Salmonella enterica subsp. enterica serovar Hadar str. RI_05P066 [asmbl_id: NC_000000].331805, GC%: 52.21%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 43 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1191214..191258 attL    TGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAG 0.0 Click
2complement(191345..192382) PHAGE_Erwini_ENT90_NC_019932: phage integrase family protein; SeH_A3701; phage(gi431810942) 2e-122 Click
3complement(192386..192952) PHAGE_Staphy_X2_NC_007065: ORF015; SeH_A3700; phage(gi66394685) 2e-22 Click
4complement(192969..193238) PHAGE_Erwini_ENT90_NC_019932: CI repressor protein; SeH_A3699; phage(gi431810951) 4e-10 Click
5193691..193912 conserved hypothetical protein; SeH_A3698 0.0 Click
6193943..194446 PHAGE_Salmon_RE_2010_NC_019488: regulatory protein; SeH_A3697; phage(gi418489686) 7e-39 Click
7194456..194638 hypothetical protein; SeH_A3696 0.0 Click
8complement(194952..195065) hypothetical protein; SeH_A3695 0.0 Click
9195068..195469 hypothetical protein; SeH_A3694 0.0 Click
10195537..195770 PHAGE_Entero_Fels_2_NC_010463: hypothetical protein STM2732.Fels2; SeH_A3693; phage(gi169936057) 1e-05 Click
11195761..196168 PHAGE_Entero_HK022_NC_002166: hypothetical protein HK022p34; SeH_A3692; phage(gi19343383) 6e-10 Click
12196165..196494 PHAGE_Yersin_L_413C_NC_004745: hypothetical protein L-413Cp39; SeH_A3691; phage(gi30065743) 3e-14 Click
13197341..199362 PHAGE_Erwini_ENT90_NC_019932: replication protein A; SeH_A3689; phage(gi431810936) 3e-128 Click
14complement(199662..199931) PHAGE_Vibrio_8_NC_022747: zinc-finger protein; SeH_A3688; phage(gi557307492) 2e-20 Click
15complement(199982..201043) PHAGE_Haemop_HP2_NC_003315: orf15; SeH_A3687; phage(gi17981829) 1e-81 Click
16complement(201040..202815) PHAGE_Haemop_HP2_NC_003315: terminase; SeH_A3686; phage(gi17981830) 8e-179 Click
17complement(202823..202936) hypothetical protein; SeH_A3685 0.0 Click
18202976..203776 PHAGE_Haemop_HP2_NC_003315: scaffold; SeH_A3684; phage(gi17981831) 9e-35 Click
19203838..204860 PHAGE_Aeromo_phiO18P_NC_009542: putative major capsid protein; SeH_A3683; phage(gi148727153) 8e-93 Click
20204864..205565 PHAGE_Aeromo_phiO18P_NC_009542: putative terminase small subunit; SeH_A3682; phage(gi148727154) 1e-54 Click
21205626..206114 PHAGE_Haemop_HP2_NC_003315: packaging protein; SeH_A3681; phage(gi17981834) 6e-25 Click
22206111..206617 PHAGE_Haemop_HP2_NC_003315: orf21; SeH_A3680; phage(gi17981835) 1e-11 Click
23206614..207321 PHAGE_Haemop_HP2_NC_003315: orf22; SeH_A3679; phage(gi17981836) 8e-13 Click
24207318..208445 PHAGE_Haemop_HP2_NC_003315: tail sheath; SeH_A3678; phage(gi17981837) 8e-107 Click
25208442..208897 PHAGE_Haemop_HP2_NC_003315: tail tube; SeH_A3677; phage(gi17981838) 4e-42 Click
26208907..209200 PHAGE_Burkho_KS9_NC_013055: holin gp22; SeH_A3676; phage(gi255033753) 2e-17 Click
27209197..209538 PHAGE_Pseudo_PaP2_NC_005884: hypothetical protein PaP2_gp17; SeH_A3675; phage(gi48697087) 1e-25 Click
28209538..209870 PHAGE_Erwini_phiEa104_NC_015292: hypothetical protein; SeH_A3674; phage(gi327198401) 3e-10 Click
29209842..210030 hypothetical protein; SeH_A3673 0.0 Click
30210017..210274 PHAGE_Haemop_HP2_NC_003315: orf26; SeH_A3672; phage(gi17981842) 6e-15 Click
31210462..212432 PHAGE_Haemop_HP2_NC_003315: orf27; SeH_A3671; phage(gi17981843) 8e-79 Click
32212429..212758 PHAGE_Haemop_HP2_NC_003315: orf28; SeH_A3670; phage(gi17981844) 2e-27 Click
33212755..213939 PHAGE_Haemop_HP2_NC_003315: orf29; SeH_A3669; phage(gi17981845) 2e-115 Click
34213944..214519 PHAGE_Haemop_HP2_NC_003315: orf30; SeH_A3668; phage(gi17981846) 4e-46 Click
35214529..216775 PHAGE_Haemop_HP2_NC_003315: tail fibers; SeH_A3667; phage(gi17981847) 8e-70 Click
36216788..217333 PHAGE_Salmon_SP_004_NC_021774: tail fiber assembly protein; SeH_A3666; phage(gi526003632) 2e-90 Click
37217323..218048 PHAGE_Haemop_HP2_NC_003315: orf33; SeH_A3665; phage(gi17981849) 1e-12 Click
38218020..218565 PHAGE_Haemop_HP2_NC_003315: orf34; SeH_A3664; phage(gi17981850) 6e-29 Click
39218565..220268 PHAGE_Haemop_HP2_NC_003315: orf35; SeH_A3663; phage(gi17981851) 4e-125 Click
40220499..220615 hypothetical protein; SeH_A3662 0.0 Click
41complement(220856..221044) conserved hypothetical protein; SeH_A3661 0.0 Click
42221060..221182 hypothetical protein; SeH_A3660 0.0 Click
43complement(221239..221314) tRNA 0.0 Click
44221239..221283 attR    TGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAG 0.0 Click
45221440..221946 G/U mismatch-specific DNA glycosylase; SeH_A3659 0.0 Click
46complement(222070..223917) PHAGE_Synech_S_CBS1_NC_016164: group2 RNA polymerase sigma factor; SeH_A3658; phage(gi356870821) 2e-36 Click