Clostridium perfringens C str. JGS1495 , whole [asmbl_id: NC_000000].3661329, GC%: 28.58%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1423656..423667 attL    CTATTATCTTTT 0.0 Click
2complement(433137..433706) PHAGE_Acanth_moumouvirus: putative low complexity protein; CPC_1619; phage(gi441432398) 2e-07 Click
3complement(434252..434647) PHAGE_Lactob_H: hypothetical protein; CPC_0913; phage(gi148750879) 6e-18 Click
4complement(434651..434833) hypothetical protein; CPC_0912 0.0 Click
5complement(434827..435000) conserved hypothetical protein; CPC_0911 0.0 Click
6complement(435015..435746) PHAGE_Bacill_1: hypothetical protein BV1_gp03; CPC_0910; phage(gi155042921) 3e-23 Click
7complement(435718..436311) putative phage protein; CPC_0909 0.0 Click
8complement(436607..436795) hypothetical protein; CPC_0908 0.0 Click
9complement(436797..437471) PHAGE_Rhodot_RM378: putative translation initiation factor; CPC_0907; phage(gi30044008) 2e-08 Click
10complement(437481..437963) PHAGE_Deep_s_D6E: gp157-like protein; CPC_0906; phage(gi423262358) 3e-34 Click
11complement(437977..438219) hypothetical protein; CPC_0905 0.0 Click
12complement(438597..439262) PHAGE_Bacill_BCP78: hypothetical protein; CPC_0904; phage(gi410492938) 3e-05 Click
13complement(439464..439709) hypothetical protein; CPC_0903 0.0 Click
14complement(439712..439891) PHAGE_Clostr_PhiS63: gp28; CPC_0902; phage(gi388570672) 5e-09 Click
15complement(439892..440251) hypothetical protein; CPC_0901 0.0 Click
16complement(440265..440444) PHAGE_Clostr_phi3626: Gp28 protein; CPC_0900; phage(gi20065991) 1e-11 Click
17complement(440438..440662) hypothetical protein; CPC_0899 0.0 Click
18440851..441522 conserved hypothetical protein; CPC_0897 0.0 Click
19complement(441491..441745) conserved domain protein; CPC_0898 0.0 Click
20complement(441816..442595) PHAGE_Lactob_H: hypothetical protein; CPC_0896; phage(gi148750866) 5e-19 Click
21complement(442596..442742) phosphoenolpyruvate carboxylase; CPC_0895 0.0 Click
22442932..443270 PHAGE_Clostr_phiCD6356: helix-turn-helix domain protein; CPC_0894; phage(gi326536885) 4e-19 Click
23complement(443277..443408) hypothetical protein; CPC_0893 0.0 Click
24443508..443519 attR    CTATTATCTTTT 0.0 Click
25443755..445260 PHAGE_Entero_phiFL3A: integrase; CPC_0892; phage(gi281416214) 2e-25 Click
26complement(445269..446438) PHAGE_Lactob_KC5a: putative minor tail protein; CPC_0891; phage(gi90592623) 4e-06 Click

Region 2, total : 10 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1232854..1234008) PHAGE_Clostr_st: putative IS transposase (OrfB); CPC_1205; phage(gi80159731) 2e-105 Click
2complement(1234019..1234420) PHAGE_Hypert_2: IS element Dka2 orfA; CPC_1204; phage(gi300116744) 3e-18 Click
3complement(1234558..1234824) MutT/nudix family protein; CPC_1203 0.0 Click
41235036..1235254 hypothetical protein; CPC_1202 0.0 Click
51235444..1236034 PHAGE_Bacill_36: membrane-bound metal-dependent hydrolase; CPC_1201; phage(gi156564213) 5e-09 Click
61236142..1237542 PHAGE_Stx2_c_86: putative long tail fiber protein; CPC_1200; phage(gi116222013) 1e-77 Click
7complement(1237659..1238195) PHAGE_Canary_virus: CNPV087 putative glutathione peroxidase; CPC_1199; phage(gi40556025) 7e-20 Click
8complement(1238412..1239623) pyridine nucleotide-disulphide oxidoreductase family protein; CPC_1198 0.0 Click
91239922..1240149 conserved hypothetical protein; CPC_1197 0.0 Click
10complement(1240253..1241158) PHAGE_Ectoca_1: EsV-1-65; CPC_1196; phage(gi13242537) 1e-12 Click

Region 3, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11458422..1458460 attL    CCGATTGGTCGGGGGTTCGAATCCTCTTCGCCGCACCAT 0.0 Click
2complement(1458591..1459751) PHAGE_Clostr_phiC2: putative integrase; CPC_0027; phage(gi134287379) 5e-32 Click
3complement(1459754..1460302) PHAGE_Clostr_PhiS63: gp36; CPC_0028; phage(gi388570662) 7e-10 Click
4complement(1460542..1461594) PHAGE_Spirop_R8A2B: putative transposase; CPC_0029; phage(gi9626114) 4e-16 Click
51462004..1462129 conserved hypothetical protein; CPC_0030 0.0 Click
61462157..1463047 PHAGE_Clostr_phiCD6356: putative phage replication protein; CPC_0031; phage(gi326536888) 8e-06 Click
71463143..1463703 PHAGE_Cronob_vB_CsaM_GAP31: baseplate wedge protein gp25; CPC_0032; phage(gi414086904) 1e-05 Click
81463822..1464067 conserved hypothetical protein; CPC_0033 0.0 Click
91464081..1464584 PHAGE_Clostr_phiCD6356: putative phage tail tape measure protein; CPC_0034; phage(gi326536862) 6e-05 Click
101464834..1465004 hypothetical protein; CPC_0035 0.0 Click
111465194..1466162 hypothetical protein; CPC_0036 0.0 Click
121466363..1467190 PHAGE_Clostr_phiSM101: hypothetical protein; CPC_0037; phage(gi110804073) 6e-07 Click
131468780..1468818 attR    CCGATTGGTCGGGGGTTCGAATCCTCTTCGCCGCACCAT 0.0 Click

Region 4, total : 49 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13100528..3102435 PHAGE_Cafete_BV_PW1: putative eIF-2gamma; CPC_2419; phage(gi310831469) 6e-18 Click
23102622..3103071 hypothetical protein; CPC_2418 0.0 Click
33103099..3104454 PHAGE_Megavi_lba: putative RNA methyltransferase; CPC_2417; phage(gi448825451) 8e-35 Click
43104432..3104446 attL    TTGTAAAATTAAATA 0.0 Click
5complement(3104519..3105658) PHAGE_Clostr_phiC2: putative integrase; CPC_2416; phage(gi134287379) 7e-114 Click
6complement(3105695..3106117) PHAGE_Thermo_THSA_485A: protein of unknown function DUF955; CPC_2415; phage(gi397912661) 1e-10 Click
7complement(3106149..3106595) PHAGE_Bacill_phi105: immunity repressor; CPC_2414; phage(gi22855027) 5e-07 Click
83106836..3107075 BcrR; CPC_2413 0.0 Click
93107059..3107313 conserved hypothetical protein; CPC_2412 0.0 Click
103107310..3108080 PHAGE_Staphy_77: 77ORF010; CPC_2411; phage(gi41189525) 3e-80 Click
113108092..3108289 glycosyl transferase, group 1 family protein; CPC_2410 0.0 Click
123108301..3108480 PHAGE_Clostr_phi3626: Gp28 protein; CPC_2409; phage(gi20065991) 1e-11 Click
133108497..3108724 hypothetical protein; CPC_2408 0.0 Click
143108742..3108924 PHAGE_Clostr_PhiS63: gp28; CPC_2407; phage(gi388570672) 5e-08 Click
153109025..3109264 PHAGE_Clostr_phi3626: Gp33 protein; CPC_2406; phage(gi20065996) 5e-06 Click
163109268..3109456 conserved hypothetical protein; CPC_2405 0.0 Click
173109475..3110128 peptidyl-prolyl cis-trans isomerase family protein; CPC_2404 0.0 Click
183110141..3111052 PHAGE_Entero_phiEf11: putative replication protein; CPC_2403; phage(gi282598768) 1e-15 Click
193111067..3111255 hypothetical protein; CPC_2402 0.0 Click
203111268..3111984 PHAGE_Staphy_StB27: DNA replication protein; CPC_2401; phage(gi431809696) 5e-41 Click
213111985..3112158 SsrA-binding protein; CPC_2400 0.0 Click
223112152..3112334 putative lipoprotein; CPC_2399 0.0 Click
233112338..3112733 PHAGE_Clostr_phiCD27: putative endodeoxyribonuclease; CPC_2398; phage(gi209901305) 5e-21 Click
243112738..3112926 hypothetical protein; CPC_2397 0.0 Click
253113116..3113469 C4-dicarboxylate transport system substrate-binding protein; CPC_2396 0.0 Click
263113450..3113719 hypothetical protein; CPC_2395 0.0 Click
273113731..3114132 PHAGE_Geobac_E2: hypothetical protein GBVE2_gp051; CPC_2394; phage(gi148747778) 2e-14 Click
283114132..3114335 PHAGE_Clostr_phiCP34O: hypothetical protein; CPC_2393; phage(gi422935476) 2e-05 Click
293114365..3114838 PHAGE_Clostr_phiSM101: probable sigma factor; CPC_2392; phage(gi110804038) 1e-24 Click
303114994..3115087 tRNA 0.0 Click
313115200..3115382 conserved hypothetical protein; CPC_2390 0.0 Click
323115457..3115843 hypothetical protein; CPC_2389 0.0 Click
333115873..3116715 PHAGE_Deep_s_D6E: small subunit terminase; CPC_2388; phage(gi423262328) 2e-60 Click
343116708..3117916 PHAGE_Staphy_phiETA3: large terminase; CPC_2387; phage(gi122891825) 7e-141 Click
353117928..3119382 PHAGE_Entero_phiFL4A: portal protein; CPC_2386; phage(gi281416468) 3e-140 Click
363119375..3120295 PHAGE_Entero_phiFL4A: phage head protein; CPC_2385; phage(gi281416469) 2e-64 Click
373120307..3120603 hypothetical protein; CPC_2384 0.0 Click
383120600..3120863 PHAGE_Strept_MM1: hypothetical protein MM1p19; CPC_2383; phage(gi15088761) 7e-11 Click
393120863..3121327 PHAGE_Entero_N4: gp49; CPC_2382; phage(gi119952225) 7e-15 Click
403122025..3122948 PHAGE_Clostr_CD119: putative capsid protein; CPC_2380; phage(gi90592716) 1e-109 Click
413122948..3123184 hypothetical protein; CPC_2379 0.0 Click
423123216..3123770 PHAGE_Entero_phiFL4A: hypothetical protein; CPC_2378; phage(gi281416475) 1e-29 Click
433123770..3124111 PHAGE_Entero_phiFL4A: hypothetical protein; CPC_2377; phage(gi281416476) 1e-11 Click
443124104..3124502 PHAGE_Entero_phiFL4A: hypothetical protein; CPC_2376; phage(gi281416477) 6e-23 Click
453124606..3124872 PHAGE_Entero_phiFL4A: hypothetical protein; CPC_2375; phage(gi281416478) 8e-12 Click
463124882..3125517 PHAGE_Entero_phiFL4A: hypothetical protein; CPC_2374; phage(gi281416479) 2e-39 Click
473125570..3125947 PHAGE_Entero_phiFL4A: hypothetical protein; CPC_2373; phage(gi281416480) 8e-14 Click
483126013..3126222 PHAGE_Lister_P40: gp13; CPC_2372; phage(gi207270787) 1e-05 Click
493126238..3129630 PHAGE_Entero_phiFL4A: tail tape measure protein; CPC_2371; phage(gi281416482) 2e-85 Click
503129633..3130331 PHAGE_Clostr_phiSM101: hypothetical protein; CPC_2370; phage(gi110804045) 7e-46 Click
513130351..3130611 PHAGE_Clostr_phiSM101: hypothetical protein; CPC_2369; phage(gi110804063) 1e-29 Click
523144484..3144498 attR    TTGTAAAATTAAATA 0.0 Click