Salmonella enterica subsp. enterica serovar Schwarzengrund str. [asmbl_id: NC_000000].4761576, GC%: 52.18%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11517981..1519066 PHAGE_Entero_phiEco32: internal virion protein; SeSB_A3452; phage(gi167583577) 9e-07 Click
2complement(1519018..1519137) hypothetical protein; SeSB_A3453 0.0 Click
31520453..1520464 attL    TCGCTGGTGCTG 0.0 Click
4complement(1521100..1521594) PHAGE_Entero_SfV: small terminase subunit; SeSB_A2458; phage(gi19548991) 9e-91 Click
5complement(1521720..1522070) PHAGE_Entero_SfV: hypothetical protein SfVp53; SeSB_A2459; phage(gi19549040) 3e-64 Click
6complement(1522121..1522453) hypothetical protein; SeSB_A2460 0.0 Click
7complement(1522916..1523308) PHAGE_Entero_SfV: putative Rz lytic protein; SeSB_A2461; phage(gi19549038) 8e-39 Click
8complement(1523305..1523919) PHAGE_Salmon_ST64B: lytic enzyme (putative glycohydrolase); SeSB_A2462; phage(gi23505496) 1e-74 Click
9complement(1523922..1524269) PHAGE_Gifsy_2: bacteriophage lysis protein; holin; SeSB_A2463; phage(gi169257295) 3e-10 Click
10complement(1524464..1525153) PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; SeSB_A2464; phage(gi169257244) 4e-100 Click
11complement(1525287..1525898) PHAGE_Gifsy_2: NinG; SeSB_A2465; phage(gi169257288) 3e-115 Click
12complement(1525901..1526107) PHAGE_Gifsy_2: hypothetical protein STM1021.1n.Gifsy2; SeSB_A2466; phage(gi169257287) 1e-35 Click
13complement(1526107..1526709) PHAGE_Gifsy_2: hypothetical protein STM1020.Gifsy2; SeSB_A2467; phage(gi169257286) 3e-111 Click
14complement(1527125..1527358) PHAGE_Gifsy_2: bacteriophage damage-inducible protein DinI; SeSB_A2468; phage(gi169257284) 8e-39 Click
15complement(1527650..1527802) PHAGE_Gifsy_2: hypothetical protein STM1019.1n.Gifsy2; SeSB_A2469; phage(gi169257283) 2e-23 Click
16complement(1528326..1528673) PHAGE_Gifsy_2: hypothetical protein STM1016.Gifsy2; SeSB_A2471; phage(gi169257281) 5e-60 Click
17complement(1528684..1529433) PHAGE_Gifsy_2: bacteriophage DNA replication protein; SeSB_A2472; phage(gi169257280) 7e-141 Click
18complement(1529436..1530419) PHAGE_Gifsy_2: bacteriophage DNA replication protein; Lambda gpo homolog; SeSB_A2473; phage(gi169257279) 0.0 Click
19complement(1530397..1530513) hypothetical protein; SeSB_A2474 0.0 Click
20complement(1530504..1530653) PHAGE_Gifsy_2: bacteriophage transcriptional activator; Lambda gpCII analog; SeSB_A2475; phage(gi169257278) 2e-21 Click
211531807..1531923 PHAGE_Gifsy_2: hypothetical protein STM1010.2n.Gifsy2; SeSB_A2476; phage(gi169257275) 3e-15 Click
221531916..1532074 PHAGE_Gifsy_2: hypothetical protein STM1010.1n.Gifsy2; SeSB_A2477; phage(gi169257274) 3e-24 Click
231532573..1535500 PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; SeSB_A2478; phage(gi169257272) 0.0 Click
241535511..1536620 PHAGE_Gifsy_2: conserved hypothetical bacteriophage protein; SeSB_A2479; phage(gi169257271) 0.0 Click
251536663..1536902 PHAGE_Gifsy_2: hypothetical protein STM1007.Gifsy2; SeSB_A2480; phage(gi169257270) 7e-40 Click
261537040..1537051 attR    TCGCTGGTGCTG 0.0 Click
27complement(1537266..1538447) PHAGE_Entero_HK544: integrase; SeSB_A2481; phage(gi428783241) 1e-141 Click

Region 2, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11749639..1750142 PHAGE_Salmon_SE1: Gp15; SeSB_A0816; phage(gi219681237) 2e-72 Click
21750352..1750849 PHAGE_Entero_HK620: hypothetical protein HK620p38; SeSB_A0817; phage(gi13559861) 1e-94 Click
31750921..1751103 PHAGE_Entero_mEp234: hypothetical protein; SeSB_A0818; phage(gi428782313) 5e-28 Click
41751672..1751929 PHAGE_Salmon_SPN3UB: terminase small subunit; SeSB_A0819; phage(gi423262378) 3e-40 Click
51751913..1753232 PHAGE_Salmon_SPN3UB: terminase large subunit; SeSB_A0820; phage(gi423262379) 0.0 Click
61753365..1754717 PHAGE_Salmon_SPN3UB: hypothetical protein; SeSB_A0821; phage(gi423262380) 0.0 Click
71754671..1755630 PHAGE_Salmon_SPN3UB: hypothetical protein; SeSB_A0822; phage(gi423262381) 0.0 Click
81755646..1756908 PHAGE_Salmon_SPN3UB: hypothetical protein; SeSB_A0823; phage(gi423262382) 0.0 Click
91756921..1757370 PHAGE_Salmon_SPN3UB: hypothetical protein; SeSB_A0824; phage(gi423262383) 1e-78 Click
101757388..1758464 PHAGE_Salmon_SPN3UB: hypothetical protein; SeSB_A0825; phage(gi423262384) 1e-159 Click
111758474..1758653 PHAGE_Salmon_SPN3UB: hypothetical protein; SeSB_A0826; phage(gi423262385) 7e-29 Click
12complement(1758981..1759112) hypothetical protein; SeSB_A0828 0.0 Click
131759106..1759285 PHAGE_Salmon_SPN3UB: hypothetical protein; SeSB_A0827; phage(gi423262387) 1e-30 Click
141759278..1759640 PHAGE_Salmon_SPN3UB: hypothetical protein; SeSB_A0829; phage(gi423262388) 2e-69 Click
151759728..1760165 PHAGE_Salmon_SPN3UB: hypothetical protein; SeSB_A0830; phage(gi423262389) 8e-81 Click
161760162..1760548 PHAGE_Salmon_SPN3UB: hypothetical protein; SeSB_A0831; phage(gi423262390) 1e-69 Click
171760566..1761306 PHAGE_Salmon_SPN3UB: hypothetical protein; SeSB_A0832; phage(gi423262391) 2e-140 Click
181761351..1762004 PHAGE_Salmon_SPN3UB: hypothetical protein; SeSB_A0833; phage(gi423262392) 6e-123 Click
19complement(1762976..1763347) PHAGE_Salmon_SPN3UB: hypothetical protein; SeSB_A0835; phage(gi423262394) 1e-65 Click
201763388..1763525 PHAGE_Salmon_SPN3UB: hypothetical protein; SeSB_A0836; phage(gi423262395) 7e-19 Click
21complement(1763546..1763668) PHAGE_Salmon_SPN3UB: Arc-like DNA binding domain protein; SeSB_A0837; phage(gi423262396) 3e-15 Click
221763983..1764156 PHAGE_Salmon_SPN3UB: hypothetical protein; SeSB_A0838; phage(gi423262397) 2e-25 Click
231764230..1764868 PHAGE_Salmon_SPN3UB: hypothetical protein; SeSB_A0839; phage(gi423262398) 2e-120 Click
241764948..1765736 PHAGE_Salmon_SPN3UB: putative antirepressor family protein; SeSB_A0840; phage(gi423262399) 1e-149 Click
251766711..1766887 conserved hypothetical protein; SeSB_A0841 0.0 Click
26complement(1767398..1768294) PHAGE_Salmon_vB_SemP_Emek: antirepressor; SeSB_A0843; phage(gi399498814) 5e-57 Click

Region 3, total : 50 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11769393..1772563 PHAGE_Salmon_vB_SosS_Oslo: tail length tape-measure protein; SeSB_A0845; phage(gi399528779) 5e-137 Click
2complement(1772588..1772704) hypothetical protein; SeSB_A0846 0.0 Click
3complement(1772785..1772925) hypothetical protein; SeSB_A0848 0.0 Click
41772913..1773260 PHAGE_Salmon_1: putative bacteriophage minor tail protein; Lambda gpM homolog; SeSB_A0847; phage(gi169257197) 2e-15 Click
51773296..1774000 PHAGE_Salmon_1: putative bacteriophage minor tail protein; Lambda gpL homolog; SeSB_A0849; phage(gi169257199) 6e-56 Click
6complement(1774689..1774853) hypothetical protein; SeSB_A0850 0.0 Click
71775199..1778378 PHAGE_Salmon_SPN3UB: host specificity protein J; SeSB_A0851; phage(gi423262414) 0.0 Click
81778387..1779346 PHAGE_Salmon_SPN3UB: hypothetical protein; SeSB_A0852; phage(gi423262415) 0.0 Click
91779357..1780493 PHAGE_Salmon_vB_SosS_Oslo: minor tail protein; SeSB_A0853; phage(gi399528788) 1e-63 Click
101780906..1780937 attL    CGCAGGTTCGAATCCTGCAGGGCGCGCCATTT 0.0 Click
111781101..1782288 PROPHAGE_Escher_CFT073: putative prophage integrase; SeSB_A0854; phage(gi26250313) 3e-141 Click
121782788..1782934 hypothetical protein; SeSB_A0855 0.0 Click
131783585..1783782 PHAGE_Burkho_KL3: gp52; SeSB_A0856; phage(gi327198097) 1e-09 Click
141783884..1784480 PHAGE_Acinet_AP22: putative DNA-binding protein; SeSB_A0857; phage(gi388570841) 1e-20 Click
151785366..1785527 hypothetical protein; SeSB_A0859 0.0 Click
161785520..1785918 PHAGE_Salmon_1: hypothetical protein STM0898.2n.Fels1; SeSB_A0860; phage(gi169257165) 3e-11 Click
171785911..1786081 hypothetical protein; SeSB_A0861 0.0 Click
181786282..1786602 PHAGE_Entero_P1: Ant2; SeSB_A0863; phage(gi46401670) 2e-12 Click
191786613..1787407 PHAGE_Salmon_1: hypothetical protein STM0896.Fels1; SeSB_A0864; phage(gi169257163) 9e-32 Click
201787404..1787709 hypothetical protein; SeSB_A0865 0.0 Click
211787799..1788182 hypothetical protein; SeSB_A0866 0.0 Click
221788175..1788822 PHAGE_Entero_phiP27: hypothetical protein P27p06; SeSB_A0867; phage(gi18249870) 2e-22 Click
231788832..1790973 PHAGE_Thermo_THSA_485A: protein of unknown function DUF927; SeSB_A0868; phage(gi397912648) 1e-16 Click
241790970..1791365 PHAGE_Pseudo_F116: single-stranded DNA-binding protein; SeSB_A0869; phage(gi56692915) 1e-07 Click
251791409..1792323 PHAGE_Salmon_1: hypothetical protein STM0902.Fels1; SeSB_A0870; phage(gi169257177) 2e-56 Click
261792417..1793220 PHAGE_Salmon_1: bacteriophage antitermination protein Q; SeSB_A0871; phage(gi169257178) 4e-103 Click
27complement(1793336..1793542) PHAGE_Salmon_1: hypothetical protein STM0904.Fels1; SeSB_A0872; phage(gi169257179) 3e-24 Click
281795044..1795388 PHAGE_Salmon_1: bacteriophage lysis protein; holin; SeSB_A0873; phage(gi169257181) 4e-64 Click
291795391..1796005 PHAGE_Salmon_1: putative bacteriophage endolysin; SeSB_A0874; phage(gi169257182) 2e-109 Click
301796002..1796538 PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; SeSB_A0875; phage(gi16765210) 2e-80 Click
311796535..1796786 hypothetical protein; SeSB_A0876 0.0 Click
321796862..1797395 hypothetical protein; SeSB_A0877 0.0 Click
331798053..1798550 PHAGE_Salmon_1: bacteriophage terminase, small subunit; SeSB_A0878; phage(gi169257184) 2e-27 Click
341798522..1800651 PHAGE_Salmon_1: bacteriophage terminase, large subunit; SeSB_A0879; phage(gi169257185) 0.0 Click
351800648..1800854 PHAGE_Salmon_1: hypothetical protein STM0911.1n.Fels1; SeSB_A0880; phage(gi169257186) 1e-31 Click
361800851..1802386 PHAGE_Salmon_1: putative bacteriophage portal protein; SeSB_A0881; phage(gi169257187) 0.0 Click
371802349..1804418 PHAGE_Salmon_1: putative Clp protease; SeSB_A0882; phage(gi169257188) 0.0 Click
381804507..1804830 PHAGE_Salmon_1: hypothetical protein STM0912.2n.Fels1; SeSB_A0883; phage(gi169257189) 4e-53 Click
391804823..1805098 PHAGE_Salmon_1: conserved hypothetical bacteriophage protein; SeSB_A0884; phage(gi169257190) 1e-45 Click
401805102..1805686 PHAGE_Salmon_1: putative bacteriophage tail component; Lambda gpZ homolog; SeSB_A0885; phage(gi169257191) 1e-101 Click
411805683..1806084 PHAGE_Salmon_1: putative bacteriophage minor tail protein; Lambda gpU homolog; SeSB_A0886; phage(gi169257192) 2e-61 Click
421806095..1806838 PHAGE_Salmon_1: putative bacteriophage major tail protein; Lambda gpV homolog; SeSB_A0887; phage(gi169257193) 8e-120 Click
431806889..1807284 PHAGE_Salmon_1: putative bacteriophage minor tail protein; Lambda gpG homolog; SeSB_A0888; phage(gi169257194) 2e-49 Click
441807347..1807619 PHAGE_Salmon_1: putative minor tail protein; SeSB_A0889; phage(gi169257195) 5e-32 Click
451807591..1810686 PHAGE_Salmon_1: putative bacteriophage tail tape measure protein; Lambda gpH homolog; SeSB_A0890; phage(gi169257196) 0.0 Click
461810689..1811018 PHAGE_Salmon_1: putative bacteriophage minor tail protein; Lambda gpM homolog; SeSB_A0891; phage(gi169257197) 2e-51 Click
471811028..1811726 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpL homolog; SeSB_A0892; phage(gi169257219) 4e-135 Click
481812509..1813015 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpI homolog; SeSB_A0894; phage(gi169257217) 7e-93 Click
491813077..1816439 PHAGE_Gifsy_1: bacteriophage host specificity protein; tail fiber; Lambda gpJ homolog; SeSB_A0895; phage(gi169257216) 0.0 Click
501816478..1816720 PHAGE_Gifsy_2: hypothetical protein STM1049.2n.Gifsy2; SeSB_A0896; phage(gi169257319) 3e-40 Click
511816774..1819452 PHAGE_Salmon_1: putative bacteriophage tail fiber protein; Lambda gpN homolog; SeSB_A0897; phage(gi169257204) 0.0 Click
521831792..1831823 attR    CGCAGGTTCGAATCCTGCAGGGCGCGCCATTT 0.0 Click

Region 4, total : 37 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12146526..2146714 PHAGE_Gifsy_1: hypothetical protein STM2615.1n.Gifsy1; SeSB_A4552; phage(gi169257242) 2e-25 Click
22146849..2147193 PHAGE_Entero_mEp390: putative holin; SeSB_A4553; phage(gi428782712) 2e-39 Click
32147180..2147461 PHAGE_Entero_mEp390: putative holin; SeSB_A4554; phage(gi428782713) 9e-40 Click
42147461..2148075 PHAGE_Salmon_ST64B: lytic enzyme (putative glycohydrolase); SeSB_A4555; phage(gi23505496) 3e-110 Click
52148072..2148614 PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; SeSB_A4556; phage(gi16765210) 2e-19 Click
62148127..2148140 attL    TGCTGGTGGCTTTT 0.0 Click
72148717..2149220 conserved hypothetical protein; SeSB_A4557 0.0 Click
82149255..2149632 PHAGE_Entero_HK446: hypothetical protein; SeSB_A4558; phage(gi428782252) 2e-47 Click
92149765..2150229 PHAGE_Salmon_ST64B: terminase small subunit; SeSB_A4559; phage(gi23505446) 3e-12 Click
102150249..2151925 PHAGE_Tetras_SI1: terminase; SeSB_A4560; phage(gi472342258) 2e-138 Click
112151925..2153229 PHAGE_Entero_mEp235: portal protein; SeSB_A4561; phage(gi428781813) 0.0 Click
122153243..2154091 PHAGE_Entero_mEp235: head maturation protease; SeSB_A4562; phage(gi428781814) 1e-135 Click
132154101..2155318 PHAGE_Entero_mEp235: major head subunit; SeSB_A4563; phage(gi428781815) 0.0 Click
142155362..2155622 PHAGE_Entero_mEp235: head-tail connector I; SeSB_A4564; phage(gi428781816) 2e-13 Click
152155622..2155945 PHAGE_Salmon_ST64B: hypothetical protein sb8; SeSB_A4565; phage(gi23505453) 4e-10 Click
162155957..2156370 PHAGE_Salmon_ST64B: hypothetical protein sb9; SeSB_A4566; phage(gi23505454) 2e-50 Click
172156342..2156854 PHAGE_Salmon_ST64B: hypothetical protein sb10; SeSB_A4567; phage(gi23505455) 4e-85 Click
182156851..2157396 PHAGE_Salmon_ST64B: hypothetical protein sb11; SeSB_A4568; phage(gi23505456) 2e-88 Click
192157418..2157582 PHAGE_Salmon_ST64B: hypothetical protein sb12; SeSB_A4569; phage(gi23505457) 3e-26 Click
202157572..2159068 PHAGE_Salmon_ST64B: Tail Sheath protein; SeSB_A4570; phage(gi23505458) 0.0 Click
212159068..2159424 PHAGE_Salmon_ST64B: Tail tube protein; SeSB_A4571; phage(gi23505459) 8e-65 Click
222159421..2159747 PHAGE_Salmon_ST64B: hypothetical protein sb15; SeSB_A4572; phage(gi23505501) 1e-55 Click
232159832..2161757 PHAGE_Salmon_ST64B: tail protein; SeSB_A4573; phage(gi23505460) 0.0 Click
242161990..2162223 conserved hypothetical protein; SeSB_A4574 0.0 Click
252162283..2163623 PHAGE_Salmon_ST64B: tail/DNA circulation protein; SeSB_A4575; phage(gi23505461) 0.0 Click
262163620..2164678 PHAGE_Salmon_ST64B: Tail protein; SeSB_A4576; phage(gi23505462) 0.0 Click
272164678..2165211 PHAGE_Salmon_ST64B: putative base plate assembly protein; SeSB_A4577; phage(gi23505463) 4e-98 Click
282165216..2165629 PHAGE_Salmon_ST64B: putative tail protein; SeSB_A4578; phage(gi23505464) 2e-76 Click
292165622..2166701 PHAGE_Salmon_ST64B: putative head assembly protein; SeSB_A4579; phage(gi23505465) 3e-96 Click
302166704..2167291 PHAGE_Salmon_ST64B: putative tail protein; SeSB_A4580; phage(gi23505467) 2e-115 Click
312167278..2168372 PHAGE_Salmon_ST64B: tail protein; SeSB_A4581; phage(gi23505468) 1e-66 Click
322168379..2168786 PHAGE_Salmon_ST64B: Probable tail fiber assembly protein; SeSB_A4582; phage(gi23505469) 4e-26 Click
33complement(2168983..2169705) guanine nucleotide exchange factor SopE (Effector protein sopE); SeSB_A4583 0.0 Click
342170230..2170793 PHAGE_Entero_mEp237: DNA invertase; SeSB_A4585; phage(gi435439291) 7e-82 Click
35complement(2170937..2171185) PHAGE_Entero_mEp460: DinI-like protein; SeSB_A4586; phage(gi428782337) 1e-41 Click
362171047..2171060 attR    TGCTGGTGGCTTTT 0.0 Click
37complement(2171247..2172344) PHAGE_Entero_mEp460: integrase; SeSB_A4587; phage(gi428782338) 0.0 Click
382172433..2173470 tRNA-dihydrouridine synthase A; SeSB_A4588 0.0 Click
39complement(2174055..2175038) oxidoreductase, zinc-binding dehydrogenase family; SeSB_A4590 0.0 Click
402175103..2176518 PHAGE_Entero_P1: Ban; SeSB_A4591; phage(gi46401697) 0.0 Click

Region 5, total : 13 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13607723..3607735 attL    TCTTTTGCGTTAA 0.0 Click
2complement(3613098..3614426) PHAGE_Salmon_1: putative bacteriophage tail fiber protein; Lambda gpN homolog; SeSB_A1618; phage(gi169257204) 9e-159 Click
3complement(3614979..3615470) PHAGE_Salmon_1: bacteriophage terminase, small subunit; SeSB_A1615; phage(gi169257184) 7e-87 Click
43615773..3615940 conserved domain protein; SeSB_A1614 0.0 Click
53616093..3616212 hypothetical protein; SeSB_A1613 0.0 Click
6complement(3616726..3617013) PHAGE_Salmon_1: putative bacteriophage endolysin; SeSB_A1610; phage(gi169257182) 1e-40 Click
73617044..3618150 PHAGE_Erwini_phiEt88: exodeoxyribonuclease; SeSB_A1609; phage(gi327198600) 1e-43 Click
83618147..3619226 PHAGE_Entero_mEp235: integrase; SeSB_A1608; phage(gi428781836) 4e-73 Click
9complement(3619601..3619954) PHAGE_Entero_PsP3: gp28; SeSB_A1604; phage(gi41057381) 5e-08 Click
10complement(3619971..3620846) copper resistance protein D; SeSB_A1603 0.0 Click
11complement(3620847..3621221) copper resistance protein CopC; SeSB_A1602 0.0 Click
123621359..3621589 PHAGE_Pectob_ZF40: putative DNA polymerase; SeSB_A1601; phage(gi422936677) 6e-17 Click
133621697..3622353 hydrolase, carbon-nitrogen family protein; SeSB_A1600 0.0 Click
143622377..3623075 PHAGE_Cronob_vB_CsaM_GAP32: putative DNA polymerase III epsilon subunit; SeSB_A1599; phage(gi414087193) 2e-15 Click
153625173..3625185 attR    TCTTTTGCGTTAA 0.0 Click

Region 6, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3898423..3898566) PHAGE_Salmon_1: putative bacteriophage tail assembly protein; SeSB_A2432; phage(gi169257205) 1e-10 Click
2complement(3898541..3898915) PHAGE_Pseudo_Lu11: putative tail assembly protein; SeSB_A2433; phage(gi388684690) 8e-14 Click
33898967..3900100 PHAGE_Escher_TL_2011b: hypothetical protein; SeSB_A2434; phage(gi418487678) 8e-20 Click
4complement(3900176..3900349) hypothetical protein; SeSB_A2435 0.0 Click
5complement(3900339..3900914) PHAGE_Salmon_ST64B: Probable tail fiber assembly protein; SeSB_A2436; phage(gi23505469) 1e-103 Click
6complement(3900914..3902458) PHAGE_Salmon_ST64B: tail protein; SeSB_A2437; phage(gi23505468) 0.0 Click
7complement(3902445..3903032) PHAGE_Salmon_ST64B: putative tail protein; SeSB_A2438; phage(gi23505467) 2e-115 Click
8complement(3903035..3904114) PHAGE_Salmon_ST64B: putative head assembly protein; SeSB_A2439; phage(gi23505465) 3e-96 Click
9complement(3904107..3904520) PHAGE_Salmon_ST64B: putative tail protein; SeSB_A2440; phage(gi23505464) 2e-76 Click
10complement(3904525..3905058) PHAGE_Salmon_ST64B: putative base plate assembly protein; SeSB_A2441; phage(gi23505463) 4e-98 Click
11complement(3905058..3906116) PHAGE_Salmon_ST64B: Tail protein; SeSB_A2442; phage(gi23505462) 0.0 Click
12complement(3906113..3907453) PHAGE_Salmon_ST64B: tail/DNA circulation protein; SeSB_A2443; phage(gi23505461) 0.0 Click
13complement(3907487..3909415) PHAGE_Salmon_ST64B: tail protein; SeSB_A2444; phage(gi23505460) 0.0 Click
14complement(3909500..3909826) PHAGE_Salmon_ST64B: hypothetical protein sb15; SeSB_A2445; phage(gi23505501) 6e-55 Click
15complement(3909823..3910179) PHAGE_Salmon_ST64B: Tail tube protein; SeSB_A2446; phage(gi23505459) 8e-65 Click
16complement(3910179..3911675) PHAGE_Salmon_ST64B: Tail Sheath protein; SeSB_A2447; phage(gi23505458) 0.0 Click
17complement(3911665..3911829) PHAGE_Salmon_ST64B: hypothetical protein sb12; SeSB_A2448; phage(gi23505457) 3e-26 Click
18complement(3911833..3912393) PHAGE_Salmon_ST64B: hypothetical protein sb11; SeSB_A2449; phage(gi23505456) 9e-106 Click
19complement(3912390..3912902) PHAGE_Salmon_ST64B: hypothetical protein sb10; SeSB_A2450; phage(gi23505455) 7e-97 Click
20complement(3912874..3913278) PHAGE_Salmon_ST64B: hypothetical protein sb9; SeSB_A2451; phage(gi23505454) 6e-73 Click
21complement(3913275..3913598) PHAGE_Salmon_ST64B: hypothetical protein sb8; SeSB_A2452; phage(gi23505453) 5e-57 Click
22complement(3913601..3913801) PHAGE_Salmon_ST64B: hypothetical protein sb7; SeSB_A2453; phage(gi23505452) 5e-31 Click
23complement(3913809..3915056) PHAGE_Salmon_ST64B: Major capsid protein precursor; SeSB_A2454; phage(gi23505451) 0.0 Click
24complement(3915071..3915721) PHAGE_Salmon_ST64B: Pro-head protease; SeSB_A2455; phage(gi23505450) 2e-120 Click

Region 7, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14100375..4100387 attL    CAGGAGTACCTGA 0.0 Click
2complement(4100527..4101690) PHAGE_Salmon_epsilon34: Tyrosine integrase; SeSB_A0787; phage(gi221328640) 0.0 Click
3complement(4102129..4102806) PHAGE_Entero_mEp460: hypothetical protein; SeSB_A0788; phage(gi428782343) 1e-18 Click
4complement(4102803..4103045) hypothetical protein; SeSB_A0789 0.0 Click
5complement(4103154..4103426) conserved hypothetical protein; SeSB_A0790 0.0 Click
6complement(4103464..4103640) hypothetical protein; SeSB_A0791 0.0 Click
7complement(4103767..4104210) PHAGE_Entero_HK633: hypothetical protein; SeSB_A0793; phage(gi428782552) 2e-08 Click
84104209..4104364 hypothetical protein; SeSB_A0792 0.0 Click
9complement(4104376..4104873) PHAGE_Entero_P22: EaE; SeSB_A0794; phage(gi9635501) 1e-79 Click
10complement(4105045..4105338) PHAGE_Entero_HK633: Abc2 protein; SeSB_A0795; phage(gi428782555) 5e-53 Click
11complement(4105362..4105745) PHAGE_Entero_HK106: hypothetical protein; SeSB_A0796; phage(gi428783315) 1e-67 Click
12complement(4105745..4105882) PHAGE_Entero_HK633: essential recombination function protein; SeSB_A0797; phage(gi428782557) 6e-20 Click
13complement(4106452..4106610) PHAGE_Entero_Sf6: gene 30 protein; SeSB_A0798; phage(gi41057308) 4e-24 Click
14complement(4106607..4106759) PHAGE_Entero_HK633: Kil protein; SeSB_A0799; phage(gi428782560) 4e-23 Click
15complement(4106900..4107868) PHAGE_Entero_IME10: Orf53; SeSB_A0800; phage(gi422934294) 8e-170 Click
16complement(4108051..4108521) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip113; SeSB_A0801; phage(gi20065908) 2e-91 Click
174108796..4108936 hypothetical protein; SeSB_A0802 0.0 Click
184109667..4109783 hypothetical protein; SeSB_A0803 0.0 Click
194110232..4110447 PHAGE_Entero_HK633: prophage antirepressor; SeSB_A0804; phage(gi428782568) 2e-22 Click
204110720..4110839 PHAGE_Salmon_vB_SemP_Emek: C1 protein; SeSB_A0805; phage(gi399498838) 9e-16 Click
214110874..4111020 PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; SeSB_A0806; phage(gi399498839) 4e-20 Click
224111013..4111873 PHAGE_Entero_c_1: DNA replication protein O; SeSB_A0807; phage(gi428781786) 2e-164 Click
234125110..4125122 attR    CAGGAGTACCTGA 0.0 Click

Region 8, total : 15 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14166647..4167771 putative bacteriophage protein; SeSB_A2309 0.0 Click
24167926..4168042 PHAGE_Salmon_RE_2010: tail fiber protein; SeSB_A2308; phage(gi418489717) 7e-06 Click
3complement(4168044..4168205) putative inner membrane protein; SeSB_A2307 0.0 Click
44169248..4169976 pertussis toxin, subunit 1 subfamily protein; SeSB_A2306 0.0 Click
54170169..4170711 PHAGE_Erwini_vB_EamP_S6: endolysin; SeSB_A2305; phage(gi422935930) 2e-63 Click
6complement(4170859..4171236) PHAGE_Pseudo_Lu11: putative tail assembly protein; SeSB_A2304; phage(gi388684690) 7e-16 Click
7complement(4171309..4172118) PHAGE_Entero_cdtI: Cytolethal distending toxin B subunit; SeSB_A2303; phage(gi148609410) 1e-63 Click
84172616..4172780 putative transposase; SeSB_A2302 0.0 Click
9complement(4172991..4173230) PHAGE_Entero_HK225: DNA damage-inducible protein; SeSB_A2301; phage(gi428782403) 5e-35 Click
10complement(4173421..4173942) EnvE; SeSB_A2300 0.0 Click
11complement(4174359..4174571) conserved domain protein; SeSB_A2299 0.0 Click
12complement(4174703..4174966) virulence protein PagD; SeSB_A2298 0.0 Click
134175015..4175206 conserved hypothetical protein; SeSB_A2297 0.0 Click
144175265..4175393 conserved hypothetical protein; SeSB_A2296 0.0 Click
154175773..4176330 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; SeSB_A2295; phage(gi148609401) 2e-22 Click

Region 9, total : 13 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14506041..4506054 attL    AGTTTTTTCGCCAG 0.0 Click
24519461..4520651 PROPHAGE_Escher_Sakai: putative integrase; SeSB_A0557; phage(gi15833788) 8e-148 Click
34520648..4521472 hypothetical protein; SeSB_A0558 0.0 Click
4complement(4521925..4522059) conserved hypothetical protein; SeSB_A0559 0.0 Click
54522229..4522405 PHAGE_Entero_P4: putative CI repressor; SeSB_A0560; phage(gi9627516) 5e-07 Click
64522398..4522757 hypothetical protein; SeSB_A0561 0.0 Click
74522789..4523073 hypothetical protein; SeSB_A0562 0.0 Click
84523070..4523453 PHAGE_Entero_P4: hypothetical protein P4p07; SeSB_A0563; phage(gi9627513) 6e-10 Click
94523450..4526122 PHAGE_Entero_P4: DNA primase; SeSB_A0564; phage(gi9627512) 7e-45 Click
10complement(4526183..4526401) hypothetical protein; SeSB_A0565 0.0 Click
114526522..4527283 PHAGE_Entero_P4: head size determination protein sid; SeSB_A0566; phage(gi9627518) 1e-10 Click
124527334..4527555 putative activator encoded in prophage CP-933I; SeSB_A0567 0.0 Click
13complement(4527742..4527864) hypothetical protein; SeSB_A0568 0.0 Click
144527895..4528878 PHAGE_Bathyc_BpV1: hypothetical protein; SeSB_A0569; phage(gi313768010) 2e-18 Click
154536841..4536854 attR    AGTTTTTTCGCCAG 0.0 Click

Region 10, total : 29 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4561743..4563332) PHAGE_Prochl_P_SSM2: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase; SeSB_A4496; phage(gi61806062) 5e-71 Click
24564242..4565075 PHAGE_Entero_P22: hypothetical protein P22gp51; SeSB_B0099; phage(gi9635519) 4e-130 Click
34565072..4566448 PHAGE_Entero_mEp213: replicative DNA helicase; SeSB_B0100; phage(gi428782646) 0.0 Click
44566534..4566749 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp63; SeSB_B0101; phage(gi302393146) 8e-17 Click
54566760..4566915 hypothetical protein; SeSB_B0102 0.0 Click
64566894..4567358 PHAGE_Escher_HK75: NinB; SeSB_B0103; phage(gi356870721) 8e-74 Click
74567504..4567707 PHAGE_Salmon_vB_SemP_Emek: NinF; SeSB_B0104; phage(gi399498849) 3e-29 Click
84567682..4568290 PHAGE_Salmon_vB_SemP_Emek: NinG; SeSB_B0105; phage(gi399498850) 2e-113 Click
94568287..4568442 hypothetical protein; SeSB_B0106 0.0 Click
104568470..4568649 PHAGE_Entero_ES18: gp72; SeSB_B0107; phage(gi62362285) 7e-27 Click
114568646..4569410 PHAGE_Entero_ES18: gp73; SeSB_B0108; phage(gi62362286) 1e-145 Click
124569706..4570224 PHAGE_Deep_s_D6E: HNH endonuclease; SeSB_B0109; phage(gi423262342) 9e-30 Click
134570448..4570720 PHAGE_Salmon_SPN3UB: hypothetical protein; SeSB_B0110; phage(gi423262443) 9e-05 Click
144570720..4571217 PHAGE_Entero_cdtI: lysin; SeSB_B0111; phage(gi148609440) 2e-89 Click
154571214..4571651 PHAGE_Escher_HK75: Rz; SeSB_B0112; phage(gi356870731) 2e-75 Click
164571854..4572396 PHAGE_Escher_P13374: regulatory protein; SeSB_B0113; phage(gi410491650) 2e-60 Click
174572868..4573047 PHAGE_Entero_HK620: hypothetical protein HK620p41; SeSB_B0115; phage(gi13559864) 3e-26 Click
184573071..4573493 PHAGE_Entero_HK620: terminase small subunit; SeSB_B0116; phage(gi13559865) 5e-77 Click
194573490..4574902 PHAGE_Entero_HK620: terminase large subunit; SeSB_B0117; phage(gi13559866) 0.0 Click
204574905..4577031 PHAGE_Entero_HK620: portal protein; SeSB_B0118; phage(gi13559867) 0.0 Click
214577045..4577929 PHAGE_Entero_HK620: scaffold protein; SeSB_B0119; phage(gi13559868) 2e-127 Click
224577940..4579217 PHAGE_Entero_HK620: capsid protein; SeSB_B0120; phage(gi13559869) 0.0 Click
234579257..4579442 PHAGE_Entero_HK620: hypothetical protein HK620p47; SeSB_B0121; phage(gi13559870) 2e-23 Click
244579417..4579899 PHAGE_Entero_HK620: DNA stabilization protein; SeSB_B0122; phage(gi13559871) 2e-72 Click
254579908..4581326 PHAGE_Entero_P22: head completion protein; SeSB_B0123; phage(gi9635541) 0.0 Click
264581330..4582031 PHAGE_Entero_P22: head completion protein; SeSB_B0124; phage(gi51236728) 3e-117 Click
274582031..4582486 PHAGE_Salmon_vB_SemP_Emek: virion stability protein; SeSB_B0125; phage(gi399498801) 1e-87 Click
284582489..4583178 PHAGE_Salmon_SPN9CC: DNA transfer protein 1; SeSB_B0126; phage(gi389060546) 4e-123 Click
294583188..4584558 PHAGE_Entero_P22: injection protein; SeSB_B0127; phage(gi9635545) 2e-170 Click