Salmonella enterica subsp. enterica serovar Newport str. SL317 [asmbl_id: NC_000000].4948011, GC%: 52.10%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1109620..109631 attL    CCTGAATCATTG 0.0 Click
2complement(113053..113751) PHAGE_Cronob_vB_CsaM_GAP32: putative DNA polymerase III epsilon subunit; SNSL317_A0213; phage(gi414087193) 2e-15 Click
3complement(113775..114431) hydrolase, carbon-nitrogen family; SNSL317_A0214 0.0 Click
4complement(114539..114769) PHAGE_Pectob_ZF40: putative DNA polymerase; SNSL317_A0215; phage(gi422936677) 6e-17 Click
5114907..115281 copper resistance protein CopC; SNSL317_A0216 0.0 Click
6115282..116157 copper resistance protein D; SNSL317_A0217 0.0 Click
7116174..116527 PHAGE_Entero_PsP3: gp28; SNSL317_A0218; phage(gi41057381) 4e-08 Click
8116819..116833 attL    CGAATTTCTGTATTC 0.0 Click
9complement(116891..117745) PHAGE_Entero_mEp235: integrase; SNSL317_A0221; phage(gi428781836) 1e-63 Click
10complement(117805..118458) PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; SNSL317_A0222; phage(gi169257272) 2e-16 Click
11118773..119306 PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; SNSL317_A0223; phage(gi16765210) 5e-95 Click
12complement(119291..119410) hypothetical protein; SNSL317_A0224 0.0 Click
13complement(119794..119982) hypothetical protein; SNSL317_A0226 0.0 Click
14120037..120528 PHAGE_Gifsy_2: bacteriophage DNA packaging protein; terminase, small subunit; SNSL317_A0227; phage(gi169257298) 3e-31 Click
15121081..123135 PHAGE_Gifsy_2: bacteriophage side tail fiber protein; Lambda gpStf (gpN) homolog; SNSL317_A0229; phage(gi169257320) 0.0 Click
16complement(123623..123739) tail fiber assembly protein; SNSL317_A0230 0.0 Click
17124002..124127 arsenical pump membrane protein; SNSL317_A0231 0.0 Click
18complement(124641..124787) conserved hypothetical protein; SNSL317_A0232 0.0 Click
19complement(125275..125889) putative inner membrane protein; SNSL317_A0233 0.0 Click
20complement(125899..126057) conserved hypothetical protein; SNSL317_A0234 0.0 Click
21complement(126190..127104) protein PagO; SNSL317_A0235 0.0 Click
22complement(127497..127625) hypothetical protein; SNSL317_A0236 0.0 Click
23complement(127895..128419) putative fimbriae; usher; SNSL317_A0237 0.0 Click
24128436..128774 PHAGE_Salmon_vB_SosS_Oslo: error-prone lesion bypass DNA polymerase V; SNSL317_A0238; phage(gi399528790) 3e-21 Click
25128969..128983 attR    CGAATTTCTGTATTC 0.0 Click
26complement(129040..129408) PHAGE_Entero_mEp235: integrase; SNSL317_A0239; phage(gi428781836) 8e-20 Click
27133914..133925 attR    CCTGAATCATTG 0.0 Click

Region 2, total : 15 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11376315..1376327 attL    TAGTGAAAATATT 0.0 Click
21388384..1389904 PHAGE_Lactob_1: putative tail fibre protein; SNSL317_A4276; phage(gi226377752) 8e-08 Click
31390155..1390511 PHAGE_Salmon_SSU5: putative repressor of phase 1 flagellin; SNSL317_A4277; phage(gi390013956) 1e-11 Click
4complement(1391349..1393682) PHAGE_Entero_P4: DNA primase; SNSL317_A4278; phage(gi9627512) 0.0 Click
5complement(1393697..1394017) PHAGE_Entero_P4: hypothetical protein P4p07; SNSL317_A4279; phage(gi9627513) 2e-53 Click
6complement(1394014..1394241) conserved hypothetical protein; SNSL317_A4280 0.0 Click
7complement(1394238..1394432) PHAGE_Entero_P4: putative CI repressor; SNSL317_A4281; phage(gi9627516) 2e-23 Click
8complement(1394792..1395058) PHAGE_Entero_P4: transcriptional regulator; SNSL317_A4282; phage(gi9627517) 7e-32 Click
9complement(1395381..1395527) hypothetical protein; SNSL317_A4283 0.0 Click
10complement(1395497..1395673) hypothetical protein; SNSL317_A4285 0.0 Click
111395641..1396336 PHAGE_Entero_P4: head size determination protein sid; SNSL317_A4284; phage(gi9627518) 2e-81 Click
121396333..1396578 PHAGE_Erwini_ENT90: transcriptional regulator; SNSL317_A4286; phage(gi431810990) 1e-14 Click
131396595..1397161 PHAGE_Entero_P4: amber mutation-suppressing protein; SNSL317_A4287; phage(gi9627520) 4e-58 Click
14complement(1397125..1397238) hypothetical protein; SNSL317_A4288 0.0 Click
15complement(1399125..1400240) conserved hypothetical protein; SNSL317_A4290 0.0 Click
161399895..1399907 attR    TAGTGAAAATATT 0.0 Click
17complement(1400251..1401444) PHAGE_Entero_P4: integrase; SNSL317_A4291; phage(gi9627511) 7e-65 Click

Region 3, total : 56 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12795422..2795467 attL    CTTCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGCCAT 0.0 Click
2complement(2795482..2796645) PHAGE_Salmon_epsilon34: Tyrosine integrase; SNSL317_A2936; phage(gi221328640) 0.0 Click
3complement(2797088..2797204) conserved hypothetical protein; SNSL317_A2937 0.0 Click
4complement(2797670..2798377) PHAGE_Salmon_ST160: hypothetical protein; SNSL317_A2938; phage(gi318065907) 2e-52 Click
5complement(2798381..2798596) hypothetical protein; SNSL317_A2939 0.0 Click
6complement(2798596..2799159) PHAGE_Entero_2008: hypothetical protein YYZ_gp09; SNSL317_A2940; phage(gi209427735) 9e-16 Click
7complement(2799156..2799515) PHAGE_Salmon_SPN1S: eaf; SNSL317_A2941; phage(gi374531242) 4e-63 Click
8complement(2799490..2799627) PHAGE_Salmon_epsilon34: hypothetical protein epsilon34_gp30; SNSL317_A2942; phage(gi221328647) 3e-23 Click
9complement(2799624..2799755) PHAGE_Escher_TL_2011c: hypothetical protein; SNSL317_A2943; phage(gi418487084) 1e-12 Click
10complement(2800007..2800135) PHAGE_Entero_ST64T: Orf56; SNSL317_A2944; phage(gi24371598) 2e-17 Click
11complement(2800508..2800777) hypothetical protein; SNSL317_A2945 0.0 Click
12complement(2801077..2801898) PHAGE_Iodoba_phiPLPE: RecE exonuclease VIII; SNSL317_A2946; phage(gi197085693) 9e-22 Click
13complement(2801895..2802203) PHAGE_Cronob_ENT47670: hypothetical protein; SNSL317_A2947; phage(gi431810539) 4e-20 Click
14complement(2802184..2802306) conserved hypothetical protein; SNSL317_A2948 0.0 Click
15complement(2802425..2802556) PHAGE_Entero_mEpX2: CIII protein; SNSL317_A2950; phage(gi428765650) 2e-10 Click
162802525..2802665 hypothetical protein; SNSL317_A2949 0.0 Click
17complement(2802770..2803753) PHAGE_Entero_ES18: gp53; SNSL317_A2951; phage(gi62362266) 3e-140 Click
182803973..2804533 PHAGE_Salmon_SPN9CC: superinfection exclusion protein B; SNSL317_A2952; phage(gi389060504) 6e-100 Click
192805227..2805430 hypothetical protein; SNSL317_A2953 0.0 Click
20complement(2805576..2806655) PHAGE_Salmon_SPN9CC: hypothetical protein; SNSL317_A2954; phage(gi389060507) 0.0 Click
21complement(2807534..2807653) hypothetical protein; SNSL317_A2956 0.0 Click
222807647..2807763 hypothetical protein; SNSL317_A2955 0.0 Click
232807945..2808226 PHAGE_Salmon_vB_SemP_Emek: C1 protein; SNSL317_A2957; phage(gi399498838) 6e-47 Click
242808400..2809215 PHAGE_Entero_P22: hypothetical protein P22gp51; SNSL317_A2958; phage(gi9635519) 2e-155 Click
252809212..2810588 PHAGE_Entero_ST104: gp12; SNSL317_A2959; phage(gi46358676) 0.0 Click
262810661..2810867 PHAGE_Entero_mEp213: hypothetical protein; SNSL317_A2960; phage(gi428782647) 3e-34 Click
272810857..2811285 PHAGE_Escher_HK75: NinB; SNSL317_A2961; phage(gi356870721) 4e-71 Click
282811461..2811802 PHAGE_Salmon_ST160: NinX; SNSL317_A2962; phage(gi318065936) 3e-65 Click
292811964..2812575 PHAGE_Entero_mEp234: NinG protein; SNSL317_A2963; phage(gi428782304) 7e-116 Click
302812593..2812796 PHAGE_Salmon_vB_SemP_Emek: NinY; SNSL317_A2964; phage(gi399498851) 1e-34 Click
312812977..2813156 PHAGE_Entero_ES18: gp72; SNSL317_A2965; phage(gi62362285) 7e-27 Click
322813153..2813917 PHAGE_Entero_ES18: gp73; SNSL317_A2966; phage(gi62362286) 3e-144 Click
332814996..2815322 PHAGE_Entero_P22: inhibitor of gene 13' protein holin; SNSL317_A2967; phage(gi9635530) 7e-56 Click
342815306..2815743 PHAGE_Entero_ES18: gp76; SNSL317_A2968; phage(gi62362289) 2e-76 Click
352815740..2816117 PHAGE_Entero_SfV: putative Rz lytic protein; SNSL317_A2969; phage(gi19549038) 2e-16 Click
362816380..2816598 conserved hypothetical protein; SNSL317_A2970 0.0 Click
372816602..2817204 PHAGE_Escher_HK639: terminase small subunit; SNSL317_A2971; phage(gi356870601) 3e-80 Click
382817204..2818676 PHAGE_Cronob_phiES15: terminase large subunit; SNSL317_A2972; phage(gi401817592) 0.0 Click
392818689..2820158 PHAGE_Cronob_ENT47670: hypothetical protein; SNSL317_A2973; phage(gi431810500) 6e-151 Click
402820190..2821089 PHAGE_Cronob_ENT47670: phage head morphogenesis; SNSL317_A2974; phage(gi431810507) 7e-117 Click
41complement(2821212..2821331) hypothetical protein; SNSL317_A2975 0.0 Click
422821709..2823094 PHAGE_Cronob_ENT47670: hypothetical protein; SNSL317_A2976; phage(gi431810499) 8e-161 Click
432823099..2823527 PHAGE_Cronob_ENT47670: hypothetical protein; SNSL317_A2977; phage(gi431810525) 4e-44 Click
442823539..2824633 PHAGE_Cronob_ENT47670: hypothetical protein; SNSL317_A2978; phage(gi431810503) 7e-125 Click
452824644..2824871 conserved hypothetical protein; SNSL317_A2979 0.0 Click
462824874..2825254 PHAGE_Cronob_ENT47670: hypothetical protein; SNSL317_A2980; phage(gi431810531) 5e-32 Click
472825700..2826056 PHAGE_Salmon_E1: hypothetical protein VIP0025; SNSL317_A2981; phage(gi170676301) 4e-21 Click
482826058..2826483 PHAGE_Cronob_ENT47670: hypothetical protein; SNSL317_A2982; phage(gi431810532) 3e-25 Click
492826480..2826863 PHAGE_Cronob_ENT47670: hypothetical protein; SNSL317_A2983; phage(gi431810530) 6e-37 Click
502826935..2827693 PHAGE_Cronob_ENT47670: major tail subunit; SNSL317_A2984; phage(gi431810520) 3e-56 Click
512827752..2828441 PHAGE_Cronob_ENT47670: hypothetical protein; SNSL317_A2985; phage(gi431810508) 1e-56 Click
522828441..2830954 PHAGE_Cronob_ENT47670: putative tail protein; SNSL317_A2986; phage(gi431810494) 0.0 Click
532830957..2831460 PHAGE_Cronob_ENT47670: hypothetical protein; SNSL317_A2987; phage(gi431810519) 3e-67 Click
542831580..2831930 PHAGE_Cronob_ENT47670: hypothetical protein; SNSL317_A2988; phage(gi431810518) 1e-24 Click
552831923..2832381 PHAGE_Cronob_ENT47670: hypothetical protein; SNSL317_A2989; phage(gi431810526) 2e-34 Click
562832356..2834794 PHAGE_Cronob_ENT47670: putative tail protein; SNSL317_A2990; phage(gi431810495) 0.0 Click
572834852..2836741 PHAGE_Cronob_ENT47670: hypothetical protein; SNSL317_A2991; phage(gi431810496) 2e-42 Click
582837005..2837050 attR    CTTCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGCCAT 0.0 Click

Region 4, total : 10 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13531271..3531284 attL    TTTCCGCCAGCTCA 0.0 Click
23543203..3544861 PHAGE_Entero_P2: Old; SNSL317_A1316; phage(gi9630369) 8e-06 Click
3complement(3544858..3545808) virK homolog; SNSL317_A1317 0.0 Click
43545954..3547072 PHAGE_Cronob_ENT47670: putative tail protein; SNSL317_A1318; phage(gi431810494) 7e-05 Click
53547069..3549015 PHAGE_Plankt_PaV_LD: ABC transporter; SNSL317_A1319; phage(gi371496158) 5e-41 Click
63549047..3549190 hypothetical protein; SNSL317_A1320 0.0 Click
7complement(3549145..3549366) PHAGE_Lactoc_bIL312: Csp; SNSL317_A1321; phage(gi13095918) 5e-14 Click
83549690..3550010 PHAGE_Cronob_vB_CsaM_GAP32: ATP-dependent Clp protease; SNSL317_A1322; phage(gi414087232) 3e-05 Click
93550041..3552317 PROPHAGE_Escher_EDL933: ATP-dependent Clp protease ATP-binding subunit; SNSL317_A1323; phage(gi15800640) 0.0 Click
10complement(3552364..3552570) hypothetical protein; SNSL317_A1324 0.0 Click
11complement(3552889..3553266) PROPHAGE_Escher_CFT073: P4 family integrase; SNSL317_A1325; phage(gi26248244) 3e-47 Click
123560525..3560538 attR    TTTCCGCCAGCTCA 0.0 Click

Region 5, total : 32 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13624529..3624540 attL    TAAAAATGTAGC 0.0 Click
2complement(3624575..3625867) PHAGE_Gifsy_2: bacteriophage integrase; SNSL317_A1385; phage(gi169257268) 0.0 Click
3complement(3625912..3626160) PHAGE_Gifsy_2: bacteriophage excisionase; SNSL317_A1386; phage(gi169257269) 1e-43 Click
4complement(3626201..3626440) PHAGE_Gifsy_1: hypothetical protein STM2634.Gifsy1; SNSL317_A1387; phage(gi169257264) 7e-40 Click
5complement(3626483..3627592) PHAGE_Gifsy_1: RecT; SNSL317_A1388; phage(gi169257263) 0.0 Click
6complement(3627603..3630530) PHAGE_Gifsy_1: bacteriophage exodeoxyribonuclease VIII-like protein; SNSL317_A1389; phage(gi169257262) 0.0 Click
7complement(3630671..3630826) PHAGE_Gifsy_1: hypothetical protein STM2630.Gifsy1; SNSL317_A1390; phage(gi169257260) 3e-11 Click
8complement(3630819..3630935) PHAGE_Gifsy_1: hypothetical protein STM2630.1n.Gifsy1; SNSL317_A1391; phage(gi169257259) 2e-15 Click
9complement(3631234..3631431) PHAGE_Salmon_SPN3UB: putative CI; SNSL317_A1392; phage(gi423262424) 1e-06 Click
103631972..3632466 conserved hypothetical protein; SNSL317_A1393 0.0 Click
113634122..3636053 PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; SNSL317_A0958; phage(gi169257235) 0.0 Click
123636037..3636240 PHAGE_Gifsy_1: bacteriophage head-to-tail joining protein; adapter between portal and gpFII; Lambda gpW homolog; SNSL317_A0959; phage(gi169257234) 2e-31 Click
133636198..3637817 PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; SNSL317_A0960; phage(gi169257233) 0.0 Click
143637807..3639303 PHAGE_Gifsy_1: bacteriophage prohead protease; Lambda gpC homolog; SNSL317_A0961; phage(gi169257232) 0.0 Click
153639316..3639663 PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; SNSL317_A0962; phage(gi169257231) 2e-61 Click
163639718..3640746 PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; SNSL317_A0963; phage(gi169257230) 0.0 Click
173640804..3641163 PHAGE_Gifsy_1: bacteriophage accessory DNA packaging protein; Lambda FI homolog; SNSL317_A0964; phage(gi169257229) 4e-62 Click
183641174..3641557 PHAGE_Gifsy_1: bacteriophage minor capsid protein; forms tail attachment site on head; Lambda FII homolog; SNSL317_A0965; phage(gi169257228) 1e-68 Click
193641635..3642159 PHAGE_Gifsy_1: bacteriophage head-tail assembly protein; Lambda gpZ homolog; SNSL317_A0966; phage(gi169257227) 1e-87 Click
20complement(3642208..3643458) PHAGE_Gifsy_1: transposase; SNSL317_A0968; phage(gi169257226) 0.0 Click
213643447..3643848 PHAGE_Gifsy_1: bacteriophage tail shaft stabilization protein; Lambda gpU homolog; SNSL317_A0967; phage(gi169257225) 2e-73 Click
223643859..3644602 PHAGE_Gifsy_1: bacteriophage major tail subunit; Lambda gpV homolog; SNSL317_A0969; phage(gi169257224) 5e-138 Click
233644653..3645048 PHAGE_Gifsy_1: bacteriophage tail assembly chaperone; Lambda gpG homolog; SNSL317_A0970; phage(gi169257223) 6e-70 Click
243645354..3648449 PHAGE_Gifsy_1: bacteriophage tail tape measure protein; minor tail protein; Lambda gpH homolog; SNSL317_A0972; phage(gi169257221) 0.0 Click
253648452..3648781 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpM homolog; SNSL317_A0973; phage(gi169257220) 2e-61 Click
263648791..3649489 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpL homolog; SNSL317_A0974; phage(gi169257219) 7e-136 Click
273650272..3650778 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpI homolog; SNSL317_A0976; phage(gi169257217) 1e-93 Click
283650840..3654202 PHAGE_Gifsy_1: bacteriophage host specificity protein; tail fiber; Lambda gpJ homolog; SNSL317_A0977; phage(gi169257216) 0.0 Click
293654247..3654483 PHAGE_Gifsy_1: hypothetical protein STM2589.1n.Gifsy1; SNSL317_A0978; phage(gi169257215) 6e-39 Click
303654537..3656909 PHAGE_Gifsy_1: bacteriophage side tail fiber protein; Lambda gpSft (gpN) homolog; SNSL317_A0979; phage(gi169257214) 0.0 Click
313656906..3657730 PHAGE_Gifsy_1: conserved hypothetical protein; contains pfam01661, Macro, Macro domain; SNSL317_A0980; phage(gi169257213) 2e-161 Click
323657720..3658298 PHAGE_Gifsy_1: bacteriophage side tail fiber assembly factor & structural component; Lambda gpTfa homolog; SNSL317_A0981; phage(gi169257212) 1e-110 Click
333659694..3659813 PROPHAGE_Xantho_306: ISxac2 transposase; SNSL317_A0983; phage(gi21244662) 5e-05 Click
343660112..3660123 attR    TAAAAATGTAGC 0.0 Click

Region 6, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3882025..3882540) PROPHAGE_Escher_Sakai: putative tail fiber assembly protein; SNSL317_A1503; phage(gi15834244) 2e-30 Click
2complement(3882550..3884031) PHAGE_Entero_PsP3: gp19; SNSL317_A1504; phage(gi41057371) 2e-74 Click
3complement(3884034..3884666) PHAGE_Burkho_BcepMu: gp51; SNSL317_A1505; phage(gi48696961) 4e-26 Click
4complement(3884659..3885774) PHAGE_Burkho_BcepMu: gp50; SNSL317_A1506; phage(gi48696960) 1e-104 Click
5complement(3885765..3886124) PHAGE_Burkho_BcepMu: gp49; SNSL317_A1507; phage(gi48696959) 1e-35 Click
63886185..3886307 hypothetical protein; SNSL317_A1508 0.0 Click
7complement(3886288..3887826) PHAGE_Salmon_epsilon34: GtrC; putative membrane protein; SNSL317_A1509; phage(gi221328637) 1e-59 Click
8complement(3887835..3888764) PHAGE_Entero_SfV: bactoprenol glucosyltransferase; SNSL317_A1510; phage(gi19549012) 4e-153 Click
9complement(3888761..3889135) PHAGE_Entero_SfV: putative flippase; SNSL317_A1511; phage(gi19549013) 7e-48 Click
10complement(3889317..3889442) hypothetical protein; SNSL317_A1512 0.0 Click
11complement(3889451..3890173) PHAGE_Burkho_BcepMu: gp48; SNSL317_A1513; phage(gi48696958) 4e-40 Click
12complement(3890183..3891226) PHAGE_Burkho_BcepMu: gp47; SNSL317_A1514; phage(gi48696957) 3e-81 Click
13complement(3891214..3891423) PHAGE_Burkho_BcepMu: gp46; SNSL317_A1515; phage(gi48696956) 9e-19 Click
14complement(3891423..3892376) PHAGE_Burkho_BcepMu: gp45; SNSL317_A1516; phage(gi48696955) 5e-46 Click
15complement(3892376..3894727) PHAGE_Burkho_BcepMu: gp44; SNSL317_A1517; phage(gi48696954) 1e-64 Click
16complement(3894824..3894952) conserved hypothetical protein; SNSL317_A1518 0.0 Click
17complement(3894912..3895229) PHAGE_Burkho_BcepMu: gp41; SNSL317_A1519; phage(gi48696951) 3e-10 Click
18complement(3895281..3895805) PHAGE_Burkho_BcepMu: gp40; SNSL317_A1520; phage(gi48696950) 1e-68 Click
19complement(3895805..3897232) PHAGE_Burkho_BcepMu: gp39; SNSL317_A1521; phage(gi48696949) 0.0 Click
20complement(3897222..3897419) PHAGE_Burkho_BcepMu: gp38; SNSL317_A1522; phage(gi48696948) 2e-08 Click
21complement(3897416..3897871) PHAGE_Burkho_BcepMu: gp37; SNSL317_A1523; phage(gi48696947) 3e-13 Click
22complement(3898031..3898345) PHAGE_Burkho_BcepMu: gp25; SNSL317_A1524; phage(gi48696935) 3e-23 Click
23complement(3898358..3898930) PHAGE_Burkho_BcepMu: gp22; SNSL317_A1525; phage(gi48696932) 4e-56 Click
24complement(3898966..3899253) PHAGE_Burkho_BcepMu: gp21; SNSL317_A1526; phage(gi48696931) 1e-20 Click
253899480..3899611 hypothetical protein; SNSL317_A1527 0.0 Click
263899830..3900177 PHAGE_Burkho_BcepMu: gp01; SNSL317_A1528; phage(gi48696911) 7e-24 Click

Region 7, total : 47 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14168972..4169979 PHAGE_Escher_TL_2011b: hypothetical protein; SNSL317_A4446; phage(gi418487646) 8e-37 Click
24170011..4170433 PHAGE_Entero_mEp237: DNA replication protein P; SNSL317_A4447; phage(gi435439308) 9e-31 Click
34170547..4170840 LygF; SNSL317_A4448 0.0 Click
44170837..4171109 PHAGE_Salmon_1: hypothetical protein STM0896.1n.Fels1; SNSL317_A4449; phage(gi169257161) 3e-08 Click
54171749..4171967 PHAGE_Salmon_SPN3UB: hypothetical protein; SNSL317_A4451; phage(gi423262436) 3e-08 Click
64172031..4172630 PHAGE_Entero_mEp237: hypothetical protein; SNSL317_A4452; phage(gi435439315) 4e-56 Click
74172627..4172821 PHAGE_Entero_mEp237: hypothetical protein; SNSL317_A4453; phage(gi435439316) 6e-15 Click
84172803..4173099 PHAGE_Entero_HK225: hypothetical protein; SNSL317_A4454; phage(gi428782439) 1e-38 Click
94173096..4173650 PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; SNSL317_A4455; phage(gi399528832) 2e-06 Click
104173647..4173766 conserved hypothetical protein; SNSL317_A4456 0.0 Click
114173916..4174227 PHAGE_Stx2_c_II: putative antirepressor-like protein; SNSL317_A4457; phage(gi302393152) 3e-48 Click
124174490..4175041 PHAGE_Gifsy_1: conserved hypothetical bacteriophage protein; SNSL317_A4458; phage(gi169257243) 1e-39 Click
134175284..4175472 PHAGE_Gifsy_1: hypothetical protein STM2615.1n.Gifsy1; SNSL317_A4459; phage(gi169257242) 1e-25 Click
14complement(4175856..4176323) conserved hypothetical protein; SNSL317_A4460 0.0 Click
154176573..4176875 PHAGE_Bacter_2: phage 21-like group II holin; SNSL317_A4461; phage(gi212499716) 1e-05 Click
164176853..4177392 PHAGE_Entero_mEp460: endolysin; SNSL317_A4462; phage(gi428782372) 5e-77 Click
174177562..4177699 putative bacteriophage protein; SNSL317_A4463 0.0 Click
184177701..4178213 PHAGE_Gifsy_1: bacteriophage lysis protein; Rz; SNSL317_A4464; phage(gi169257238) 3e-61 Click
194178371..4178559 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip154; SNSL317_A4465; phage(gi20065949) 9e-06 Click
204178686..4178799 protein gp55; SNSL317_A4466 0.0 Click
214178860..4179273 putative gas vesicle protein; SNSL317_A4467 0.0 Click
224179338..4179967 PHAGE_Escher_HK639: terminase small subunit; SNSL317_A4468; phage(gi356870601) 3e-86 Click
234179970..4181589 PHAGE_Burkho_BcepB1A: gp33 TerL; SNSL317_A4469; phage(gi48697520) 2e-154 Click
244181589..4183109 PHAGE_Burkho_Bcep781: gp17; SNSL317_A4470; phage(gi23752328) 3e-101 Click
254183150..4183839 PHAGE_Burkho_Bcep781: gp16; SNSL317_A4471; phage(gi23752327) 3e-36 Click
264183836..4185182 PHAGE_Burkho_Bcep781: gp14; SNSL317_A4472; phage(gi47835023) 3e-40 Click
274185184..4185666 PHAGE_Burkho_Bcep781: gp13; SNSL317_A4473; phage(gi23752324) 8e-14 Click
284185666..4186694 PHAGE_Burkho_Bcep781: gp12; SNSL317_A4474; phage(gi23752323) 6e-82 Click
294186698..4187045 PHAGE_Burkho_Bcep781: gp09; SNSL317_A4475; phage(gi23752320) 1e-09 Click
304187051..4187497 PHAGE_Burkho_Bcep781: gp08; SNSL317_A4476; phage(gi23752319) 4e-20 Click
314187491..4188075 PHAGE_Aeromo_vB_AsaM_56: hypothetical protein; SNSL317_A4477; phage(gi422937546) 3e-18 Click
324188072..4188437 PHAGE_Burkho_Bcep781: gp06; SNSL317_A4478; phage(gi47835021) 2e-08 Click
334188422..4188967 PHAGE_Burkho_Bcep781: gp05; SNSL317_A4479; phage(gi47835036) 2e-14 Click
344188948..4190432 PHAGE_Burkho_Bcep781: gp04; SNSL317_A4480; phage(gi23752316) 7e-67 Click
354190433..4190879 PHAGE_Burkho_Bcep781: gp03; SNSL317_A4481; phage(gi23752315) 2e-13 Click
364190879..4191283 PHAGE_Aeromo_vB_AsaM_56: hypothetical protein; SNSL317_A4482; phage(gi422937551) 9e-22 Click
374191328..4191507 gp15' E'; SNSL317_A4483 0.0 Click
384191491..4193662 PHAGE_Pseudo_PB1: putative tail protein containing transglycosylase; SNSL317_A4484; phage(gi219523908) 1e-13 Click
394193659..4194369 PHAGE_Aeromo_vB_AsaM_56: hypothetical protein; SNSL317_A4485; phage(gi422937557) 5e-08 Click
404194369..4194671 PHAGE_Burkho_Bcep781: gp50; SNSL317_A4486; phage(gi23752358) 1e-08 Click
414194668..4195537 PHAGE_Burkho_Bcep781: gp38; SNSL317_A4487; phage(gi23752349) 2e-10 Click
424195518..4196195 PHAGE_Burkho_Bcep781: gp36; SNSL317_A4488; phage(gi47835025) 2e-20 Click
434196208..4196564 PHAGE_Burkho_Bcep781: gp51; SNSL317_A4489; phage(gi23752359) 3e-14 Click
444196561..4197802 PHAGE_Acinet_AP22: putative baseplate J-like protein; SNSL317_A4490; phage(gi388570818) 9e-54 Click
454197804..4198406 PHAGE_Burkho_Bcep781: gp32; SNSL317_A4491; phage(gi23752343) 3e-26 Click
464198396..4199847 PHAGE_Gifsy_2: bacteriophage side tail fiber protein; Lambda gpStf (gpN) homolog; SNSL317_A4492; phage(gi169257320) 5e-179 Click
474199847..4200431 PHAGE_Gifsy_1: bacteriophage side tail fiber assembly factor & structural component; Lambda gpTfa homolog; SNSL317_A4493; phage(gi169257212) 3e-100 Click

Region 8, total : 68 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14638356..4640020 PHAGE_Ostreo_OsV5: hypothetical protein OsV5_028r; SNSL317_A0075; phage(gi163955001) 3e-84 Click
2complement(4640131..4640271) hypothetical protein; SNSL317_A0077 0.0 Click
34640241..4640319 tRNA 0.0 Click
44640463..4640627 conserved hypothetical protein; SNSL317_A0888 0.0 Click
54640635..4640949 hypothetical protein; SNSL317_A0889 0.0 Click
64640961..4641995 PHAGE_Entero_P1: PdcB; SNSL317_A0890; phage(gi46401727) 1e-151 Click
74642173..4642541 PHAGE_Entero_P1: Lpa; SNSL317_A0891; phage(gi46401728) 2e-47 Click
84642651..4643838 PHAGE_Entero_P1: PacA; SNSL317_A0892; phage(gi46401729) 6e-157 Click
94643838..4645322 PHAGE_Entero_P1: PacB; SNSL317_A0893; phage(gi46401730) 0.0 Click
10complement(4645349..4646200) PHAGE_Entero_P1: C1.100; SNSL317_A0894; phage(gi46401731) 8e-130 Click
11complement(4646309..4646518) PHAGE_Entero_P1: Coi; SNSL317_A0895; phage(gi46401732) 8e-15 Click
124646570..4646713 hypothetical protein; SNSL317_A0896 0.0 Click
134647414..4647620 conserved hypothetical protein; SNSL317_A0897 0.0 Click
144647644..4648714 PHAGE_Sinorh_PBC5: hypothetical protein PBC5p75; SNSL317_A0898; phage(gi18071268) 3e-40 Click
154648711..4648926 PHAGE_Entero_P1: Cra; SNSL317_A0899; phage(gi46401627) 2e-20 Click
164648934..4649962 PHAGE_Entero_P1: Cre; SNSL317_A0900; phage(gi46401628) 1e-157 Click
174649997..4650359 PHAGE_Entero_P1: C8; SNSL317_A0901; phage(gi46401629) 1e-20 Click
184650356..4650514 hypothetical protein; SNSL317_A0902 0.0 Click
194650629..4651249 conserved hypothetical protein; SNSL317_A0903 0.0 Click
204651230..4651679 conserved hypothetical protein; SNSL317_A0904 0.0 Click
214651682..4651993 hypothetical protein; SNSL317_A0905 0.0 Click
224652126..4652677 PHAGE_Entero_P1: Ref; SNSL317_A0906; phage(gi46401630) 2e-66 Click
234652705..4652944 hypothetical protein; SNSL317_A0907 0.0 Click
244653150..4653800 PHAGE_Entero_IME11: hypothetical protein; SNSL317_A0908; phage(gi414090513) 1e-08 Click
25complement(4654533..4654868) PHAGE_Aeromo_Aes012: putative XRE family plasmid maintenance system antidote protein; SNSL317_A0910; phage(gi472438177) 3e-09 Click
264655367..4655504 hypothetical protein; SNSL317_A0911 0.0 Click
274656317..4656694 PHAGE_Entero_P1: gp26; SNSL317_A0913; phage(gi46401704) 9e-59 Click
284656707..4657924 PHAGE_Entero_P1: gp25; SNSL317_A0914; phage(gi46401703) 0.0 Click
294657928..4658668 PHAGE_Entero_P1: gp7; SNSL317_A0915; phage(gi46401702) 5e-101 Click
304658652..4659443 PHAGE_Entero_P1: gp24; SNSL317_A0916; phage(gi46401701) 1e-93 Click
314659472..4660488 PHAGE_Entero_P1: gp6; SNSL317_A0917; phage(gi46401700) 4e-155 Click
324660481..4661089 PHAGE_Entero_P1: gp5; SNSL317_A0918; phage(gi46401699) 2e-91 Click
334661220..4661423 hypothetical protein; SNSL317_A0919 0.0 Click
34complement(4661680..4664430) PHAGE_Cafete_BV_PW1: hypothetical protein; SNSL317_A0920; phage(gi310831380) 3e-34 Click
354664981..4665172 transposase; SNSL317_A0921 0.0 Click
36complement(4665220..4665918) PHAGE_Entero_phiP27: hypothetical protein P27p20; SNSL317_A0922; phage(gi18249884) 4e-09 Click
37complement(4665954..4668413) PHAGE_Entero_P1: Dmt; SNSL317_A0923; phage(gi46401691) 3e-125 Click
38complement(4668413..4669321) PHAGE_Entero_P1: HrdC; SNSL317_A0924; phage(gi46401690) 3e-137 Click
39complement(4669314..4669598) PHAGE_Entero_P1: Uhr; SNSL317_A0925; phage(gi46401689) 7e-32 Click
404669837..4670040 PHAGE_Entero_P1: UpfC; SNSL317_A0926; phage(gi46401688) 9e-29 Click
414670050..4670832 PHAGE_Entero_P1: UpfB; SNSL317_A0927; phage(gi46401687) 3e-72 Click
424670864..4671286 PHAGE_Entero_P1: PpfA; SNSL317_A0928; phage(gi46401686) 3e-39 Click
434671312..4671452 PHAGE_Entero_P1: Mlp; SNSL317_A0929; phage(gi46401685) 2e-17 Click
444671464..4671826 PHAGE_Entero_epsilon15: hypothetical protein epsilon15p50; SNSL317_A0930; phage(gi117371479) 2e-41 Click
454672129..4673016 PHAGE_Entero_P1: RepA; SNSL317_A0931; phage(gi46401683) 3e-52 Click
464673423..4674628 PHAGE_Entero_P1: ParA; SNSL317_A0932; phage(gi46401682) 2e-131 Click
474674625..4675590 PHAGE_Entero_P1: ParB; SNSL317_A0933; phage(gi46401681) 1e-59 Click
484675855..4677558 PHAGE_Entero_P1: gp23; SNSL317_A0934; phage(gi46401680) 0.0 Click
494677613..4679211 PHAGE_Entero_P1: gp22; SNSL317_A0935; phage(gi46401679) 0.0 Click
504679223..4680041 PHAGE_Entero_P1: gp21; SNSL317_A0936; phage(gi46401678) 4e-109 Click
514680321..4680671 PHAGE_Entero_P1: PmgG; SNSL317_A0937; phage(gi46401677) 1e-42 Click
524680682..4681191 PHAGE_Entero_P1: BplB; SNSL317_A0938; phage(gi46401676) 2e-80 Click
53complement(4681339..4681569) hypothetical protein; SNSL317_A0939 0.0 Click
54complement(4681939..4682292) PHAGE_Burkho_2: gp7, putative addiction module killer protein; SNSL317_A0940; phage(gi134288691) 3e-10 Click
55complement(4682420..4683424) PHAGE_Entero_P1: Ant1; SNSL317_A0941; phage(gi46401669) 2e-112 Click
564683978..4684097 hypothetical protein; SNSL317_A0942 0.0 Click
574684228..4684851 hypothetical protein; SNSL317_A0943 0.0 Click
584685064..4685342 hypothetical protein; SNSL317_A0944 0.0 Click
594685401..4685967 PHAGE_Entero_P1: PmgC; SNSL317_A0945; phage(gi46401664) 7e-77 Click
604685975..4686577 PHAGE_Entero_P1: Tub; SNSL317_A0946; phage(gi46401663) 3e-93 Click
614686590..4687483 PHAGE_Entero_P1: PmgB; SNSL317_A0947; phage(gi46401662) 2e-134 Click
624687545..4690790 PHAGE_Entero_P1: Sit; SNSL317_A0948; phage(gi46401661) 0.0 Click
634690790..4691146 PHAGE_Entero_P1: PmgA; SNSL317_A0949; phage(gi46401660) 1e-49 Click
644691147..4692589 PHAGE_Entero_P1: BplA; SNSL317_A0950; phage(gi46401659) 0.0 Click
654692589..4693704 PHAGE_Entero_P1: gp16; SNSL317_A0951; phage(gi46401658) 1e-96 Click
664693764..4694201 PHAGE_Entero_P1: gpR; SNSL317_A0952; phage(gi46401657) 2e-56 Click
674694214..4696322 PHAGE_Entero_P1: S; SNSL317_A0953; phage(gi46401656) 4e-124 Click
684696322..4696909 PHAGE_Salmon_ST64B: Probable tail fiber assembly protein; SNSL317_A0954; phage(gi23505469) 1e-67 Click
69complement(4696914..4697498) PHAGE_Salmon_RE_2010: tail fiber assembly protein; SNSL317_A0955; phage(gi418489714) 4e-56 Click

Region 9, total : 40 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4701040..4701198) PHAGE_Gifsy_1: hypothetical protein STM2630.Gifsy1; SNSL317_A3545; phage(gi169257260) 1e-25 Click
2complement(4701191..4701307) PHAGE_Gifsy_1: hypothetical protein STM2630.1n.Gifsy1; SNSL317_A3546; phage(gi169257259) 2e-15 Click
3complement(4701655..4702029) hypothetical protein; SNSL317_A3547 0.0 Click
4complement(4702317..4702445) hypothetical protein; SNSL317_A3548 0.0 Click
5complement(4702696..4703535) PHAGE_Lactob_LF1: chromosome partitioning ATPase; SNSL317_A3549; phage(gi418489414) 4e-29 Click
64704516..4704665 PHAGE_Gifsy_1: probable regulatory protein; transcriptional activator; lambda CII analog; SNSL317_A3550; phage(gi169257256) 2e-21 Click
74704757..4705641 PHAGE_Gifsy_1: bacteriophage replication protein O; SNSL317_A3551; phage(gi169257255) 1e-43 Click
84705638..4706333 PHAGE_Escher_HK639: replication protein 14; SNSL317_A3552; phage(gi356870655) 9e-57 Click
94706347..4707045 PHAGE_Salmon_vB_SemP_Emek: Eaa1; SNSL317_A3553; phage(gi399498822) 3e-57 Click
104708028..4708261 PHAGE_Gifsy_1: bacteriophage putative DNA damage-inducible protein; DinI homolog; SNSL317_A3554; phage(gi169257250) 2e-38 Click
114708510..4708626 PHAGE_Entero_mEp237: hypothetical protein; SNSL317_A3555; phage(gi435439314) 2e-15 Click
124708661..4709263 PHAGE_Gifsy_1: conserved hypothetical bacteriophage protein; SNSL317_A3556; phage(gi169257248) 2e-111 Click
134709263..4709469 PHAGE_Gifsy_1: hypothetical protein STM2620.1n.Gifsy1; SNSL317_A3557; phage(gi169257247) 8e-36 Click
144709472..4710083 PHAGE_Gifsy_1: NinG; SNSL317_A3558; phage(gi169257246) 5e-117 Click
154710217..4710894 PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; SNSL317_A3559; phage(gi169257244) 3e-130 Click
164711045..4711170 hypothetical protein; SNSL317_A3560 0.0 Click
174711167..4711730 PHAGE_Gifsy_1: conserved hypothetical bacteriophage protein; SNSL317_A3561; phage(gi169257243) 1e-103 Click
184712071..4712149 tRNA 0.0 Click
194712237..4712425 PHAGE_Gifsy_1: hypothetical protein STM2615.1n.Gifsy1; SNSL317_A3563; phage(gi169257242) 2e-33 Click
20complement(4712640..4713326) PHAGE_Gifsy_1: virulence protein GogA; SNSL317_A3564; phage(gi169257241) 9e-134 Click
214713596..4713931 PHAGE_Gifsy_1: bacteriophage lysis protein; holin; SNSL317_A3565; phage(gi169257240) 4e-58 Click
224713918..4714367 PHAGE_Gifsy_1: bacteriophage lysin protein; endolysin; SNSL317_A3566; phage(gi169257239) 2e-82 Click
234714385..4714837 PHAGE_Gifsy_1: bacteriophage lysis protein; Rz; SNSL317_A3567; phage(gi169257238) 6e-80 Click
24complement(4715073..4715396) PHAGE_Gifsy_1: hypothetical protein STM2610.Gifsy1; SNSL317_A3568; phage(gi169257237) 8e-57 Click
254715761..4716306 PHAGE_Gifsy_1: DNA packaging protein; small terminase subunit; Lambda Nu1 homolog; SNSL317_A3569; phage(gi169257236) 2e-87 Click
264716278..4718209 PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; SNSL317_A3570; phage(gi169257235) 0.0 Click
274718193..4718396 PHAGE_Gifsy_1: bacteriophage head-to-tail joining protein; adapter between portal and gpFII; Lambda gpW homolog; SNSL317_A3571; phage(gi169257234) 2e-31 Click
284719730..4719972 PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; SNSL317_A3573; phage(gi169257233) 6e-39 Click
294721469..4721816 PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; SNSL317_A3576; phage(gi169257231) 2e-61 Click
304721871..4722899 PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; SNSL317_A3577; phage(gi169257230) 0.0 Click
314722957..4723316 PHAGE_Gifsy_1: bacteriophage accessory DNA packaging protein; Lambda FI homolog; SNSL317_A3578; phage(gi169257229) 4e-62 Click
324723327..4723710 PHAGE_Gifsy_1: bacteriophage minor capsid protein; forms tail attachment site on head; Lambda FII homolog; SNSL317_A3579; phage(gi169257228) 1e-68 Click
334723739..4724317 PHAGE_Gifsy_1: bacteriophage head-tail assembly protein; Lambda gpZ homolog; SNSL317_A3580; phage(gi169257227) 2e-103 Click
34complement(4724366..4725616) PHAGE_Gifsy_1: transposase; SNSL317_A3581; phage(gi169257226) 0.0 Click
354726012..4726755 PHAGE_Gifsy_1: bacteriophage major tail subunit; Lambda gpV homolog; SNSL317_A3583; phage(gi169257224) 5e-138 Click
364726806..4727201 PHAGE_Gifsy_1: bacteriophage tail assembly chaperone; Lambda gpG homolog; SNSL317_A3584; phage(gi169257223) 2e-70 Click
374727264..4727536 PHAGE_Gifsy_1: part of bacteriophage tail assembly chaperone gpG by translational frameshifting; Lambda gpT homolog; SNSL317_A3585; phage(gi169257222) 1e-47 Click
384727508..4730603 PHAGE_Gifsy_1: bacteriophage tail tape measure protein; minor tail protein; Lambda gpH homolog; SNSL317_A3586; phage(gi169257221) 0.0 Click
394730606..4730935 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpM homolog; SNSL317_A3587; phage(gi169257220) 2e-61 Click
404730945..4731643 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpL homolog; SNSL317_A3588; phage(gi169257219) 7e-136 Click
414732426..4732932 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpI homolog; SNSL317_A3590; phage(gi169257217) 1e-93 Click

Region 10, total : 48 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4765774..4766835) PHAGE_Pseudo_MP1412: diguanylate-cyclase GGDEF domain; SNSL317_A2233; phage(gi399529005) 2e-06 Click
24767313..4769280 PHAGE_Parame_FR483: hypothetical protein FR483_N003L; SNSL317_A2234; phage(gi155370101) 3e-128 Click
34769999..4770217 PHAGE_Salmon_SPN3UB: hypothetical protein; SNSL317_A2235; phage(gi423262436) 3e-08 Click
44770280..4770882 PHAGE_Gifsy_1: conserved hypothetical bacteriophage protein; SNSL317_A2236; phage(gi169257248) 3e-110 Click
54770882..4771088 PHAGE_Gifsy_1: hypothetical protein STM2620.1n.Gifsy1; SNSL317_A2237; phage(gi169257247) 4e-30 Click
64771091..4771732 PHAGE_Salmon_SPN3UB: NinG; SNSL317_A2238; phage(gi423262439) 1e-120 Click
74771865..4772662 PHAGE_Salmon_SPN3UB: antitermination protein Q; SNSL317_A2239; phage(gi423262441) 8e-153 Click
8complement(4772795..4773481) PHAGE_Gifsy_1: virulence protein GogA; SNSL317_A2240; phage(gi169257241) 8e-129 Click
94773857..4774045 PHAGE_Gifsy_1: hypothetical protein STM2615.1n.Gifsy1; SNSL317_A2241; phage(gi169257242) 1e-25 Click
10complement(4774429..4774896) conserved hypothetical protein; SNSL317_A2242 0.0 Click
114775146..4775361 PHAGE_Escher_P13374: lysis protein, holin; SNSL317_A2243; phage(gi410491645) 5e-09 Click
124775324..4775827 PHAGE_Salmon_SE1: Gp19; SNSL317_A2244; phage(gi219681236) 6e-58 Click
134775857..4776315 PHAGE_Gifsy_1: bacteriophage lysis protein; Rz; SNSL317_A2245; phage(gi169257238) 2e-49 Click
14complement(4776504..4776827) PHAGE_Gifsy_1: hypothetical protein STM2610.Gifsy1; SNSL317_A2246; phage(gi169257237) 1e-55 Click
154777191..4777736 PHAGE_Gifsy_1: DNA packaging protein; small terminase subunit; Lambda Nu1 homolog; SNSL317_A2247; phage(gi169257236) 3e-87 Click
164777708..4779639 PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; SNSL317_A2248; phage(gi169257235) 0.0 Click
174779623..4779826 PHAGE_Gifsy_1: bacteriophage head-to-tail joining protein; adapter between portal and gpFII; Lambda gpW homolog; SNSL317_A2249; phage(gi169257234) 2e-31 Click
184779784..4781403 PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; SNSL317_A2250; phage(gi169257233) 0.0 Click
194781393..4782889 PHAGE_Gifsy_1: bacteriophage prohead protease; Lambda gpC homolog; SNSL317_A2251; phage(gi169257232) 0.0 Click
204782902..4783249 PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; SNSL317_A2252; phage(gi169257231) 2e-61 Click
214784389..4784748 PHAGE_Gifsy_1: bacteriophage accessory DNA packaging protein; Lambda FI homolog; SNSL317_A2254; phage(gi169257229) 4e-62 Click
224784759..4785142 PHAGE_Gifsy_1: bacteriophage minor capsid protein; forms tail attachment site on head; Lambda FII homolog; SNSL317_A2255; phage(gi169257228) 3e-68 Click
234785170..4785748 PHAGE_Gifsy_1: bacteriophage head-tail assembly protein; Lambda gpZ homolog; SNSL317_A2256; phage(gi169257227) 7e-104 Click
24complement(4785797..4786552) PHAGE_Gifsy_1: transposase; SNSL317_A2258; phage(gi169257226) 4e-144 Click
254786245..4786721 hypothetical protein; SNSL317_A2257 0.0 Click
264787035..4787436 PHAGE_Gifsy_1: bacteriophage tail shaft stabilization protein; Lambda gpU homolog; SNSL317_A2259; phage(gi169257225) 2e-73 Click
274787447..4788190 PHAGE_Gifsy_1: bacteriophage major tail subunit; Lambda gpV homolog; SNSL317_A2260; phage(gi169257224) 5e-138 Click
284788241..4788636 PHAGE_Gifsy_1: bacteriophage tail assembly chaperone; Lambda gpG homolog; SNSL317_A2261; phage(gi169257223) 2e-70 Click
294788699..4788971 PHAGE_Gifsy_1: part of bacteriophage tail assembly chaperone gpG by translational frameshifting; Lambda gpT homolog; SNSL317_A2262; phage(gi169257222) 1e-47 Click
304788943..4792038 PHAGE_Gifsy_1: bacteriophage tail tape measure protein; minor tail protein; Lambda gpH homolog; SNSL317_A2263; phage(gi169257221) 0.0 Click
314792041..4792370 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpM homolog; SNSL317_A2264; phage(gi169257220) 2e-61 Click
324792380..4793078 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpL homolog; SNSL317_A2265; phage(gi169257219) 7e-136 Click
334793861..4794367 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpI homolog; SNSL317_A2267; phage(gi169257217) 1e-93 Click
344795723..4796292 PHAGE_Entero_2: DNA-invertase; SNSL317_A4533; phage(gi169936026) 2e-68 Click
354796517..4796702 PHAGE_Entero_P1: LydA; SNSL317_A4534; phage(gi46401651) 5e-21 Click
364797126..4797731 PHAGE_Entero_P1: Hdf; SNSL317_A4535; phage(gi46401649) 3e-84 Click
374797823..4799664 PHAGE_Entero_P1: DarA; SNSL317_A4536; phage(gi46401648) 0.0 Click
384799661..4800020 PHAGE_Entero_P1: DdrA; SNSL317_A4537; phage(gi46401647) 2e-44 Click
394800033..4803029 PHAGE_Entero_P1: DdrB; SNSL317_A4538; phage(gi46401646) 0.0 Click
404803016..4803309 PHAGE_Entero_P1: Hxr; SNSL317_A4539; phage(gi46401645) 8e-15 Click
41complement(4803339..4803875) PHAGE_Entero_P1: Ssb; SNSL317_A4540; phage(gi46401640) 1e-65 Click
424804052..4804606 PHAGE_Entero_P1: Lyz; SNSL317_A4541; phage(gi46401639) 6e-89 Click
434804603..4804857 PHAGE_Entero_P1: LydD; SNSL317_A4542; phage(gi46401638) 7e-32 Click
44complement(4804835..4805365) hypothetical protein; SNSL317_A4543 0.0 Click
45complement(4805362..4806087) hypothetical protein; SNSL317_A4544 0.0 Click
464806130..4806300 hypothetical protein; SNSL317_A4545 0.0 Click
47complement(4806510..4807526) PHAGE_Entero_P1: Pro; SNSL317_A4546; phage(gi46401637) 2e-155 Click
48complement(4807519..4809189) PHAGE_Entero_P1: Prt; SNSL317_A4547; phage(gi46401636) 0.0 Click

Region 11, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14868529..4868852 PHAGE_Iodoba_phiPLPE: gp40 putative lipoprotein; SNSL317_A2291; phage(gi197085654) 1e-06 Click
2complement(4868849..4870150) PHAGE_Burkho_phi1026b: gp59; SNSL317_A2292; phage(gi38707949) 6e-51 Click
3complement(4870254..4870709) PHAGE_Prochl_P_HM1: hypothetical protein; SNSL317_A2293; phage(gi326782031) 6e-37 Click
44871621..4873552 PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; SNSL317_A1675; phage(gi169257235) 0.0 Click
54873536..4873739 PHAGE_Gifsy_1: bacteriophage head-to-tail joining protein; adapter between portal and gpFII; Lambda gpW homolog; SNSL317_A1676; phage(gi169257234) 2e-31 Click
64873697..4875316 PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; SNSL317_A1677; phage(gi169257233) 0.0 Click
74875306..4876802 PHAGE_Gifsy_1: bacteriophage prohead protease; Lambda gpC homolog; SNSL317_A1678; phage(gi169257232) 0.0 Click
84876815..4877162 PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; SNSL317_A1679; phage(gi169257231) 2e-61 Click
94877217..4878245 PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; SNSL317_A1680; phage(gi169257230) 0.0 Click
104878303..4878662 PHAGE_Gifsy_1: bacteriophage accessory DNA packaging protein; Lambda FI homolog; SNSL317_A1681; phage(gi169257229) 4e-62 Click
114878673..4879056 PHAGE_Gifsy_1: bacteriophage minor capsid protein; forms tail attachment site on head; Lambda FII homolog; SNSL317_A1682; phage(gi169257228) 1e-68 Click
124879084..4879662 PHAGE_Gifsy_1: bacteriophage head-tail assembly protein; Lambda gpZ homolog; SNSL317_A1683; phage(gi169257227) 7e-104 Click
13complement(4879711..4880961) PHAGE_Gifsy_1: transposase; SNSL317_A1685; phage(gi169257226) 0.0 Click
144880950..4881351 PHAGE_Gifsy_1: bacteriophage tail shaft stabilization protein; Lambda gpU homolog; SNSL317_A1684; phage(gi169257225) 2e-73 Click
154881362..4882105 PHAGE_Gifsy_1: bacteriophage major tail subunit; Lambda gpV homolog; SNSL317_A1686; phage(gi169257224) 5e-138 Click
164882156..4882551 PHAGE_Gifsy_1: bacteriophage tail assembly chaperone; Lambda gpG homolog; SNSL317_A1687; phage(gi169257223) 2e-70 Click
174882614..4882886 PHAGE_Gifsy_1: part of bacteriophage tail assembly chaperone gpG by translational frameshifting; Lambda gpT homolog; SNSL317_A1688; phage(gi169257222) 1e-47 Click
184882858..4885953 PHAGE_Gifsy_1: bacteriophage tail tape measure protein; minor tail protein; Lambda gpH homolog; SNSL317_A1689; phage(gi169257221) 0.0 Click
194885956..4886285 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpM homolog; SNSL317_A1690; phage(gi169257220) 2e-61 Click
204886295..4886993 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpL homolog; SNSL317_A1691; phage(gi169257219) 7e-136 Click
214887776..4888282 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpI homolog; SNSL317_A1693; phage(gi169257217) 1e-93 Click