Salmonella enterica subsp. enterica serovar Hadar str. RI_05P066 [asmbl_id: NC_000000].4793325, GC%: 52.27%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 48 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11313432..1313452 attL    GGAATCACACAGCCTCACACT 0.0 Click
2complement(1313991..1315940) PHAGE_Salmon_vB_SemP_Emek: tailspike protein; SeH_A0887; phage(gi399498815) 0.0 Click
3complement(1316129..1318060) PHAGE_Salmon_SPN9CC: DNA transfer protein 3; SeH_A0886; phage(gi389060548) 0.0 Click
4complement(1318060..1319409) PHAGE_Entero_P22: injection protein; SeH_A0885; phage(gi9635545) 3e-170 Click
5complement(1319419..1320108) PHAGE_Salmon_SPN9CC: DNA transfer protein 1; SeH_A0884; phage(gi389060546) 2e-122 Click
6complement(1320111..1320386) PHAGE_Entero_P22: virion stability factor; SeH_A0883; phage(gi51236729) 2e-49 Click
7complement(1320566..1321204) PHAGE_Entero_P22: head completion protein; SeH_A0882; phage(gi51236728) 1e-80 Click
8complement(1321208..1322626) PHAGE_Entero_P22: head completion protein; SeH_A0881; phage(gi9635541) 0.0 Click
9complement(1323078..1323254) conserved hypothetical protein; SeH_A0880 0.0 Click
10complement(1323308..1324561) PHAGE_Entero_P22: coat protein; SeH_A0879; phage(gi9635538) 9e-36 Click
11complement(1324580..1325473) PHAGE_Entero_Sf6: gene 4 protein; SeH_A0878; phage(gi41057282) 1e-24 Click
12complement(1325564..1327762) PHAGE_Bacter_2: portal protein; SeH_A0877; phage(gi212499722) 0.0 Click
13complement(1327764..1329179) PHAGE_Entero_Sf6: gene 2 protein; SeH_A0876; phage(gi41057280) 0.0 Click
14complement(1329176..1329604) PHAGE_Entero_Sf6: gene 1 protein; SeH_A0875; phage(gi41057279) 2e-76 Click
15complement(1329622..1329801) PHAGE_Entero_P22: Orf59c; SeH_A0874; phage(gi19343398) 9e-24 Click
16complement(1330382..1331068) PHAGE_Salmon_SPN9CC: hypothetical protein; SeH_A0872; phage(gi389060533) 1e-127 Click
17complement(1331334..1331519) PHAGE_Entero_mEpX2: lysis protein Rz1; SeH_A0871; phage(gi428765675) 6e-28 Click
18complement(1331715..1332155) PHAGE_Entero_P22: lysozyme; SeH_A0870; phage(gi9635531) 3e-75 Click
19complement(1332136..1332462) PHAGE_Entero_P22: inhibitor of gene 13' protein holin; SeH_A0869; phage(gi9635530) 7e-56 Click
20complement(1332906..1333670) PHAGE_Entero_ES18: gp73; SeH_A0868; phage(gi62362286) 2e-142 Click
21complement(1333667..1333846) PHAGE_Salmon_vB_SosS_Oslo: NinZ protein; SeH_A0867; phage(gi399528831) 1e-26 Click
22complement(1333827..1334030) PHAGE_Salmon_SPN9CC: NinH; SeH_A0866; phage(gi389060527) 5e-35 Click
23complement(1334027..1334251) PHAGE_Entero_P22: NinY; SeH_A0865; phage(gi9635527) 5e-38 Click
24complement(1334248..1334859) PHAGE_Entero_mEp234: NinG protein; SeH_A0864; phage(gi428782304) 2e-115 Click
25complement(1335021..1335395) PHAGE_Entero_P22: NinX; SeH_A0863; phage(gi9635524) 1e-14 Click
26complement(1335711..1335839) PHAGE_Cronob_phiES15: putative adenine-specific DNA methyltransferase; SeH_A0862; phage(gi401817568) 6e-06 Click
27complement(1336298..1336741) PHAGE_Entero_HK022: Protein Nin B; SeH_A0861; phage(gi19343391) 2e-80 Click
28complement(1336886..1337197) PHAGE_Entero_Sf6: gene 48 protein; SeH_A0860; phage(gi41057325) 3e-34 Click
29complement(1337491..1338867) PHAGE_Entero_mEp213: replicative DNA helicase; SeH_A0859; phage(gi428782646) 0.0 Click
30complement(1338864..1339685) PHAGE_Entero_mEp213: DNA replication protein O; SeH_A0858; phage(gi428782645) 2e-155 Click
31complement(1339866..1340162) PHAGE_Entero_mEp234: CII protein; SeH_A0857; phage(gi428782295) 6e-50 Click
321340605..1341258 PHAGE_Stx2_c_II: CI protein; SeH_A0856; phage(gi302393138) 1e-122 Click
331341612..1341944 PHAGE_Entero_P22: hypothetical protein P22gp46; SeH_A0855; phage(gi9635514) 4e-35 Click
341342023..1342217 PHAGE_Entero_P22: Ral; SeH_A0854; phage(gi9635512) 2e-30 Click
351342301..1343446 PHAGE_Entero_ES18: gp53; SeH_A0853; phage(gi62362266) 5e-109 Click
36complement(1343551..1343688) hypothetical protein; SeH_A0851 0.0 Click
371343657..1343788 PHAGE_Entero_mEpX2: CIII protein; SeH_A0852; phage(gi428765650) 2e-10 Click
381343907..1344029 conserved hypothetical protein; SeH_A0850 0.0 Click
391344010..1344318 PHAGE_Entero_mEpX1: hypothetical protein; SeH_A0849; phage(gi428781907) 5e-56 Click
401344315..1345217 PHAGE_Entero_mEpX1: RecT family recombination protein; SeH_A0848; phage(gi428781906) 9e-151 Click
411345201..1345683 PHAGE_Entero_HK140: hypothetical protein; SeH_A0847; phage(gi428781979) 4e-81 Click
421346068..1346196 PHAGE_Entero_ST64T: Orf56; SeH_A0846; phage(gi24371598) 3e-18 Click
431346193..1347131 PHAGE_Entero_P22: EaE; SeH_A0845; phage(gi9635501) 2e-28 Click
441347128..1347382 PHAGE_Entero_EcP1: hypothetical protein; SeH_A0844; phage(gi418489320) 1e-14 Click
451347369..1348100 PHAGE_Escher_P13374: hypothetical protein; SeH_A0843; phage(gi410491610) 9e-21 Click
461348183..1348320 PHAGE_Salmon_epsilon34: hypothetical protein epsilon34_gp27; SeH_A0842; phage(gi221328644) 2e-21 Click
471348324..1348716 PHAGE_Salmon_SPN3UB: putative Eaa protein; SeH_A0841; phage(gi423262432) 2e-23 Click
481349266..1349550 PHAGE_Entero_ST104: ORF6; SeH_A0839; phage(gi46358654) 2e-50 Click
491350002..1350022 attR    GGAATCACACAGCCTCACACT 0.0 Click
501350227..1351390 PHAGE_Salmon_epsilon34: Tyrosine integrase; SeH_A0838; phage(gi221328640) 0.0 Click

Region 2, total : 43 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13020748..3020792 attL    TGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAG 0.0 Click
2complement(3020879..3021916) PHAGE_Erwini_ENT90: phage integrase family protein; SeH_A3701; phage(gi431810942) 2e-122 Click
3complement(3021920..3022486) PHAGE_Staphy_X2: ORF015; SeH_A3700; phage(gi66394685) 1e-22 Click
4complement(3022503..3022772) PHAGE_Erwini_ENT90: CI repressor protein; SeH_A3699; phage(gi431810951) 3e-10 Click
53023225..3023446 conserved hypothetical protein; SeH_A3698 0.0 Click
63023477..3023980 PHAGE_Salmon_RE_2010: regulatory protein; SeH_A3697; phage(gi418489686) 6e-39 Click
73023990..3024172 hypothetical protein; SeH_A3696 0.0 Click
8complement(3024486..3024599) hypothetical protein; SeH_A3695 0.0 Click
93024602..3025003 hypothetical protein; SeH_A3694 0.0 Click
103025071..3025304 PHAGE_Entero_2: hypothetical protein STM2732.Fels2; SeH_A3693; phage(gi169936057) 1e-05 Click
113025295..3025702 PHAGE_Entero_HK022: hypothetical protein HK022p34; SeH_A3692; phage(gi19343383) 5e-10 Click
123025699..3026028 PHAGE_Yersin_413C: hypothetical protein L-413Cp39; SeH_A3691; phage(gi30065743) 2e-14 Click
133026875..3028896 PHAGE_Erwini_ENT90: replication protein A; SeH_A3689; phage(gi431810936) 2e-128 Click
14complement(3029196..3029465) PHAGE_Vibrio_kappa: hypothetical zinc-finger protein; SeH_A3688; phage(gi165970253) 2e-20 Click
15complement(3029516..3030577) PHAGE_Haemop_HP2: orf15; SeH_A3687; phage(gi17981829) 1e-81 Click
16complement(3030574..3032349) PHAGE_Haemop_HP2: terminase; SeH_A3686; phage(gi17981830) 6e-179 Click
17complement(3032357..3032470) hypothetical protein; SeH_A3685 0.0 Click
183032510..3033310 PHAGE_Haemop_HP2: scaffold; SeH_A3684; phage(gi17981831) 7e-35 Click
193033372..3034394 PHAGE_Aeromo_phiO18P: putative major capsid protein; SeH_A3683; phage(gi148727153) 6e-93 Click
203034398..3035099 PHAGE_Aeromo_phiO18P: putative terminase small subunit; SeH_A3682; phage(gi148727154) 1e-54 Click
213035160..3035648 PHAGE_Haemop_HP2: packaging protein; SeH_A3681; phage(gi17981834) 5e-25 Click
223035645..3036151 PHAGE_Haemop_HP2: orf21; SeH_A3680; phage(gi17981835) 1e-11 Click
233036148..3036855 PHAGE_Haemop_HP2: orf22; SeH_A3679; phage(gi17981836) 6e-13 Click
243036852..3037979 PHAGE_Haemop_HP2: tail sheath; SeH_A3678; phage(gi17981837) 6e-107 Click
253037976..3038431 PHAGE_Haemop_HP2: tail tube; SeH_A3677; phage(gi17981838) 4e-42 Click
263038441..3038734 PHAGE_Burkho_KS9: holin gp22; SeH_A3676; phage(gi255033753) 1e-17 Click
273038731..3039072 PHAGE_Pseudo_PaP2: hypothetical protein PaP2_gp17; SeH_A3675; phage(gi48697087) 7e-26 Click
283039072..3039404 PHAGE_Erwini_phiEa104: hypothetical protein; SeH_A3674; phage(gi327198401) 3e-10 Click
293039376..3039564 PHAGE_Entero_NJ01: hypothetical protein; SeH_A3673; phage(gi410490876) 1e-04 Click
303039551..3039808 PHAGE_Haemop_HP2: orf26; SeH_A3672; phage(gi17981842) 4e-15 Click
313039996..3041966 PHAGE_Haemop_HP2: orf27; SeH_A3671; phage(gi17981843) 7e-79 Click
323041963..3042292 PHAGE_Haemop_HP2: orf28; SeH_A3670; phage(gi17981844) 1e-27 Click
333042289..3043473 PHAGE_Haemop_HP2: orf29; SeH_A3669; phage(gi17981845) 2e-115 Click
343043478..3044053 PHAGE_Haemop_HP2: orf30; SeH_A3668; phage(gi17981846) 3e-46 Click
353044063..3046309 PHAGE_Haemop_HP2: tail fibers; SeH_A3667; phage(gi17981847) 6e-70 Click
363046322..3046867 PHAGE_Salmon_ST64B: Probable tail fiber assembly protein; SeH_A3666; phage(gi23505469) 2e-53 Click
373046857..3047582 PHAGE_Haemop_HP2: orf33; SeH_A3665; phage(gi17981849) 8e-13 Click
383047554..3048099 PHAGE_Haemop_HP2: orf34; SeH_A3664; phage(gi17981850) 5e-29 Click
393048099..3049802 PHAGE_Haemop_HP2: orf35; SeH_A3663; phage(gi17981851) 3e-125 Click
403050033..3050149 hypothetical protein; SeH_A3662 0.0 Click
41complement(3050390..3050578) conserved hypothetical protein; SeH_A3661 0.0 Click
423050594..3050716 hypothetical protein; SeH_A3660 0.0 Click
43complement(3050773..3050848) tRNA 0.0 Click
443050773..3050817 attR    TGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAG 0.0 Click
453050974..3051480 G/U mismatch-specific DNA glycosylase; SeH_A3659 0.0 Click
46complement(3051604..3053451) PHAGE_Synech_S_CBS1: group2 RNA polymerase sigma factor; SeH_A3658; phage(gi356870821) 2e-36 Click

Region 3, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3647351..3647698) PHAGE_Burkho_BcepMu: gp01; SeH_A4703; phage(gi48696911) 7e-24 Click
2complement(3647916..3648047) hypothetical protein; SeH_A4702 0.0 Click
33648274..3648561 PHAGE_Burkho_BcepMu: gp21; SeH_A4701; phage(gi48696931) 1e-20 Click
43648564..3649169 PHAGE_Burkho_BcepMu: gp22; SeH_A4700; phage(gi48696932) 2e-55 Click
53649182..3649496 PHAGE_Burkho_BcepMu: gp25; SeH_A4699; phage(gi48696935) 3e-23 Click
63649656..3650111 PHAGE_Burkho_BcepMu: gp37; SeH_A4698; phage(gi48696947) 5e-13 Click
73650108..3650305 PHAGE_Burkho_BcepMu: gp38; SeH_A4697; phage(gi48696948) 2e-08 Click
83650295..3651722 PHAGE_Burkho_BcepMu: gp39; SeH_A4696; phage(gi48696949) 0.0 Click
93651722..3652246 PHAGE_Burkho_BcepMu: gp40; SeH_A4695; phage(gi48696950) 1e-68 Click
103652298..3652615 PHAGE_Burkho_BcepMu: gp41; SeH_A4694; phage(gi48696951) 1e-09 Click
113652575..3652703 conserved hypothetical protein; SeH_A4693 0.0 Click
123652800..3655154 PHAGE_Burkho_BcepMu: gp44; SeH_A4692; phage(gi48696954) 4e-68 Click
133655154..3656107 PHAGE_Burkho_BcepMu: gp45; SeH_A4691; phage(gi48696955) 2e-45 Click
143656107..3656316 PHAGE_Burkho_BcepMu: gp46; SeH_A4690; phage(gi48696956) 9e-19 Click
153656304..3657347 PHAGE_Burkho_BcepMu: gp47; SeH_A4689; phage(gi48696957) 1e-80 Click
163657357..3658079 PHAGE_Burkho_BcepMu: gp48; SeH_A4688; phage(gi48696958) 2e-40 Click
173658088..3658213 hypothetical protein; SeH_A4687 0.0 Click
183658407..3658769 PHAGE_Entero_SfV: putative flippase; SeH_A4686; phage(gi19549013) 2e-48 Click
193658766..3659695 PHAGE_Entero_SfV: bactoprenol glucosyltransferase; SeH_A4685; phage(gi19549012) 4e-153 Click
203659704..3661242 PHAGE_Salmon_epsilon34: GtrC; putative membrane protein; SeH_A4684; phage(gi221328637) 2e-59 Click
21complement(3661223..3661345) hypothetical protein; SeH_A4683 0.0 Click
223661406..3661765 PHAGE_Burkho_BcepMu: gp49; SeH_A4682; phage(gi48696959) 1e-35 Click
233661756..3662871 PHAGE_Burkho_BcepMu: gp50; SeH_A4681; phage(gi48696960) 2e-105 Click
243662864..3663496 PHAGE_Burkho_BcepMu: gp51; SeH_A4680; phage(gi48696961) 2e-25 Click
253663499..3664980 PHAGE_Entero_PsP3: gp19; SeH_A4679; phage(gi41057371) 2e-74 Click
263664990..3665505 PROPHAGE_Escher_Sakai: putative tail fiber assembly protein; SeH_A4678; phage(gi15834244) 2e-30 Click

Region 4, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13736274..3736287 attL    TGAGCTGGCGGAAA 0.0 Click
23743539..3743916 PROPHAGE_Escher_CFT073: P4 family integrase; SeH_A1249; phage(gi26248244) 4e-48 Click
3complement(3744486..3746762) PROPHAGE_Escher_EDL933: ATP-dependent Clp protease ATP-binding subunit; SeH_A1248; phage(gi15800640) 0.0 Click
4complement(3746793..3747113) PHAGE_Cronob_vB_CsaM_GAP32: ATP-dependent Clp protease; SeH_A1247; phage(gi414087232) 3e-05 Click
53747437..3747658 PHAGE_Lactoc_bIL312: Csp; SeH_A1246; phage(gi13095918) 5e-14 Click
6complement(3747613..3747756) hypothetical protein; SeH_A1245 0.0 Click
7complement(3747788..3749734) PHAGE_Plankt_PaV_LD: ABC transporter; SeH_A1244; phage(gi371496158) 5e-41 Click
8complement(3749731..3750849) PHAGE_Cronob_ENT47670: putative tail protein; SeH_A1243; phage(gi431810494) 4e-05 Click
93750995..3751945 conserved hypothetical protein; SeH_A1242 0.0 Click
10complement(3751942..3753600) PHAGE_Entero_P2: Old; SeH_A1241; phage(gi9630369) 8e-06 Click
113765519..3765532 attR    TGAGCTGGCGGAAA 0.0 Click

Region 5, total : 37 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4543984..4544559) PHAGE_Gifsy_1: bacteriophage side tail fiber assembly factor & structural component; Lambda gpTfa homolog; SeH_A1354; phage(gi169257212) 3e-93 Click
2complement(4544559..4546997) PHAGE_Gifsy_1: bacteriophage side tail fiber protein; Lambda gpSft (gpN) homolog; SeH_A1353; phage(gi169257214) 0.0 Click
3complement(4547051..4547293) PHAGE_Gifsy_1: hypothetical protein STM2589.1n.Gifsy1; SeH_A1352; phage(gi169257215) 1e-38 Click
4complement(4547332..4550694) PHAGE_Gifsy_1: bacteriophage host specificity protein; tail fiber; Lambda gpJ homolog; SeH_A1351; phage(gi169257216) 0.0 Click
5complement(4550757..4551263) PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpI homolog; SeH_A1350; phage(gi169257217) 4e-92 Click
6complement(4552046..4552744) PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpL homolog; SeH_A1348; phage(gi169257219) 3e-134 Click
7complement(4552754..4553083) PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpM homolog; SeH_A1347; phage(gi169257220) 7e-61 Click
8complement(4553086..4556181) PHAGE_Gifsy_1: bacteriophage tail tape measure protein; minor tail protein; Lambda gpH homolog; SeH_A1346; phage(gi169257221) 0.0 Click
9complement(4556153..4556425) PHAGE_Gifsy_1: part of bacteriophage tail assembly chaperone gpG by translational frameshifting; Lambda gpT homolog; SeH_A1345; phage(gi169257222) 1e-47 Click
10complement(4556488..4556883) PHAGE_Gifsy_1: bacteriophage tail assembly chaperone; Lambda gpG homolog; SeH_A1344; phage(gi169257223) 2e-70 Click
11complement(4556934..4557677) PHAGE_Gifsy_1: bacteriophage major tail subunit; Lambda gpV homolog; SeH_A1343; phage(gi169257224) 7e-137 Click
12complement(4557688..4557843) PHAGE_Gifsy_1: bacteriophage tail shaft stabilization protein; Lambda gpU homolog; SeH_A1342; phage(gi169257225) 4e-24 Click
13complement(4558086..4558664) PHAGE_Gifsy_1: bacteriophage head-tail assembly protein; Lambda gpZ homolog; SeH_A1341; phage(gi169257227) 7e-104 Click
14complement(4558651..4559028) PHAGE_Gifsy_1: bacteriophage minor capsid protein; forms tail attachment site on head; Lambda FII homolog; SeH_A1340; phage(gi169257228) 1e-64 Click
15complement(4559039..4559404) PHAGE_Gifsy_1: bacteriophage accessory DNA packaging protein; Lambda FI homolog; SeH_A1339; phage(gi169257229) 1e-60 Click
16complement(4559462..4560490) PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; SeH_A1338; phage(gi169257230) 0.0 Click
17complement(4560545..4560892) PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; SeH_A1337; phage(gi169257231) 2e-61 Click
18complement(4560905..4562401) PHAGE_Gifsy_1: bacteriophage prohead protease; Lambda gpC homolog; SeH_A1336; phage(gi169257232) 0.0 Click
19complement(4562391..4564010) PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; SeH_A1335; phage(gi169257233) 0.0 Click
20complement(4563968..4564171) PHAGE_Gifsy_1: bacteriophage head-to-tail joining protein; adapter between portal and gpFII; Lambda gpW homolog; SeH_A1334; phage(gi169257234) 2e-31 Click
21complement(4564155..4566086) PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; SeH_A1333; phage(gi169257235) 0.0 Click
22complement(4566058..4566603) PHAGE_Gifsy_1: DNA packaging protein; small terminase subunit; Lambda Nu1 homolog; SeH_A1332; phage(gi169257236) 2e-87 Click
234566967..4567290 PHAGE_Gifsy_1: hypothetical protein STM2610.Gifsy1; SeH_A1330; phage(gi169257237) 9e-56 Click
24complement(4567547..4568050) conserved hypothetical protein; SeH_A1329 0.0 Click
25complement(4568379..4568849) PHAGE_Gifsy_1: bacteriophage lysis protein; Rz; SeH_A1328; phage(gi169257238) 1e-73 Click
26complement(4568846..4569295) PHAGE_Gifsy_1: bacteriophage lysin protein; endolysin; SeH_A1327; phage(gi169257239) 1e-80 Click
27complement(4569282..4569530) PHAGE_Gifsy_1: bacteriophage lysis protein; holin; SeH_A1326; phage(gi169257240) 2e-40 Click
284570100..4570573 PHAGE_Gifsy_1: virulence protein GogA; SeH_A1325; phage(gi169257241) 9e-87 Click
29complement(4571839..4572528) PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; SeH_A1324; phage(gi169257244) 8e-101 Click
30complement(4572662..4573273) PHAGE_Gifsy_1: NinG; SeH_A1323; phage(gi169257246) 4e-116 Click
31complement(4573482..4574084) PHAGE_Gifsy_1: conserved hypothetical bacteriophage protein; SeH_A1322; phage(gi169257248) 9e-110 Click
324574097..4574219 hypothetical protein; SeH_A1321 0.0 Click
33complement(4574500..4574733) PHAGE_Gifsy_1: bacteriophage putative DNA damage-inducible protein; DinI homolog; SeH_A1320; phage(gi169257250) 4e-23 Click
344575724..4575921 conserved hypothetical protein; SeH_A1319 0.0 Click
354575933..4576910 conserved hypothetical protein; SeH_A1318 0.0 Click
36complement(4576965..4577222) PHAGE_Salmon_ST64B: putative DNA methyltransferase; SeH_A1317; phage(gi23505488) 2e-07 Click
37complement(4577222..4577866) PHAGE_Salmon_SPN3UB: putative Eaa protein; SeH_A1316; phage(gi423262432) 2e-33 Click