Salmonella enterica subsp. enterica serovar Javiana str. [asmbl_id: NC_000000].4546142, GC%: 52.23%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1282871..282882 attL    AAATTAAACAAA 0.0 Click
2complement(295275..296306) PHAGE_Acanth_moumouvirus: Zn-dependent alcohol dehydrogenase; SeJ_A0285; phage(gi441432240) 2e-13 Click
3296523..297053 shikimate kinase; SeJ_A0286 0.0 Click
4complement(297081..298100) PHAGE_Acanth_mimivirus: probable zinc-type alcohol dehydrogenase-like protein; SeJ_A0287; phage(gi311977890) 2e-42 Click
5298322..298408 tRNA 0.0 Click
6298571..299824 PHAGE_Entero_P4: integrase; SeJ_A0289; phage(gi9627511) 0.0 Click
7complement(299861..299977) conserved hypothetical protein; SeJ_A0290 0.0 Click
8complement(300539..301771) PHAGE_Burkho_KS9: hypothetical protein gp32; SeJ_A0291; phage(gi255033715) 1e-10 Click
9301891..302076 hypothetical protein; SeJ_A0292 0.0 Click
10complement(302040..302606) PHAGE_Entero_P4: amber mutation-suppressing protein; SeJ_A0293; phage(gi9627520) 1e-64 Click
11complement(302622..302867) PHAGE_Erwini_ENT90: transcriptional regulator; SeJ_A0294; phage(gi431810990) 2e-14 Click
12complement(302864..303601) PHAGE_Entero_P4: head size determination protein sid; SeJ_A0295; phage(gi9627518) 3e-84 Click
13303673..303819 hypothetical protein; SeJ_A0296 0.0 Click
14304142..304408 PHAGE_Entero_P4: transcriptional regulator; SeJ_A0297; phage(gi9627517) 7e-32 Click
15304624..304956 PHAGE_Entero_P4: putative CI repressor; SeJ_A0298; phage(gi9627516) 3e-32 Click
16304953..305180 conserved hypothetical protein; SeJ_A0299 0.0 Click
17305177..305497 PHAGE_Entero_P4: hypothetical protein P4p07; SeJ_A0300; phage(gi9627513) 2e-53 Click
18305512..307845 PHAGE_Entero_P4: DNA primase; SeJ_A0301; phage(gi9627512) 0.0 Click
19309913..309924 attR    AAATTAAACAAA 0.0 Click

Region 2, total : 40 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12875659..2875671 attL    TTCGGGGCTTTTT 0.0 Click
2complement(2885150..2886370) PROPHAGE_Entero_Fels-2: integrase-like protein; SeJ_A3190; phage(gi16766052) 1e-126 Click
32886538..2886582 attL    TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT 0.0 Click
4complement(2886696..2887907) PHAGE_Salmon_RE_2010: hypothetical protein; SeJ_A3189; phage(gi418489682) 4e-109 Click
5complement(2887904..2888929) PHAGE_Entero_2: P2 Int-like protein; SeJ_A3188; phage(gi169936064) 0.0 Click
62889779..2889931 PHAGE_Entero_2: bacteriophage regulatory protein Ap1; SeJ_A3187; phage(gi169936062) 5e-08 Click
72889964..2890473 PHAGE_Entero_2: bacteriophage regulatory protein CII; SeJ_A3186; phage(gi169936061) 8e-89 Click
8complement(2890560..2890835) hypothetical protein; SeJ_A3185 0.0 Click
92890920..2891114 PHAGE_Entero_2: hypothetical protein STM2735.Fels2; SeJ_A3184; phage(gi169936060) 5e-09 Click
102891078..2891419 PHAGE_Entero_2: hypothetical protein STM2733.Fels2; SeJ_A3183; phage(gi169936058) 2e-51 Click
112891487..2891714 PHAGE_Entero_2: hypothetical protein STM2732.Fels2; SeJ_A3182; phage(gi169936057) 7e-11 Click
122891714..2891941 PHAGE_Entero_2: P2 gpOrf82-like protein; SeJ_A3181; phage(gi169936056) 9e-24 Click
132891938..2892795 PHAGE_Entero_2: DNA adenine methylase-like protein; SeJ_A3180; phage(gi169936055) 3e-130 Click
142892849..2895215 PHAGE_Entero_2: P2 gpA-like protein; SeJ_A3179; phage(gi169936054) 0.0 Click
152895567..2895800 PHAGE_Entero_2: TumB protein; SeJ_A3178; phage(gi169936052) 2e-38 Click
16complement(2896945..2897997) PHAGE_Entero_2: P2 gpQ-like protein; SeJ_A3177; phage(gi169936049) 0.0 Click
17complement(2897997..2899763) PHAGE_Entero_2: P2 gpP-like protein; SeJ_A3176; phage(gi169936048) 0.0 Click
182899906..2900739 PHAGE_Entero_2: P2 gpO-like protein; SeJ_A3175; phage(gi169936047) 5e-146 Click
192900756..2901820 PHAGE_Entero_2: P2 gpN-like major capsid protein; SeJ_A3174; phage(gi169936046) 0.0 Click
202901824..2902474 PHAGE_Entero_2: P2 gpM-like protein; SeJ_A3173; phage(gi169936045) 1e-116 Click
212902568..2903032 PHAGE_Entero_2: P2 gpL-like protein; SeJ_A3172; phage(gi169936044) 4e-86 Click
222903032..2903235 PHAGE_Entero_2: P2 gpX-like tail protein; SeJ_A3171; phage(gi169936043) 9e-35 Click
232903239..2903454 PHAGE_Entero_2: lysis protein; SeJ_A3170; phage(gi169936042) 2e-35 Click
242903435..2903944 PHAGE_Entero_2: endolysin; SeJ_A3169; phage(gi169936041) 1e-87 Click
252903949..2904326 conserved hypothetical protein; SeJ_A3168 0.0 Click
262904326..2904751 PHAGE_Entero_2: P2 LysB-like protein; SeJ_A3167; phage(gi169936038) 6e-72 Click
272904711..2904884 PHAGE_Entero_2: P2 LysC-like protein; SeJ_A3166; phage(gi169936037) 9e-27 Click
282904847..2905278 PHAGE_Entero_2: P2 gpR-like tail completion protein; SeJ_A3165; phage(gi169936036) 7e-76 Click
292905271..2905717 PHAGE_Entero_2: P2 gpS-like tail completion protein; SeJ_A3164; phage(gi169936035) 1e-78 Click
302905786..2906364 PHAGE_Entero_2: P2 gpV-like protein; SeJ_A3163; phage(gi169936034) 4e-104 Click
312906361..2906720 PHAGE_Entero_2: P2 gpW-like baseplate protein; SeJ_A3162; phage(gi169936033) 1e-60 Click
322906707..2907615 PHAGE_Entero_2: P2 gpJ-like baseplate assembly protein; SeJ_A3161; phage(gi169936032) 9e-154 Click
332907608..2908213 PHAGE_Entero_2: P2 gpI-like baseplate assembly protein; SeJ_A3160; phage(gi169936031) 1e-110 Click
342908210..2909976 PHAGE_Entero_2: P2 gpH-like protein; SeJ_A3159; phage(gi169936030) 5e-142 Click
352909979..2910506 PHAGE_Sodali_phiSG1: putative phage tail fiber assembly protein; SeJ_A3158; phage(gi89886004) 2e-15 Click
36complement(2910535..2910657) hypothetical protein; SeJ_A3156 0.0 Click
372910640..2911812 PHAGE_Entero_2: P2 gpFI-like protein; SeJ_A3157; phage(gi169936025) 0.0 Click
382911822..2912337 PHAGE_Entero_2: P2 gpFII-like protein; SeJ_A3155; phage(gi169936024) 2e-92 Click
392912392..2912694 PHAGE_Entero_2: P2 gpE-like tail protein; SeJ_A3154; phage(gi169936023) 5e-46 Click
402912821..2915595 PHAGE_Entero_2: P2 gpT-like tail protein; SeJ_A3152; phage(gi169936021) 9e-117 Click
412915595..2916080 PHAGE_Entero_2: P2 gpU-like tail protein; SeJ_A3151; phage(gi169936020) 1e-83 Click
422916077..2917177 PHAGE_Entero_2: P2 gpD-like tail protein; SeJ_A3150; phage(gi169936019) 0.0 Click
432918022..2918066 attR    TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT 0.0 Click
442923263..2923275 attR    TTCGGGGCTTTTT 0.0 Click

Region 3, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12985135..2985148 attL    ATCATTGCTCACAT 0.0 Click
22985357..2986586 PHAGE_Gifsy_1: bacteriophage integrase protein; SeJ_A3089; phage(gi169257266) 0.0 Click
3complement(2987134..2988003) PHAGE_Entero_P1: Dmt; SeJ_A3088; phage(gi46401691) 5e-72 Click
4complement(2988000..2988680) PHAGE_Stx2_c_1717: exonuclease; SeJ_A3087; phage(gi209447136) 7e-115 Click
5complement(2988677..2989462) PHAGE_Stx2_c_86: recombination protein Bet; SeJ_A3086; phage(gi116222044) 5e-145 Click
6complement(2989468..2989764) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; SeJ_A3085; phage(gi116222045) 2e-38 Click
7complement(2989850..2990092) PHAGE_Escher_P13374: host killing protein; SeJ_A3084; phage(gi410491620) 4e-11 Click
82990345..2990551 PHAGE_Entero_HK225: hypothetical protein; SeJ_A3083; phage(gi428782417) 5e-19 Click
9complement(2990927..2991988) PHAGE_Lactob_Lj965: hypothetical protein Ljo_0304; SeJ_A3082; phage(gi41179236) 1e-67 Click
10complement(2992058..2992192) PHAGE_Entero_mEp237: prophage repressor; SeJ_A3081; phage(gi435439304) 4e-13 Click
112992985..2993134 PHAGE_Gifsy_1: probable regulatory protein; transcriptional activator; lambda CII analog; SeJ_A3080; phage(gi169257256) 2e-21 Click
122993226..2994131 PHAGE_Entero_lambda: DNA replication protein; SeJ_A3079; phage(gi9626295) 6e-97 Click
132994128..2994829 PHAGE_Entero_HK140: DNA replication protein P; SeJ_A3078; phage(gi428781992) 1e-109 Click
142994826..2995275 conserved hypothetical protein; SeJ_A3077 0.0 Click
152995272..2995757 PHAGE_Gifsy_1: conserved hypothetical bacteriophage protein; SeJ_A3076; phage(gi169257252) 1e-32 Click
16complement(2995784..2996776) non-LEE encoded type III effector C; SeJ_A3075 0.0 Click
172997046..2997279 PHAGE_Gifsy_1: bacteriophage putative DNA damage-inducible protein; DinI homolog; SeJ_A3074; phage(gi169257250) 2e-38 Click
18complement(2997548..2997685) hypothetical protein; SeJ_A3073 0.0 Click
19complement(2997741..2998256) PHAGE_Entero_lambda: hypothetical protein lambdap90; SeJ_A3072; phage(gi9626267) 2e-19 Click
202998372..2999766 PHAGE_Gifsy_1: bacteriophage side tail fiber protein; Lambda gpSft (gpN) homolog; SeJ_A3071; phage(gi169257214) 0.0 Click
212999766..3000344 PHAGE_Gifsy_1: bacteriophage side tail fiber assembly factor & structural component; Lambda gpTfa homolog; SeJ_A3070; phage(gi169257212) 6e-98 Click
223005208..3005221 attR    ATCATTGCTCACAT 0.0 Click

Region 4, total : 50 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3484835..3486319) PHAGE_Megavi_lba: asparaginyl-tRNA synthetase; SeJ_A1342; phage(gi448825735) 3e-79 Click
2complement(3486404..3487606) nicotinate phosphoribosyltransferase; SeJ_A1343 0.0 Click
33487752..3487766 attL    TTATAAAAATGTAGC 0.0 Click
4complement(3487801..3489141) PHAGE_Gifsy_2: bacteriophage integrase; SeJ_A1344; phage(gi169257268) 0.0 Click
5complement(3489138..3489386) PHAGE_Gifsy_2: bacteriophage excisionase; SeJ_A1345; phage(gi169257269) 1e-43 Click
6complement(3489427..3489666) PHAGE_Gifsy_2: hypothetical protein STM1007.Gifsy2; SeJ_A1346; phage(gi169257270) 7e-40 Click
7complement(3489709..3490818) PHAGE_Gifsy_2: conserved hypothetical bacteriophage protein; SeJ_A1347; phage(gi169257271) 0.0 Click
8complement(3490829..3494029) PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; SeJ_A1348; phage(gi169257272) 0.0 Click
9complement(3494679..3494795) PHAGE_Gifsy_2: hypothetical protein STM1010.2n.Gifsy2; SeJ_A1350; phage(gi169257275) 3e-15 Click
103495870..3496364 conserved hypothetical protein; SeJ_A1351 0.0 Click
113496411..3497418 PHAGE_Escher_TL_2011b: hypothetical protein; SeJ_A1352; phage(gi418487646) 5e-36 Click
123497450..3497872 PHAGE_Escher_HK639: replication protein 14; SeJ_A1353; phage(gi356870655) 1e-29 Click
133497885..3498280 PHAGE_Gifsy_2: hypothetical protein STM1016.Gifsy2; SeJ_A1354; phage(gi169257281) 9e-05 Click
14complement(3498567..3499628) PHAGE_Pseudo_MP1412: diguanylate-cyclase GGDEF domain; SeJ_A1355; phage(gi399529005) 3e-06 Click
153500106..3502073 PHAGE_Parame_FR483: hypothetical protein FR483_N003L; SeJ_A1356; phage(gi155370101) 3e-128 Click
16complement(3502091..3502249) conserved hypothetical protein; SeJ_A1357 0.0 Click
173502792..3503010 PHAGE_Salmon_SPN3UB: hypothetical protein; SeJ_A1358; phage(gi423262436) 3e-08 Click
183503073..3503675 PHAGE_Gifsy_2: hypothetical protein STM1020.Gifsy2; SeJ_A1359; phage(gi169257286) 2e-110 Click
193503675..3503881 PHAGE_Gifsy_2: hypothetical protein STM1021.1n.Gifsy2; SeJ_A1360; phage(gi169257287) 2e-33 Click
203503884..3504525 PHAGE_Salmon_SPN3UB: NinG; SeJ_A1361; phage(gi423262439) 1e-120 Click
213504522..3504662 PHAGE_Gifsy_2: hypothetical protein STM1022.1n.Gifsy2; SeJ_A1362; phage(gi169257289) 6e-10 Click
223504659..3505336 PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; SeJ_A1363; phage(gi169257244) 1e-120 Click
233505487..3505612 hypothetical protein; SeJ_A1364 0.0 Click
243505609..3506175 PHAGE_Gifsy_1: conserved hypothetical bacteriophage protein; SeJ_A1365; phage(gi169257243) 4e-76 Click
25complement(3506304..3506777) PHAGE_Gifsy_2: bacteriophage virulence determinant; GtgA; SeJ_A1366; phage(gi169257294) 4e-87 Click
263507260..3507607 PHAGE_Gifsy_2: bacteriophage lysis protein; holin; SeJ_A1367; phage(gi169257295) 2e-10 Click
273507610..3508236 PHAGE_Entero_epsilon15: endolysin; SeJ_A1368; phage(gi30387404) 7e-95 Click
283508233..3508775 PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; SeJ_A1369; phage(gi16765210) 4e-17 Click
293508878..3509381 conserved hypothetical protein; SeJ_A1370 0.0 Click
30complement(3509436..3509681) hypothetical protein; SeJ_A1371 0.0 Click
31complement(3509703..3509927) hypothetical protein; SeJ_A1372 0.0 Click
323509980..3510471 PHAGE_Gifsy_2: bacteriophage DNA packaging protein; terminase, small subunit; SeJ_A1373; phage(gi169257298) 2e-30 Click
333510458..3512566 PHAGE_Gifsy_2: bacteriophage DNA packaging protein; terminase, large subunit; SeJ_A1374; phage(gi169257299) 0.0 Click
343512563..3512769 PHAGE_Gifsy_2: conserved hypothetical bacteriophage protein; SeJ_A1375; phage(gi169257300) 7e-16 Click
353512766..3514301 PHAGE_Gifsy_2: bacteriophage portal protein; SeJ_A1376; phage(gi169257301) 0.0 Click
363514264..3516333 PHAGE_Gifsy_2: bacteriophage Clp protease involved in capsid processing; SeJ_A1377; phage(gi169257302) 0.0 Click
373516422..3516745 PHAGE_Gifsy_2: conserved hypothetical bacteriophage protein; SeJ_A1378; phage(gi169257303) 1e-36 Click
383516738..3517013 PHAGE_Gifsy_2: conserved hypothetical bacteriophage protein; SeJ_A1379; phage(gi169257304) 8e-17 Click
393517017..3517601 PHAGE_Salmon_1: putative bacteriophage tail component; Lambda gpZ homolog; SeJ_A1380; phage(gi169257191) 1e-104 Click
403517598..3517999 PHAGE_Salmon_1: putative bacteriophage minor tail protein; Lambda gpU homolog; SeJ_A1381; phage(gi169257192) 3e-70 Click
413518010..3518756 PHAGE_Gifsy_2: bacteriophage major tail protein; Lambda gpV homolog; SeJ_A1382; phage(gi169257307) 9e-98 Click
423518807..3519202 PHAGE_Gifsy_2: bacteriophage tail assembly chaperone; Lambda gpG homolog; SeJ_A1383; phage(gi169257308) 4e-32 Click
433519265..3519537 PHAGE_Gifsy_2: bacteriophage tail assembly chapterone - part of G+G' frameshift hybrid protein ; Lambda gpT homolog; SeJ_A1384; phage(gi169257309) 2e-19 Click
443519509..3522550 PHAGE_Gifsy_2: bacteriophage tail tape measure protein; minor tail protein; Lambda gpH homolog; SeJ_A1385; phage(gi169257310) 0.0 Click
453522553..3522882 PHAGE_Gifsy_2: bacteriophage tail tip assembly protein; Lambda gpM homolog; SeJ_A1386; phage(gi169257311) 5e-36 Click
463522892..3523590 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpL homolog; SeJ_A1387; phage(gi169257219) 2e-133 Click
473523699..3524334 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpK homolog; SeJ_A1388; phage(gi169257218) 2e-123 Click
483524373..3524879 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpI homolog; SeJ_A1389; phage(gi169257217) 7e-93 Click
493524941..3528303 PHAGE_Gifsy_1: bacteriophage host specificity protein; tail fiber; Lambda gpJ homolog; SeJ_A1390; phage(gi169257216) 0.0 Click
503528342..3528584 PHAGE_Gifsy_2: hypothetical protein STM1049.2n.Gifsy2; SeJ_A1391; phage(gi169257319) 1e-38 Click
513528638..3531079 PHAGE_Gifsy_2: bacteriophage side tail fiber protein; Lambda gpStf (gpN) homolog; SeJ_A1392; phage(gi169257320) 0.0 Click
523531079..3531663 PHAGE_Gifsy_2: bacteriophage side tail fiber assembly protein; Lambda gpTfa analog; SeJ_A1393; phage(gi169257321) 8e-97 Click
533535440..3535454 attR    TTATAAAAATGTAGC 0.0 Click

Region 5, total : 8 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14188447..4188460 attL    TCTTCCCCAAAACT 0.0 Click
2complement(4188495..4189715) PHAGE_Entero_mEp235: integrase; SeJ_A2259; phage(gi428781836) 5e-62 Click
3complement(4190007..4190546) PHAGE_Entero_SfV: hypothetical protein SfVp30; SeJ_A2258; phage(gi19549017) 2e-66 Click
4complement(4190683..4191213) PHAGE_Entero_SfV: hypothetical protein SfVp31; SeJ_A2257; phage(gi19549018) 1e-61 Click
54191433..4192392 PHAGE_Entero_phiP27: hypothetical protein P27p17; SeJ_A2256; phage(gi18249881) 1e-41 Click
64192876..4193529 PHAGE_Entero_SfV: DNA adenine methylase; SeJ_A2255; phage(gi19549028) 4e-113 Click
74193526..4193915 PHAGE_Entero_SfV: crossover junction endodeoxyribonuclease; SeJ_A2254; phage(gi19549030) 1e-61 Click
84193932..4194255 PHAGE_Entero_SfV: hypothetical protein SfVp44; SeJ_A2253; phage(gi19549031) 1e-29 Click
94194354..4194764 PHAGE_Entero_SfV: tail fibre assembly protein; SeJ_A2252; phage(gi19549010) 2e-20 Click
104200552..4200565 attR    TCTTCCCCAAAACT 0.0 Click

Region 6, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14245204..4245216 attL    TCTTTTGCGTTAA 0.0 Click
2complement(4250576..4251160) PHAGE_Salmon_1: putative bacteriophage tail assembly protein; SeJ_A1552; phage(gi169257205) 2e-87 Click
3complement(4251150..4251470) PHAGE_Gifsy_1: conserved hypothetical protein; contains pfam01661, Macro, Macro domain; SeJ_A1551; phage(gi169257213) 2e-53 Click
4complement(4251442..4252779) PHAGE_Salmon_1: putative bacteriophage tail fiber protein; Lambda gpN homolog; SeJ_A1550; phage(gi169257204) 0.0 Click
5complement(4253332..4253823) PHAGE_Salmon_1: bacteriophage terminase, small subunit; SeJ_A1548; phage(gi169257184) 4e-86 Click
64253942..4254061 hypothetical protein; SeJ_A1547 0.0 Click
74254126..4254293 conserved domain protein; SeJ_A1546 0.0 Click
8complement(4254550..4255083) PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; SeJ_A1545; phage(gi16765210) 3e-93 Click
9complement(4255080..4255367) PHAGE_Salmon_1: putative bacteriophage endolysin; SeJ_A1544; phage(gi169257182) 1e-40 Click
104255398..4256504 PHAGE_Erwini_phiEt88: exodeoxyribonuclease; SeJ_A1543; phage(gi327198600) 6e-43 Click
114256501..4257580 PHAGE_Entero_mEp235: integrase; SeJ_A1542; phage(gi428781836) 5e-74 Click
12complement(4257954..4258307) PHAGE_Entero_PsP3: gp28; SeJ_A1538; phage(gi41057381) 4e-08 Click
13complement(4258324..4259199) copper resistance protein D; SeJ_A1537 0.0 Click
14complement(4259200..4259574) copper resistance protein CopC; SeJ_A1536 0.0 Click
154259712..4259942 PHAGE_Pectob_ZF40: putative DNA polymerase; SeJ_A1535; phage(gi422936677) 8e-17 Click
164260049..4260705 hydrolase, carbon-nitrogen family; SeJ_A1534 0.0 Click
174260729..4261427 PHAGE_Cronob_vB_CsaM_GAP32: putative DNA polymerase III epsilon subunit; SeJ_A1533; phage(gi414087193) 2e-15 Click
184263525..4263537 attR    TCTTTTGCGTTAA 0.0 Click