Salmonella enterica subsp. enterica serovar Virchow str. SL491 [asmbl_id: NC_000000].4867829, GC%: 52.08%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 28 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(704197..704544) PHAGE_Burkho_BcepMu: gp01; SeV_B0702; phage(gi48696911) 7e-24 Click
2complement(704498..704638) hypothetical protein; SeV_B0703 0.0 Click
3705120..705407 PHAGE_Burkho_BcepMu: gp21; SeV_B0704; phage(gi48696931) 7e-21 Click
4705410..706015 PHAGE_Burkho_BcepMu: gp22; SeV_B0705; phage(gi48696932) 1e-57 Click
5706028..706342 PHAGE_Burkho_BcepMu: gp25; SeV_B0706; phage(gi48696935) 3e-23 Click
6706502..706957 PHAGE_Burkho_BcepMu: gp37; SeV_B0707; phage(gi48696947) 3e-13 Click
7706954..707151 PHAGE_Burkho_BcepMu: gp38; SeV_B0708; phage(gi48696948) 2e-08 Click
8707141..708568 PHAGE_Burkho_BcepMu: gp39; SeV_B0709; phage(gi48696949) 0.0 Click
9708568..709092 PHAGE_Burkho_BcepMu: gp40; SeV_B0710; phage(gi48696950) 1e-68 Click
10709144..709461 PHAGE_Burkho_BcepMu: gp41; SeV_B0711; phage(gi48696951) 1e-09 Click
11709421..709549 conserved hypothetical protein; SeV_B0712 0.0 Click
12709646..712000 PHAGE_Burkho_BcepMu: gp44; SeV_B0713; phage(gi48696954) 7e-67 Click
13712000..712953 PHAGE_Burkho_BcepMu: gp45; SeV_B0714; phage(gi48696955) 5e-46 Click
14712953..713162 PHAGE_Burkho_BcepMu: gp46; SeV_B0715; phage(gi48696956) 9e-19 Click
15713150..714193 PHAGE_Burkho_BcepMu: gp47; SeV_B0716; phage(gi48696957) 6e-80 Click
16714203..714925 PHAGE_Burkho_BcepMu: gp48; SeV_B0717; phage(gi48696958) 4e-40 Click
17715241..715615 PHAGE_Entero_SfV: putative flippase; SeV_B0718; phage(gi19549013) 7e-48 Click
18715612..716541 PHAGE_Entero_SfV: bactoprenol glucosyltransferase; SeV_B0719; phage(gi19549012) 4e-151 Click
19716550..718088 PHAGE_Salmon_epsilon34: GtrC; putative membrane protein; SeV_B0720; phage(gi221328637) 3e-59 Click
20complement(718069..718191) hypothetical protein; SeV_B0721 0.0 Click
21718252..718611 PHAGE_Burkho_BcepMu: gp49; SeV_B0722; phage(gi48696959) 4e-35 Click
22718602..719717 PHAGE_Burkho_BcepMu: gp50; SeV_B0723; phage(gi48696960) 2e-103 Click
23719710..720342 PHAGE_Burkho_BcepMu: gp51; SeV_B0724; phage(gi48696961) 4e-26 Click
24720345..722111 PHAGE_Entero_PsP3: gp19; SeV_B0725; phage(gi41057371) 8e-76 Click
25722116..722721 PHAGE_Haemop_Aaphi23: putative tail fiber assembly protein; SeV_B0726; phage(gi31544054) 3e-05 Click
26722718..723161 PHAGE_Haemop_SuMu: enoyl-CoA hydratase/carnithine racemase-like protein; SeV_B0727; phage(gi418489075) 3e-21 Click
27723482..723964 serine acetyltransferase; SeV_B0728 0.0 Click
28724538..725266 PHAGE_Entero_P1: PmgQ; SeV_B0729; phage(gi46401711) 7e-34 Click

Region 2, total : 79 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12273590..2273602 attL    TTCGGGGCTTTTT 0.0 Click
2complement(2275837..2276850) PHAGE_Entero_2: P2 Int-like protein; SeV_B2347; phage(gi169936064) 3e-137 Click
3complement(2276850..2277119) PHAGE_Haemop_HP2: cI repressor; SeV_B2348; phage(gi17981818) 1e-07 Click
42277718..2278308 PHAGE_Entero_2: bacteriophage regulatory protein CII; SeV_B2349; phage(gi169936061) 2e-38 Click
52278318..2278545 conserved hypothetical protein; SeV_B2350 0.0 Click
6complement(2278826..2278957) hypothetical protein; SeV_B2351 0.0 Click
72278960..2279361 hypothetical protein; SeV_B2352 0.0 Click
82279429..2279659 conserved hypothetical protein; SeV_B2353 0.0 Click
92280507..2282528 PHAGE_Erwini_ENT90: replication protein A; SeV_B2355; phage(gi431810936) 2e-129 Click
102282647..2282859 PHAGE_Entero_2: hypothetical protein STM2728.Fels2; SeV_B2356; phage(gi169936053) 6e-09 Click
11complement(2283153..2284214) PHAGE_Vibrio_kappa: hypothetical pbsx family phage portal protein; SeV_B2357; phage(gi165970255) 7e-79 Click
12complement(2284211..2285986) PHAGE_Vibrio_kappa: putative terminase ATPase subunit; SeV_B2358; phage(gi165970256) 0.0 Click
13complement(2285994..2286107) hypothetical protein; SeV_B2359 0.0 Click
142286147..2286947 PHAGE_Aeromo_phiO18P: putative capsid scaffolding protein; SeV_B2360; phage(gi148727152) 4e-32 Click
152287009..2288031 PHAGE_Aeromo_phiO18P: putative major capsid protein; SeV_B2361; phage(gi148727153) 6e-93 Click
162288035..2288736 PHAGE_Aeromo_phiO18P: putative terminase small subunit; SeV_B2362; phage(gi148727154) 4e-55 Click
172288782..2289285 PHAGE_Aeromo_phiO18P: putative head completion protein; SeV_B2363; phage(gi148727155) 4e-31 Click
182289282..2289788 PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_27; SeV_B2364; phage(gi148727156) 3e-13 Click
192289785..2290492 PHAGE_Aeromo_phiO18P: putative tail completion protein; SeV_B2365; phage(gi148727157) 9e-38 Click
202290489..2291616 PHAGE_Aeromo_phiO18P: putative tail sheath protein; SeV_B2366; phage(gi148727158) 2e-107 Click
212291613..2292068 PHAGE_Aeromo_phiO18P: putative tail tube protein; SeV_B2367; phage(gi148727159) 2e-49 Click
222292078..2292371 PHAGE_Burkho_KS9: holin gp22; SeV_B2368; phage(gi255033753) 1e-17 Click
232292368..2292709 PHAGE_Pseudo_PaP2: hypothetical protein PaP2_gp17; SeV_B2369; phage(gi48697087) 7e-26 Click
242292709..2293041 PHAGE_Erwini_phiEa104: hypothetical protein; SeV_B2370; phage(gi327198401) 2e-10 Click
252293158..2293445 PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_36; SeV_B2372; phage(gi148727164) 3e-23 Click
262293633..2295603 PHAGE_Aeromo_phiO18P: putative tail tape measure protein; SeV_B2373; phage(gi148727166) 6e-78 Click
272295600..2295929 PHAGE_Haemop_HP1: hypothetical protein HP1p35; SeV_B2374; phage(gi9628634) 4e-28 Click
282295926..2297110 PHAGE_Haemop_HP2: orf29; SeV_B2375; phage(gi17981845) 4e-115 Click
292297103..2297690 PHAGE_Haemop_HP2: orf30; SeV_B2376; phage(gi17981846) 2e-46 Click
302297700..2299856 PHAGE_Salmon_ST64B: tail protein; SeV_B2377; phage(gi23505468) 6e-89 Click
312299869..2300423 PHAGE_Salmon_ST64B: Probable tail fiber assembly protein; SeV_B2378; phage(gi23505469) 1e-53 Click
322300413..2301138 PHAGE_Haemop_HP1: hypothetical protein HP1p40; SeV_B2379; phage(gi9628639) 2e-13 Click
332301110..2301655 PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_45; SeV_B2380; phage(gi148727174) 5e-40 Click
342301655..2303358 PHAGE_Haemop_HP2: orf35; SeV_B2381; phage(gi17981851) 6e-124 Click
35complement(2303488..2303628) hypothetical protein; SeV_B2382 0.0 Click
362304039..2305157 conserved hypothetical protein; SeV_B2383 0.0 Click
372305981..2305992 attL    CGTTATGCCGCT 0.0 Click
38complement(2305983..2306690) PHAGE_Erwini_ENT90: phage integrase family protein; SeV_B2384; phage(gi431810942) 1e-68 Click
39complement(2307274..2308299) PHAGE_Entero_2: P2 Int-like protein; SeV_B2385; phage(gi169936064) 0.0 Click
40complement(2308303..2308707) PHAGE_Entero_2: P2 CI-like protein; SeV_B2386; phage(gi169936063) 1e-70 Click
412309052..2309291 PHAGE_Entero_2: bacteriophage regulatory protein Ap1; SeV_B2387; phage(gi169936062) 2e-40 Click
422309327..2309836 PHAGE_Entero_2: bacteriophage regulatory protein CII; SeV_B2388; phage(gi169936061) 3e-92 Click
43complement(2310025..2310390) conserved hypothetical protein; SeV_B2389 0.0 Click
442310703..2311044 PHAGE_Entero_2: hypothetical protein STM2733.Fels2; SeV_B2390; phage(gi169936058) 3e-59 Click
452311112..2311345 PHAGE_Entero_2: hypothetical protein STM2732.Fels2; SeV_B2391; phage(gi169936057) 4e-37 Click
462311345..2311572 PHAGE_Entero_2: P2 gpOrf82-like protein; SeV_B2392; phage(gi169936056) 7e-40 Click
472311569..2312426 PHAGE_Entero_2: DNA adenine methylase-like protein; SeV_B2393; phage(gi169936055) 3e-168 Click
482312417..2314828 PHAGE_Entero_2: P2 gpA-like protein; SeV_B2394; phage(gi169936054) 0.0 Click
492314984..2315172 PHAGE_Entero_2: hypothetical protein STM2728.Fels2; SeV_B2395; phage(gi169936053) 3e-25 Click
502316054..2316764 PHAGE_Cronob_phiES15: hypothetical protein; SeV_B2397; phage(gi401817564) 5e-09 Click
512317071..2317535 PHAGE_Bacill_SPBc2: putative ATP/GTP-binding protein; SeV_B2398; phage(gi9630203) 9e-12 Click
52complement(2317579..2318619) PHAGE_Entero_2: P2 gpQ-like protein; SeV_B2399; phage(gi169936049) 0.0 Click
53complement(2318619..2320385) PHAGE_Entero_2: P2 gpP-like protein; SeV_B2400; phage(gi169936048) 0.0 Click
542320528..2321361 PHAGE_Entero_2: P2 gpO-like protein; SeV_B2401; phage(gi169936047) 9e-153 Click
552321378..2322442 PHAGE_Entero_2: P2 gpN-like major capsid protein; SeV_B2402; phage(gi169936046) 0.0 Click
562322446..2323096 PHAGE_Entero_2: P2 gpM-like protein; SeV_B2403; phage(gi169936045) 9e-117 Click
572323190..2323654 PHAGE_Entero_2: P2 gpL-like protein; SeV_B2404; phage(gi169936044) 7e-86 Click
582323654..2323857 PHAGE_Entero_2: P2 gpX-like tail protein; SeV_B2405; phage(gi169936043) 9e-35 Click
592323861..2324076 PHAGE_Entero_2: lysis protein; SeV_B2406; phage(gi169936042) 2e-35 Click
602324057..2324566 PHAGE_Entero_2: endolysin; SeV_B2407; phage(gi169936041) 4e-88 Click
612324571..2324948 conserved hypothetical protein; SeV_B2408 0.0 Click
622324948..2325373 PHAGE_Entero_2: P2 LysB-like protein; SeV_B2409; phage(gi169936038) 2e-69 Click
632325333..2325506 PHAGE_Entero_2: P2 LysC-like protein; SeV_B2410; phage(gi169936037) 2e-25 Click
642325469..2325900 PHAGE_Entero_2: P2 gpR-like tail completion protein; SeV_B2411; phage(gi169936036) 2e-74 Click
652325893..2326336 PHAGE_Entero_2: P2 gpS-like tail completion protein; SeV_B2412; phage(gi169936035) 2e-66 Click
66complement(2326387..2328093) PHAGE_Entero_2: hypothetical protein STM2723.1.Fels2; SeV_B2413; phage(gi169936050) 4e-07 Click
672328232..2328810 PHAGE_Entero_2: P2 gpV-like protein; SeV_B2414; phage(gi169936034) 2e-103 Click
682328807..2329166 PHAGE_Entero_2: P2 gpW-like baseplate protein; SeV_B2415; phage(gi169936033) 5e-60 Click
692329153..2330061 PHAGE_Entero_2: P2 gpJ-like baseplate assembly protein; SeV_B2416; phage(gi169936032) 2e-159 Click
702330054..2330659 PHAGE_Entero_2: P2 gpI-like baseplate assembly protein; SeV_B2417; phage(gi169936031) 7e-116 Click
712330656..2332434 PHAGE_Entero_2: P2 gpH-like protein; SeV_B2418; phage(gi169936030) 0.0 Click
722332434..2333021 PHAGE_Entero_2: P2 gpG-like protein; SeV_B2419; phage(gi169936029) 2e-95 Click
73complement(2333025..2333564) PHAGE_Escher_D108: probable tail fiber assembly protein; SeV_B2420; phage(gi281199695) 5e-64 Click
74complement(2333567..2334433) PHAGE_Escher_D108: tail fiber fragment; SeV_B2421; phage(gi281199697) 7e-39 Click
752335123..2336295 PHAGE_Entero_2: P2 gpFI-like protein; SeV_B2422; phage(gi169936025) 0.0 Click
762336305..2336820 PHAGE_Entero_2: P2 gpFII-like protein; SeV_B2423; phage(gi169936024) 7e-94 Click
772336875..2337177 PHAGE_Entero_2: P2 gpE-like tail protein; SeV_B2424; phage(gi169936023) 1e-48 Click
782337239..2337250 attR    CGTTATGCCGCT 0.0 Click
792337304..2340111 PHAGE_Entero_2: P2 gpT-like tail protein; SeV_B2426; phage(gi169936021) 0.0 Click
802340108..2340593 PHAGE_Entero_2: P2 gpU-like tail protein; SeV_B2427; phage(gi169936020) 4e-86 Click
812340590..2341690 PHAGE_Entero_2: P2 gpD-like tail protein; SeV_B2428; phage(gi169936019) 0.0 Click
822341737..2341976 PHAGE_Entero_2: P2 gpOgr-like protein (acttivation of late gene expression); SeV_B2429; phage(gi169936018) 7e-30 Click
832347851..2347863 attR    TTCGGGGCTTTTT 0.0 Click

Region 3, total : 65 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3713685..3714119) PHAGE_Cronob_vB_CsaM_GAP32: translation initiation factor IF-3; SeV_A0754; phage(gi414087231) 9e-13 Click
2complement(3714231..3716159) threonyl-tRNA synthetase; SeV_A0755 0.0 Click
33716188..3716225 attL    ATACGCAAGATCACATACAAAGAGAAAATGAATTTATT 0.0 Click
4complement(3716491..3717759) PHAGE_Salmon_vB_SosS_Oslo: error-prone lesion bypass DNA polymerase V; SeV_A0756; phage(gi399528790) 0.0 Click
5complement(3717762..3718238) PHAGE_Salmon_vB_SosS_Oslo: errror-prone repair protein UmuD; SeV_A0757; phage(gi399528789) 1e-37 Click
6complement(3718418..3719716) PHAGE_Salmon_vB_SosS_Oslo: minor tail protein; SeV_A0758; phage(gi399528788) 0.0 Click
7complement(3719727..3720686) PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SeV_A0759; phage(gi399528787) 0.0 Click
8complement(3720695..3723877) PHAGE_Salmon_vB_SosS_Oslo: tail fiber protein; SeV_A0760; phage(gi399528786) 0.0 Click
9complement(3723910..3724065) hypothetical protein; SeV_A0761 0.0 Click
10complement(3724563..3724910) PHAGE_Salmon_vB_SosS_Oslo: tail assembly protein; SeV_A0762; phage(gi399528785) 1e-54 Click
11complement(3725033..3725752) PHAGE_Salmon_vB_SosS_Oslo: tail assembly protein; SeV_A0763; phage(gi399528784) 5e-145 Click
12complement(3725752..3726435) PHAGE_Salmon_vB_SosS_Oslo: minor tail protein; SeV_A0764; phage(gi399528783) 7e-133 Click
13complement(3726803..3726979) conserved hypothetical protein; SeV_A0765 0.0 Click
14complement(3726990..3727124) PHAGE_Salmon_vB_SosS_Oslo: minor tail protein; SeV_A0766; phage(gi399528780) 5e-19 Click
153727430..3727828 PHAGE_Entero_ES18: gp22; SeV_A0767; phage(gi62362235) 1e-62 Click
16complement(3727829..3730012) PHAGE_Salmon_vB_SosS_Oslo: tail length tape-measure protein; SeV_A0768; phage(gi399528779) 0.0 Click
17complement(3730402..3730653) PHAGE_Salmon_SPN3UB: hypothetical protein; SeV_A0769; phage(gi423262403) 2e-33 Click
18complement(3731117..3731905) PHAGE_Salmon_SPN3UB: putative antirepressor family protein; SeV_A0770; phage(gi423262399) 1e-149 Click
19complement(3731970..3732836) PHAGE_Klebsi_phiKO2: Gp27; SeV_A0771; phage(gi46402113) 2e-32 Click
20complement(3732826..3732987) conserved hypothetical protein; SeV_A0772 0.0 Click
213733294..3733425 PHAGE_Salmon_SPN3UB: Arc-like DNA binding domain protein; SeV_A0773; phage(gi423262396) 1e-14 Click
22complement(3734833..3735486) PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SeV_A0775; phage(gi399528773) 9e-122 Click
23complement(3735532..3736269) PHAGE_Salmon_vB_SosS_Oslo: major tail protein; SeV_A0776; phage(gi399528772) 3e-137 Click
24complement(3736285..3736671) PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SeV_A0777; phage(gi399528771) 1e-64 Click
253736947..3737081 hypothetical protein; SeV_A0778 0.0 Click
26complement(3737071..3737433) PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SeV_A0779; phage(gi399528769) 2e-68 Click
27complement(3737605..3738006) PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SeV_A0780; phage(gi399528767) 8e-71 Click
28complement(3738058..3738237) PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SeV_A0781; phage(gi399528766) 2e-27 Click
29complement(3738247..3739323) PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SeV_A0782; phage(gi399528765) 0.0 Click
30complement(3739341..3739790) PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SeV_A0783; phage(gi399528764) 5e-80 Click
31complement(3739803..3741068) PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SeV_A0784; phage(gi399528763) 0.0 Click
32complement(3741071..3741913) PHAGE_Salmon_vB_SosS_Oslo: putative head morphogenesis protein; SeV_A0785; phage(gi399528762) 1e-156 Click
33complement(3741957..3743306) PHAGE_Salmon_vB_SosS_Oslo: portal protein; SeV_A0786; phage(gi399528761) 0.0 Click
34complement(3743439..3744758) PHAGE_Salmon_vB_SosS_Oslo: terminase large subunit; SeV_A0787; phage(gi399528760) 3e-151 Click
35complement(3744742..3744999) PHAGE_Entero_ES18: gp1; SeV_A0788; phage(gi62362214) 4e-41 Click
36complement(3745403..3745531) hypothetical protein; SeV_A0789 0.0 Click
37complement(3745629..3746150) PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; SeV_A0790; phage(gi399498859) 1e-100 Click
38complement(3746405..3746590) PHAGE_Entero_mEpX2: lysis protein Rz1; SeV_A0791; phage(gi428765675) 6e-28 Click
39complement(3746878..3747381) PHAGE_Salmon_vB_SosS_Oslo: lysin; SeV_A0792; phage(gi399528834) 1e-87 Click
40complement(3747353..3747496) PHAGE_Salmon_vB_SosS_Oslo: class II holin; SeV_A0793; phage(gi399528833) 1e-22 Click
41complement(3747801..3747878) tRNA 0.0 Click
42complement(3747882..3747958) tRNA 0.0 Click
43complement(3748093..3748866) PHAGE_Salmon_SE1: Gp23; SeV_A0796; phage(gi219681234) 1e-146 Click
44complement(3748863..3749042) PHAGE_Salmon_vB_SemP_Emek: NinZ; SeV_A0797; phage(gi399498853) 9e-27 Click
45complement(3749223..3749447) PHAGE_Entero_P22: NinY; SeV_A0798; phage(gi9635527) 1e-37 Click
46complement(3749444..3750049) PHAGE_Entero_mEp213: NinG protein; SeV_A0799; phage(gi428782653) 3e-115 Click
47complement(3750904..3751359) PHAGE_Salmon_epsilon34: NinB; SeV_A0800; phage(gi221328673) 9e-81 Click
48complement(3751418..3752854) PHAGE_Entero_mEp235: replicative DNA helicase; SeV_A0801; phage(gi428781855) 0.0 Click
49complement(3752844..3753734) PHAGE_Escher_HK75: replication protein O; SeV_A0802; phage(gi356870718) 5e-167 Click
50complement(3753917..3754195) PHAGE_Entero_mEpX2: CII protein; SeV_A0803; phage(gi428765658) 9e-43 Click
51complement(3754374..3754490) hypothetical protein; SeV_A0804 0.0 Click
523755384..3756562 PHAGE_Salmon_SPN9CC: hypothetical protein; SeV_A0805; phage(gi389060507) 0.0 Click
53complement(3756601..3756804) hypothetical protein; SeV_A0806 0.0 Click
54complement(3756951..3757130) hypothetical protein; SeV_A0808 0.0 Click
553757054..3757139 tRNA 0.0 Click
563757245..3757502 PHAGE_Salmon_ST160: Gp24; SeV_A0809; phage(gi318065922) 1e-40 Click
573757842..3758042 PHAGE_Entero_ST104: Ral; SeV_A0810; phage(gi46358667) 7e-29 Click
583758079..3758702 PHAGE_Entero_mEp235: hypothetical protein; SeV_A0811; phage(gi428781847) 2e-108 Click
593758950..3759108 PHAGE_Entero_ST104: C3; SeV_A0812; phage(gi46358663) 8e-25 Click
603759089..3759277 PHAGE_Salmon_vB_SosS_Oslo: Kil protein; SeV_A0813; phage(gi399528802) 5e-32 Click
613759267..3759410 PHAGE_Salmon_vB_SosS_Oslo: Arf protein; SeV_A0814; phage(gi399528801) 4e-21 Click
623759407..3760114 PHAGE_Salmon_SE1: Erf; SeV_A0815; phage(gi219681206) 5e-134 Click
633760445..3760738 PHAGE_Salmon_ST160: Abc2; SeV_A0816; phage(gi318065913) 2e-51 Click
643760791..3760919 PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SeV_A0817; phage(gi399528797) 3e-18 Click
653760916..3761515 PHAGE_Entero_P22: EaE; SeV_A0818; phage(gi9635501) 6e-55 Click
663761625..3762248 PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SeV_A0819; phage(gi399528795) 2e-16 Click
673762479..3762772 PHAGE_Klebsi_phiKO2: Gp43; SeV_A0820; phage(gi46402129) 8e-36 Click
683762769..3763770 PHAGE_Salmon_ST160: hypothetical protein; SeV_A0821; phage(gi318065907) 2e-74 Click
693763763..3764047 PHAGE_Entero_ST104: ORF6; SeV_A0822; phage(gi46358654) 2e-51 Click
70complement(3764314..3765525) PHAGE_Salmon_vB_SosS_Oslo: integrase; SeV_A0823; phage(gi399528791) 0.0 Click
713765704..3765741 attR    ATACGCAAGATCACATACAAAGAGAAAATGAATTTATT 0.0 Click

Region 4, total : 51 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14030763..4030781 attL    GCTACATTTTTATAACATG 0.0 Click
2complement(4031586..4032806) PROPHAGE_Escher_CFT073: transposase; SeV_A1123; phage(gi26249432) 1e-86 Click
3complement(4033026..4033244) PHAGE_Escher_D108: G region invertase; SeV_A1124; phage(gi281199698) 3e-21 Click
44033457..4034179 guanine nucleotide exchange factor SopE; SeV_A1125 0.0 Click
5complement(4034376..4034957) PHAGE_Gifsy_1: bacteriophage side tail fiber assembly factor & structural component; Lambda gpTfa homolog; SeV_A1126; phage(gi169257212) 1e-93 Click
6complement(4035768..4038206) PHAGE_Gifsy_1: bacteriophage side tail fiber protein; Lambda gpSft (gpN) homolog; SeV_A1128; phage(gi169257214) 0.0 Click
7complement(4038260..4038496) PHAGE_Gifsy_1: hypothetical protein STM2589.1n.Gifsy1; SeV_A1129; phage(gi169257215) 6e-38 Click
8complement(4038541..4041903) PHAGE_Gifsy_1: bacteriophage host specificity protein; tail fiber; Lambda gpJ homolog; SeV_A1130; phage(gi169257216) 0.0 Click
9complement(4041966..4042472) PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpI homolog; SeV_A1131; phage(gi169257217) 3e-92 Click
10complement(4043255..4043953) PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpL homolog; SeV_A1133; phage(gi169257219) 4e-135 Click
11complement(4043963..4044292) PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpM homolog; SeV_A1134; phage(gi169257220) 2e-61 Click
12complement(4044295..4047336) PHAGE_Gifsy_1: bacteriophage tail tape measure protein; minor tail protein; Lambda gpH homolog; SeV_A1135; phage(gi169257221) 0.0 Click
13complement(4047308..4047580) PHAGE_Gifsy_1: part of bacteriophage tail assembly chaperone gpG by translational frameshifting; Lambda gpT homolog; SeV_A1136; phage(gi169257222) 1e-47 Click
14complement(4047643..4048038) PHAGE_Gifsy_1: bacteriophage tail assembly chaperone; Lambda gpG homolog; SeV_A1137; phage(gi169257223) 2e-70 Click
15complement(4048089..4048832) PHAGE_Gifsy_1: bacteriophage major tail subunit; Lambda gpV homolog; SeV_A1138; phage(gi169257224) 5e-138 Click
16complement(4048843..4049244) PHAGE_Gifsy_1: bacteriophage tail shaft stabilization protein; Lambda gpU homolog; SeV_A1140; phage(gi169257225) 3e-73 Click
174049233..4050483 PHAGE_Gifsy_1: transposase; SeV_A1139; phage(gi169257226) 0.0 Click
18complement(4050532..4051110) PHAGE_Gifsy_1: bacteriophage head-tail assembly protein; Lambda gpZ homolog; SeV_A1141; phage(gi169257227) 7e-104 Click
19complement(4051138..4051521) PHAGE_Gifsy_1: bacteriophage minor capsid protein; forms tail attachment site on head; Lambda FII homolog; SeV_A1142; phage(gi169257228) 1e-68 Click
20complement(4051532..4051891) PHAGE_Gifsy_1: bacteriophage accessory DNA packaging protein; Lambda FI homolog; SeV_A1143; phage(gi169257229) 4e-62 Click
21complement(4051949..4052977) PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; SeV_A1144; phage(gi169257230) 0.0 Click
22complement(4053032..4053379) PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; SeV_A1145; phage(gi169257231) 2e-61 Click
23complement(4053392..4054888) PHAGE_Gifsy_1: bacteriophage prohead protease; Lambda gpC homolog; SeV_A1146; phage(gi169257232) 0.0 Click
24complement(4054878..4056458) PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; SeV_A1147; phage(gi169257233) 0.0 Click
25complement(4056455..4056658) PHAGE_Gifsy_1: bacteriophage head-to-tail joining protein; adapter between portal and gpFII; Lambda gpW homolog; SeV_A1148; phage(gi169257234) 2e-31 Click
26complement(4056642..4058573) PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; SeV_A1149; phage(gi169257235) 0.0 Click
27complement(4058545..4059090) PHAGE_Gifsy_1: DNA packaging protein; small terminase subunit; Lambda Nu1 homolog; SeV_A1150; phage(gi169257236) 2e-87 Click
284059376..4059777 PHAGE_Gifsy_1: hypothetical protein STM2610.Gifsy1; SeV_A1151; phage(gi169257237) 2e-71 Click
29complement(4060013..4060498) PHAGE_Gifsy_1: bacteriophage lysis protein; Rz; SeV_A1152; phage(gi169257238) 7e-71 Click
30complement(4060495..4061121) PHAGE_Entero_epsilon15: endolysin; SeV_A1153; phage(gi30387404) 2e-96 Click
31complement(4061124..4061471) PHAGE_Entero_SfV: holin; SeV_A1154; phage(gi19549036) 7e-48 Click
32complement(4061666..4062355) PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; SeV_A1155; phage(gi169257244) 4e-102 Click
33complement(4062489..4063100) PHAGE_Gifsy_1: NinG; SeV_A1156; phage(gi169257246) 7e-116 Click
34complement(4063309..4063911) PHAGE_Gifsy_1: conserved hypothetical bacteriophage protein; SeV_A1157; phage(gi169257248) 3e-110 Click
35complement(4063946..4064062) PHAGE_Entero_mEp237: hypothetical protein; SeV_A1158; phage(gi435439314) 2e-15 Click
36complement(4064311..4064544) PHAGE_Gifsy_1: bacteriophage putative DNA damage-inducible protein; DinI homolog; SeV_A1159; phage(gi169257250) 2e-38 Click
374064930..4065043 hypothetical protein; SeV_A1160 0.0 Click
38complement(4065391..4065891) PHAGE_Entero_P1: PmgT; SeV_A1161; phage(gi46401715) 6e-34 Click
39complement(4065905..4066600) PHAGE_Escher_HK639: replication protein 14; SeV_A1162; phage(gi356870655) 3e-60 Click
40complement(4066597..4067514) PHAGE_Entero_HK140: DNA replication protein O; SeV_A1163; phage(gi428781991) 6e-33 Click
41complement(4067707..4067856) PHAGE_Gifsy_1: probable regulatory protein; transcriptional activator; lambda CII analog; SeV_A1164; phage(gi169257256) 5e-21 Click
424068649..4068783 PHAGE_Entero_mEp237: prophage repressor; SeV_A1165; phage(gi435439304) 4e-13 Click
434068955..4069803 conserved hypothetical protein; SeV_A1166 0.0 Click
444070070..4070606 hypothetical protein; SeV_A1167 0.0 Click
45complement(4070646..4070852) PHAGE_Entero_HK225: hypothetical protein; SeV_A1168; phage(gi428782417) 4e-19 Click
464071140..4071256 PHAGE_Gifsy_1: hypothetical protein STM2630.1n.Gifsy1; SeV_A1169; phage(gi169257259) 2e-15 Click
474071249..4071419 PHAGE_Gifsy_1: hypothetical protein STM2630.Gifsy1; SeV_A1170; phage(gi169257260) 3e-11 Click
484071918..4075118 PHAGE_Gifsy_1: bacteriophage exodeoxyribonuclease VIII-like protein; SeV_A1171; phage(gi169257262) 0.0 Click
494075129..4076238 PHAGE_Gifsy_1: RecT; SeV_A1172; phage(gi169257263) 0.0 Click
504076281..4076520 PHAGE_Gifsy_1: hypothetical protein STM2634.Gifsy1; SeV_A1173; phage(gi169257264) 7e-40 Click
514076561..4076809 PHAGE_Gifsy_2: bacteriophage excisionase; SeV_A1174; phage(gi169257269) 1e-43 Click
524076806..4078146 PHAGE_Gifsy_2: bacteriophage integrase; SeV_A1175; phage(gi169257268) 0.0 Click
534078181..4078199 attR    GCTACATTTTTATAACATG 0.0 Click

Region 5, total : 10 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14149025..4149037 attL    CGGGCTTTTTTTT 0.0 Click
24149670..4150353 PROPHAGE_Escher_CFT073: transposase insF; SeV_A1236; phage(gi26249410) 1e-32 Click
34150666..4151043 PROPHAGE_Escher_CFT073: P4 family integrase; SeV_A1237; phage(gi26248244) 7e-48 Click
44151455..4151467 attR    CGGGCTTTTTTTT 0.0 Click
5complement(4151615..4153891) PROPHAGE_Escher_EDL933: ATP-dependent Clp protease ATP-binding subunit; SeV_A1238; phage(gi15800640) 0.0 Click
6complement(4153922..4154242) PHAGE_Cronob_vB_CsaM_GAP32: ATP-dependent Clp protease; SeV_A1239; phage(gi414087232) 7e-05 Click
74154566..4154787 PHAGE_Lactoc_bIL312: Csp; SeV_A1240; phage(gi13095918) 5e-14 Click
8complement(4154742..4154885) hypothetical protein; SeV_A1241 0.0 Click
9complement(4154917..4156863) PHAGE_Plankt_PaV_LD: ABC transporter; SeV_A1242; phage(gi371496158) 5e-41 Click
10complement(4156860..4157978) PHAGE_Cronob_ENT47670: putative tail protein; SeV_A1243; phage(gi431810494) 4e-05 Click
114158124..4159074 conserved hypothetical protein; SeV_A1244 0.0 Click
12complement(4159071..4160729) PHAGE_Entero_P2: Old; SeV_A1245; phage(gi9630369) 8e-06 Click