ECH7EC4206_A0014; phage(gi209427769) 3e-104 Click
985118741..5119310 PHAGE_Entero_2008: putative antirepressor; ECH7EC4206_A0015; phage(gi209427770) 7e-107 Click
995119310..5119456 PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; ECH7EC4206_A0016; phage(gi302861202) 2e-20 Click
1005119464..5119931 PHAGE_Entero_2008: putative endopeptidase; ECH7EC4206_A0017; phage(gi209427771) 2e-75 Click
1015120014..5120154 conserved hypothetical protein; ECH7EC4206_A0018 0.0 Click
1025120180..5120347 hypothetical protein; ECH7EC4206_A0019 0.0 Click
103complement(5120791..5120955) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECH7EC4206_A0020; phage(gi209427772) 5e-08 Click
1045121402..5121947 PHAGE_Entero_HK630: terminase small subunit nu1; ECH7EC4206_A0022; phage(gi428782788) 2e-82 Click
1055121922..5123847 PHAGE_Entero_HK630: terminase large subunit A; ECH7EC4206_A0023; phage(gi428782789) 0.0 Click
1065123844..5124050 PHAGE_Entero_HK630: head-tail connector W; ECH7EC4206_A0024; phage(gi428782790) 1e-31 Click
1075124047..5125648 PHAGE_Entero_HK630: portal protein B; ECH7EC4206_A0025; phage(gi428782791) 0.0 Click
1085125629..5126948 PHAGE_Entero_HK630: head maturation protease C; ECH7EC4206_A0026; phage(gi428782792) 0.0 Click
1095126958..5127290 PHAGE_Entero_HK630: head decoration protein D; ECH7EC4206_A0027; phage(gi428782794) 7e-58 Click
1105127319..5128371 PHAGE_Entero_HK630: major head subunit E; ECH7EC4206_A0028; phage(gi428782795) 0.0 Click
1115128413..5128811 PHAGE_Entero_HK225: head assembly protein Fi; ECH7EC4206_A0029; phage(gi428782384) 7e-21 Click
1125128823..5129176 PHAGE_Entero_HK630: head-tail connector Fii; ECH7EC4206_A0030; phage(gi428782797) 2e-58 Click
1135129191..5129724 PHAGE_Entero_HK630: minor tail protein Z; ECH7EC4206_A0031; phage(gi428782798) 2e-65 Click
1145129721..5130116 PHAGE_Entero_HK630: minor tail protein U; ECH7EC4206_A0032; phage(gi428782799) 6e-59 Click
1155130124..5130876 PHAGE_Entero_HK630: major tail protein V; ECH7EC4206_A0033; phage(gi428782800) 1e-112 Click
1165131339..5131647 PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4206_A0035; phage(gi15832204) 2e-56 Click
1175131691..5134336 PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; ECH7EC4206_A0036; phage(gi15832203) 0.0 Click
1185134333..5134662 PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4206_A0037; phage(gi15832202) 3e-60 Click
1195134662..5135360 PHAGE_Entero_2008: putative tail protein; ECH7EC4206_A0038; phage(gi209427787) 5e-130 Click
1205136111..5136689 PHAGE_Entero_2008: putative tail assembly protein; ECH7EC4206_A0040; phage(gi209427790) 7e-102 Click
1215136735..5136854 hypothetical protein; ECH7EC4206_A0041 0.0 Click
1225136930..5139785 PHAGE_Entero_2008: phage-related tail protein; ECH7EC4206_A0042; phage(gi209427791) 0.0 Click
1235139853..5140452 PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECH7EC4206_A0043; phage(gi209427792) 9e-94 Click
1245140604..5141908 PHAGE_Entero_2008: putative tail protein; ECH7EC4206_A0044; phage(gi209427793) 0.0 Click
1255141910..5142179 PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ECH7EC4206_A0045; phage(gi209427794) 1e-43 Click
1265147328..5147339 attR    TTTTGATATGTT 0.0 Click

Region 18, total : 57 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(5158820..5161264) PHAGE_Entero_mEp460: putative exonuclease; ECH7EC4206_A0063; phage(gi428782342) 9e-59 Click
2complement(5161357..5161545) conserved hypothetical protein; ECH7EC4206_A0064 0.0 Click
35162128..5162292 conserved hypothetical protein; ECH7EC4206_A0066 0.0 Click
4complement(5162296..5162514) hypothetical protein; ECH7EC4206_A0067 0.0 Click
5complement(5162544..5162672) hypothetical protein; ECH7EC4206_A0068 0.0 Click
6complement(5162674..5162829) PHAGE_Salico_CGphi29: hypothetical protein; ECH7EC4206_A0069; phage(gi472340166) 8e-09 Click
7complement(5163019..5163153) PHAGE_Cronob_phiES15: putative transcriptional repressor DicA; ECH7EC4206_A0070; phage(gi401817574) 8e-07 Click
85163192..5163398 hypothetical protein; ECH7EC4206_A0071 0.0 Click
95163504..5163731 PHAGE_Salmon_vB_SemP_Emek: Cro; ECH7EC4206_A0072; phage(gi399498837) 1e-09 Click
105163775..5164266 conserved hypothetical protein; ECH7EC4206_A0073 0.0 Click
115165310..5165732 PHAGE_Escher_HK639: replication protein 14; ECH7EC4206_A0075; phage(gi356870655) 1e-31 Click
125165767..5166537 conserved hypothetical protein; ECH7EC4206_A0076 0.0 Click
135166553..5166948 putative exclusion protein ren of cryptic prophage CP-933P; ECH7EC4206_A0077 0.0 Click
145167005..5167361 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip073; ECH7EC4206_A0078; phage(gi20065868) 1e-07 Click
155167410..5167622 conserved hypothetical protein; ECH7EC4206_A0079 0.0 Click
165167658..5168029 PHAGE_Entero_cdtI: Valyl-tRNA synthetase; ECH7EC4206_A0080; phage(gi148609417) 2e-10 Click
175168026..5168388 PHAGE_Entero_HK022: hypothetical protein HK022p33; ECH7EC4206_A0081; phage(gi19343382) 4e-61 Click
185168459..5168608 conserved hypothetical protein; ECH7EC4206_A0082 0.0 Click
195169230..5169487 conserved hypothetical protein; ECH7EC4206_A0083 0.0 Click
205169837..5170886 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp51; ECH7EC4206_A0085; phage(gi148609433) 4e-101 Click
215170899..5171273 PHAGE_Escher_HK75: RusA-like protein; ECH7EC4206_A0086; phage(gi356870726) 3e-35 Click
225171270..5172091 PHAGE_Entero_HK225: late gene regulator Q; ECH7EC4206_A0087; phage(gi428782441) 2e-93 Click
235172318..5172515 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp55; ECH7EC4206_A0088; phage(gi148609437) 8e-09 Click
245172666..5173724 PHAGE_Entero_cdtI: putative DNA methylase; ECH7EC4206_A0089; phage(gi148609438) 4e-175 Click
255173766..5173840 tRNA 0.0 Click
26complement(5173771..5173890) hypothetical protein; ECH7EC4206_A0091 0.0 Click
27complement(5173932..5174078) conserved hypothetical protein; ECH7EC4206_A0092 0.0 Click
285174318..5176264 PHAGE_Stx1_converting: hypothetical protein Stx1_gp75; ECH7EC4206_A0093; phage(gi302861197) 0.0 Click
295176401..5176580 PHAGE_Escher_P13374: hypothetical protein; ECH7EC4206_A0094; phage(gi410491643) 2e-28 Click
305176621..5176866 PHAGE_Escher_P13374: hypothetical protein; ECH7EC4206_A0095; phage(gi410491644) 6e-39 Click
315176944..5177159 PHAGE_Escher_P13374: lysis protein, holin; ECH7EC4206_A0096; phage(gi410491645) 2e-35 Click
325177163..5177720 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp05; ECH7EC4206_A0097; phage(gi116221997) 1e-49 Click
335177757..5178290 PHAGE_Escher_TL_2011c: lysozyme; ECH7EC4206_A0098; phage(gi418487070) 3e-101 Click
345178589..5179056 PHAGE_Entero_4795: putative endopeptidase Rz; ECH7EC4206_A0099; phage(gi157166036) 3e-78 Click
355179469..5179945 PHAGE_Entero_mEp460: terminase small subunit; ECH7EC4206_A0100; phage(gi428782317) 2e-46 Click
365179942..5182065 PHAGE_Entero_cdtI: putative large terminase subunit; ECH7EC4206_A0101; phage(gi148609384) 0.0 Click
375182062..5182274 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp03; ECH7EC4206_A0102; phage(gi148609385) 9e-24 Click
385182274..5183776 PHAGE_Entero_cdtI: putative portal protein; ECH7EC4206_A0103; phage(gi148609386) 0.0 Click
395183790..5185745 PHAGE_Entero_cdtI: putative protease/scaffold protein; ECH7EC4206_A0104; phage(gi148609387) 0.0 Click
405185833..5186159 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp06; ECH7EC4206_A0105; phage(gi148609388) 2e-22 Click
415186185..5186433 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp07; ECH7EC4206_A0106; phage(gi148609389) 7e-13 Click
425186436..5187059 PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4206_A0107; phage(gi15832208) 3e-111 Click
435187072..5187470 PROPHAGE_Escher_Sakai: putative minor tail protein U; ECH7EC4206_A0108; phage(gi15832207) 1e-72 Click
445187478..5188230 PHAGE_Entero_HK630: major tail protein V; ECH7EC4206_A0109; phage(gi428782800) 1e-112 Click
455188244..5188666 PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4206_A0110; phage(gi15832205) 1e-74 Click
465188717..5189001 PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4206_A0111; phage(gi15832204) 4e-52 Click
475189045..5191690 PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; ECH7EC4206_A0112; phage(gi15832203) 0.0 Click
485191687..5192016 PROPHAGE_Escher_Sakai: putative minor tail protein; ECH7EC4206_A0113; phage(gi15832202) 3e-60 Click
495192016..5192714 PHAGE_Entero_4795: putative tail fiber component; ECH7EC4206_A0114; phage(gi157166054) 8e-132 Click
505192833..5193468 PHAGE_Entero_cdtI: putative tail protein; ECH7EC4206_A0115; phage(gi148609398) 1e-112 Click
515193465..5194043 PHAGE_Stx2_c_1717: putative tail component; ECH7EC4206_A0116; phage(gi209447195) 2e-102 Click
525194089..5194208 hypothetical protein; ECH7EC4206_A0117 0.0 Click
535194284..5197760 PHAGE_Entero_cdtI: putative tail tip assembly protein; ECH7EC4206_A0118; phage(gi148609400) 0.0 Click
545197828..5198427 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; ECH7EC4206_A0119; phage(gi148609401) 2e-108 Click
55complement(5198428..5198556) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; ECH7EC4206_A0120; phage(gi157166059) 8e-19 Click
565199527..5199805 PHAGE_Escher_TL_2011c: putative tail fiber protein; ECH7EC4206_A0121; phage(gi418487108) 2e-51 Click
575199807..5200076 PHAGE_Stx2_c_II: putative tail fiber protein; ECH7EC4206_A0123; phage(gi302393091) 9e-43 Click
585200638..5201033 PROPHAGE_Escher_MG1655: IS1 transposase B; ECH7EC4206_A0125; phage(gi16131317) 1e-66 Click
595201209..5201799 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp23; ECH7EC4206_A0126; phage(gi148609405) 4e-09 Click

Region 19, total : 41 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15489802..5490005 PHAGE_Salmon_SSU5: putative selenium-binding protein YdfZ; ECH7EC4206_A0403; phage(gi410491512) 1e-13 Click
2complement(5491592..5492875) PHAGE_Burkho_phi1026b: gp59; ECH7EC4206_A0405; phage(gi38707949) 2e-33 Click
35493043..5493249 PHAGE_Entero_2008: putative DNA damage-inducible protein; ECH7EC4206_A0406; phage(gi209427797) 5e-28 Click
4complement(5493411..5493905) PHAGE_Entero_2008: hypothetical protein YYZ_gp73; ECH7EC4206_A0407; phage(gi209427796) 3e-89 Click
5complement(5494134..5494535) PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECH7EC4206_A0408; phage(gi209427795) 6e-71 Click
6complement(5494836..5495171) PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECH7EC4206_A0409; phage(gi209427795) 2e-19 Click
7complement(5495525..5495794) PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ECH7EC4206_A0410; phage(gi209427794) 5e-46 Click
8complement(5495796..5497109) PHAGE_Entero_2008: putative tail protein; ECH7EC4206_A0411; phage(gi209427793) 0.0 Click
9complement(5497174..5497773) PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECH7EC4206_A0412; phage(gi209427792) 2e-114 Click
10complement(5497841..5500354) PHAGE_Entero_2008: phage-related tail protein; ECH7EC4206_A0413; phage(gi209427791) 0.0 Click
11complement(5500351..5501919) PHAGE_Entero_2008: phage-related tail protein; ECH7EC4206_A0414; phage(gi209427791) 0.0 Click
12complement(5502261..5502842) PHAGE_Entero_2008: putative tail assembly protein; ECH7EC4206_A0415; phage(gi209427790) 2e-101 Click
13complement(5502839..5503513) PHAGE_Entero_2008: putative tail component K-like protein; ECH7EC4206_A0416; phage(gi209427789) 2e-127 Click
14complement(5503593..5504291) PHAGE_Entero_2008: putative tail protein; ECH7EC4206_A0417; phage(gi209427787) 4e-126 Click
15complement(5504291..5504632) PHAGE_Entero_2008: putative minor tail protein; ECH7EC4206_A0418; phage(gi209427786) 4e-64 Click
16complement(5504625..5507867) PHAGE_Entero_2008: putative tail protein; ECH7EC4206_A0419; phage(gi209427785) 0.0 Click
17complement(5507919..5508122) PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECH7EC4206_A0420; phage(gi209427784) 3e-32 Click
18complement(5508224..5508598) PHAGE_Entero_2008: putative tail assembly protein; ECH7EC4206_A0421; phage(gi209427783) 2e-65 Click
19complement(5508604..5509320) PHAGE_Entero_2008: putative tail protein; ECH7EC4206_A0422; phage(gi209427782) 5e-122 Click
20complement(5510163..5510513) PHAGE_Entero_2008: putative head-tail adaptor; ECH7EC4206_A0425; phage(gi209427779) 9e-61 Click
21complement(5510523..5510849) PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ECH7EC4206_A0426; phage(gi209427778) 6e-54 Click
22complement(5512890..5513111) PHAGE_Entero_2008: hypothetical protein YYZ_gp53; ECH7EC4206_A0429; phage(gi209427801) 5e-35 Click
23complement(5513156..5513689) PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECH7EC4206_A0430; phage(gi209427776) 1e-92 Click
24complement(5513655..5514062) PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECH7EC4206_A0431; phage(gi209427768) 9e-54 Click
25complement(5514067..5514273) PHAGE_Entero_2008: lysis protein; ECH7EC4206_A0432; phage(gi209427767) 6e-33 Click
265514281..5514442 conserved hypothetical protein; ECH7EC4206_A0433 0.0 Click
27complement(5514721..5516571) PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECH7EC4206_A0434; phage(gi209427766) 0.0 Click
28complement(5516885..5517052) PHAGE_Entero_P1: TciB; ECH7EC4206_A0436; phage(gi46401695) 1e-08 Click
29complement(5517049..5517480) PHAGE_Pseudo_AF: putative tellurite resistance protein; ECH7EC4206_A0437; phage(gi431810338) 1e-28 Click
30complement(5517649..5517727) tRNA 0.0 Click
31complement(5517827..5517902) tRNA 0.0 Click
32complement(5517931..5518518) putative transcriptional regulator; ECH7EC4206_A0440 0.0 Click
335518535..5518675 hypothetical protein; ECH7EC4206_A0441 0.0 Click
34complement(5518780..5519100) PHAGE_Entero_phiP27: hypothetical protein P27p23; ECH7EC4206_A0442; phage(gi18249887) 7e-29 Click
35complement(5520044..5522623) PHAGE_Entero_HK630: tail length tape measure protein H; ECH7EC4206_B0010; phage(gi428782803) 0.0 Click
36complement(5522604..5522993) PHAGE_Entero_HK630: tail assembly protein GT; ECH7EC4206_B0011; phage(gi428782802) 4e-43 Click
37complement(5523044..5523475) PHAGE_Entero_HK630: minor tail protein G; ECH7EC4206_B0012; phage(gi428782801) 5e-45 Click
38complement(5523489..5524151) PHAGE_Entero_HK630: major tail protein V; ECH7EC4206_B0013; phage(gi428782800) 5e-97 Click
39complement(5524211..5524471) PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; ECH7EC4206_B0014; phage(gi169257230) 8e-36 Click
40complement(5524535..5524882) PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; ECH7EC4206_B0015; phage(gi169257231) 9e-43 Click
41complement(5524919..5526424) PHAGE_Gifsy_1: bacteriophage prohead protease; Lambda gpC homolog; ECH7EC4206_B0016; phage(gi169257232) 4e-175 Click
42complement(5526414..5528006) PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; ECH7EC4206_B0017; phage(gi169257233) 0.0 Click
43complement(5528003..5528209) PHAGE_Entero_mEp237: head-tail connector; ECH7EC4206_B0018; phage(gi435439268) 1e-13 Click