Clostridium botulinum C str. Eklund , whole [asmbl_id: NC_000000].2961186, GC%: 28.98%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 51 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1684719..684770 attL    CTCCAAAACCATTGGTTCTGGGTTCGAGTCCTAGTGCCCCTGCCAGACGTAA 0.0 Click
2complement(684878..685978) PHAGE_Clostr_phiC2: putative integrase; CBC_0725; phage(gi134287379) 2e-50 Click
3complement(686015..686323) putative transcriptional regulator; CBC_0724 0.0 Click
4complement(686340..686663) PHAGE_Thermo_THSA_485A: transcriptional regulator, XRE family; CBC_0723; phage(gi397912660) 7e-11 Click
5686885..687097 PHAGE_Thermo_THSA_485A: transcriptional regulator, XRE family; CBC_0722; phage(gi397912660) 3e-06 Click
6687098..687352 hypothetical protein; CBC_0721 0.0 Click
7687474..688262 PHAGE_Brocho_BL3: gp34; CBC_0720; phage(gi327409426) 6e-41 Click
8688348..688503 conserved hypothetical protein; CBC_0719 0.0 Click
9688620..688955 PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp18; CBC_0718; phage(gi56694886) 2e-06 Click
10689001..691286 PHAGE_Lister_B054: gp49; CBC_0717; phage(gi157325333) 5e-112 Click
11691293..692042 PHAGE_Lister_B054: gp50; CBC_0716; phage(gi157325334) 4e-65 Click
12692044..692766 PHAGE_Lister_B054: gp51; CBC_0715; phage(gi157325335) 3e-58 Click
13692770..692961 conserved hypothetical protein; CBC_0714 0.0 Click
14692971..693858 PHAGE_Lister_A118: gp49; CBC_0713; phage(gi16798836) 2e-38 Click
15693887..694114 hypothetical protein; CBC_0712 0.0 Click
16694128..694298 hypothetical protein; CBC_0711 0.0 Click
17694357..694518 hypothetical protein; CBC_0710 0.0 Click
18694732..694893 hypothetical protein; CBC_0709 0.0 Click
19694890..695312 PHAGE_Staphy_StB20: hypothetical protein; CBC_0708; phage(gi431809750) 5e-29 Click
20695314..695940 conserved hypothetical protein; CBC_0707 0.0 Click
21696037..696195 conserved hypothetical protein; CBC_0706 0.0 Click
22696201..696647 PHAGE_Clostr_phiC2: hypothetical protein phiC2p80; CBC_0705; phage(gi134287412) 1e-16 Click
23697504..698073 PHAGE_Lactob_Lj928: putative portal protein; CBC_0704; phage(gi41179313) 3e-19 Click
24698063..699301 PHAGE_Thermo_THSA_485A: phage terminase, large subunit, PBSX family; CBC_0703; phage(gi397912639) 3e-73 Click
25699315..700766 PHAGE_Clostr_phiC2: putative portal protein; CBC_0702; phage(gi134287338) 4e-80 Click
26701892..702497 PHAGE_Bacill_SPP1: hypothetical protein SPP1p020; CBC_0700; phage(gi22855064) 7e-27 Click
27702519..703526 PHAGE_Entero_phiFL3A: coat protein; CBC_0699; phage(gi281416261) 2e-92 Click
28703539..703883 PHAGE_Lactob_Lj771: hypothetical protein LJ771_034; CBC_0698; phage(gi163932187) 4e-09 Click
29703886..704260 PHAGE_Clostr_phiC2: hypothetical protein phiC2p10; CBC_0697; phage(gi134287345) 5e-11 Click
30704260..704673 PHAGE_Clostr_phiC2: hypothetical protein phiC2p11; CBC_0696; phage(gi134287346) 5e-23 Click
31704670..705110 PHAGE_Clostr_phiC2: hypothetical protein phiC2p12; CBC_0695; phage(gi134287347) 2e-21 Click
32705100..705264 PHAGE_Lactob_KC5a: hypothetical protein; CBC_0694; phage(gi90592619) 1e-06 Click
33705265..706575 PHAGE_Clostr_phiC2: putative sheath tail protein; CBC_0693; phage(gi134287348) 2e-78 Click
34706589..707053 PHAGE_Clostr_phiC2: putative core tail; CBC_0692; phage(gi134287349) 2e-31 Click
35707069..707482 PHAGE_Clostr_phiC2: hypothetical protein phiC2p16; CBC_0691; phage(gi134287351) 5e-17 Click
36707724..708323 putative phage lipoprotein; CBC_0690 0.0 Click
37708457..708825 conserved hypothetical protein; CBC_0689 0.0 Click
38708918..711149 PHAGE_Clostr_phiC2: putative tail tape measure protein; CBC_0688; phage(gi134287355) 8e-68 Click
39711149..711847 PHAGE_Clostr_phiC2: putative LysM; CBC_0687; phage(gi134287356) 7e-25 Click
40711852..712826 PHAGE_Clostr_phiC2: putative hydrolase; CBC_0686; phage(gi134287357) 3e-61 Click
41713248..713658 PHAGE_Strept_1: hypothetical protein EJ-1p60; CBC_0684; phage(gi39653734) 4e-21 Click
42713661..714755 PHAGE_Clostr_phiC2: hypothetical protein phiC2p25; CBC_0683; phage(gi134287359) 1e-83 Click
43714736..715362 PHAGE_Clostr_phiC2: hypothetical protein phiC2p26; CBC_0682; phage(gi134287360) 8e-32 Click
44715365..716825 PHAGE_Clostr_phiC2: putative tail fiber protein; CBC_0681; phage(gi134287361) 2e-49 Click
45716844..717167 hypothetical protein; CBC_0680 0.0 Click
46717169..717378 hypothetical protein; CBC_0679 0.0 Click
47717605..718021 PHAGE_Clostr_phiCTP1: predicted holin; CBC_0678; phage(gi304360690) 1e-31 Click
48718064..718738 PHAGE_Clostr_phiZP2: N-acetylmuramoyl-L-alanine amidase; CBC_0677; phage(gi392972694) 5e-27 Click
49719161..719334 PHAGE_Lactob_JCL1032: hypothetical protein; CBC_0676; phage(gi418489174) 2e-07 Click
50719438..720409 hypothetical protein; CBC_0675 0.0 Click
51720835..720960 hypothetical protein; CBC_0674 0.0 Click
52complement(720971..721180) PHAGE_Clostr_st: putative transcriptional regulator; CBC_0673; phage(gi80159825) 4e-08 Click
53721566..721617 attR    CTCCAAAACCATTGGTTCTGGGTTCGAGTCCTAGTGCCCCTGCCAGACGTAA 0.0 Click

Region 2, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11360306..1360319 attL    TTTTCAATATAAAT 0.0 Click
21360309..1360320 attL    TCAATATAAATT 0.0 Click
3complement(1363582..1366740) PHAGE_Amsact_: hypothetical protein AMV156; CBC_A0928; phage(gi9964470) 1e-14 Click
4complement(1366754..1366939) hypothetical protein; CBC_A0929 0.0 Click
5complement(1367619..1367819) hypothetical protein; CBC_A0930 0.0 Click
6complement(1367832..1368179) PHAGE_Bacill_phIS3501: phage head-tail adaptor; CBC_A0931; phage(gi422934333) 2e-05 Click
7complement(1368466..1369923) PHAGE_Clostr_phiMMP04: terminase; CBC_A0932; phage(gi414090443) 6e-130 Click
8complement(1369927..1370265) PHAGE_Clostr_phiMMP04: hypothetical protein; CBC_A0933; phage(gi414090493) 3e-13 Click
9complement(1370360..1370668) PHAGE_Clostr_phiMMP04: HNH endonuclease; CBC_A0934; phage(gi414090491) 4e-18 Click
10complement(1370881..1371423) PHAGE_Bacill_phIS3501: site-specific phage integrase; CBC_A0935; phage(gi422934319) 2e-35 Click
11complement(1371817..1372098) PHAGE_Bacill_phIS3501: phage DNA packaging protein; CBC_A0937; phage(gi422934332) 5e-06 Click
12complement(1372161..1372325) hypothetical protein; CBC_A0938 0.0 Click
13complement(1374140..1375342) PHAGE_Bacill_phIS3501: portal protein; CBC_A0941; phage(gi422934329) 1e-15 Click
14complement(1376339..1376458) hypothetical protein; CBC_A0943 0.0 Click
15complement(1376646..1377335) PHAGE_Bacill_1: hypothetical protein BV1_gp03; CBC_A0944; phage(gi155042921) 3e-36 Click
16complement(1378505..1378693) conserved domain protein; CBC_A0947 0.0 Click
171378766..1378777 attR    TCAATATAAATT 0.0 Click
181378835..1379467 PHAGE_Clostr_PhiS63: gp36; CBC_A0948; phage(gi388570662) 1e-09 Click
191379529..1380710 PHAGE_Clostr_phiC2: putative integrase; CBC_A0949; phage(gi134287379) 2e-100 Click
201382834..1382847 attR    TTTTCAATATAAAT 0.0 Click

Region 3, total : 59 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1641292..1643058) PHAGE_Bacill_36: RecJ; CBC_A0760; phage(gi156564062) 4e-92 Click
21643137..1643955 endonuclease IV; CBC_A0761 0.0 Click
3complement(1644820..1644942) hypothetical protein; CBC_A0764 0.0 Click
4complement(1645169..1645753) PHAGE_Deep_s_D6E: structure protein; CBC_A0765; phage(gi423262348) 1e-19 Click
5complement(1645858..1646031) PHAGE_Lactob_JCL1032: hypothetical protein; CBC_A0766; phage(gi418489174) 2e-07 Click
6complement(1646461..1647741) PHAGE_Clostr_st: putative N-acetylmuramoyl-L-alanine amidase; CBC_A0767; phage(gi80159794) 5e-53 Click
7complement(1647787..1648056) PHAGE_Clostr_phi8074_B1: hypothetical protein; CBC_A0768; phage(gi431810381) 3e-05 Click
8complement(1648118..1649824) PHAGE_Lister_2389: Gp14 protein; CBC_A0769; phage(gi17488517) 2e-51 Click
9complement(1649914..1650117) hypothetical protein; CBC_A0770 0.0 Click
10complement(1650137..1651459) PHAGE_Clostr_phiCD38_2: tail fiber protein; CBC_A0771; phage(gi333798127) 3e-10 Click
11complement(1651444..1652142) PHAGE_Lister_2389: Gp13 protein; CBC_A0772; phage(gi17488516) 1e-23 Click
12complement(1652144..1657054) PHAGE_Clostr_phiSM101: phage tail tape measure protein, TP901 family, core region domain protein; CBC_A0773; phage(gi110804068) 1e-136 Click
13complement(1657087..1657398) hypothetical protein; CBC_A0774 0.0 Click
14complement(1657365..1657661) hypothetical protein; CBC_A0775 0.0 Click
15complement(1657694..1658248) hypothetical protein; CBC_A0776 0.0 Click
16complement(1658261..1658575) PHAGE_Lactoc_bIL285: Orf49; CBC_A0777; phage(gi13095729) 2e-09 Click
17complement(1658562..1658951) PHAGE_Geobac_E2: hypothetical protein GBVE2_gp010; CBC_A0778; phage(gi148747737) 3e-15 Click
18complement(1658951..1659292) hypothetical protein; CBC_A0779 0.0 Click
19complement(1659276..1659581) PHAGE_Lister_2389: Gp6 protein; CBC_A0780; phage(gi17488509) 3e-17 Click
20complement(1659587..1660786) PHAGE_Lister_2389: major capsid protein a; CBC_A0781; phage(gi17488508) 3e-61 Click
21complement(1660786..1661526) PHAGE_Lactob_JCL1032: putative ClpP protease; CBC_A0782; phage(gi418489116) 2e-37 Click
22complement(1661519..1662673) PHAGE_Lister_2389: hypothetical protein 2389gp03; CBC_A0783; phage(gi17488506) 1e-58 Click
23complement(1662714..1662899) hypothetical protein; CBC_A0784 0.0 Click
24complement(1662918..1664579) PHAGE_Lister_2389: terminase large subunit; CBC_A0785; phage(gi17488505) 2e-98 Click
25complement(1664563..1664871) PHAGE_Lister_2389: terminase small subunit; CBC_A0786; phage(gi17488504) 2e-08 Click
26complement(1664992..1665180) hypothetical protein; CBC_A0787 0.0 Click
27complement(1665185..1665505) PHAGE_Lister_2389: Gp54 protein; CBC_A0788; phage(gi17488559) 1e-24 Click
28complement(1665474..1665812) PHAGE_Bacill_phi105: hypothetical protein phi105_51; CBC_A0789; phage(gi22855044) 2e-08 Click
29complement(1665871..1666239) hypothetical protein; CBC_A0790 0.0 Click
30complement(1666477..1666905) PHAGE_Clostr_phiSM101: probable sigma factor; CBC_A0791; phage(gi110804038) 2e-14 Click
31complement(1666929..1667372) PHAGE_Staphy_37: ORF027; CBC_A0792; phage(gi66395754) 6e-10 Click
32complement(1667369..1667515) hypothetical protein; CBC_A0793 0.0 Click
33complement(1667533..1668024) hypothetical protein; CBC_A0794 0.0 Click
34complement(1668034..1668192) conserved hypothetical protein; CBC_A0795 0.0 Click
35complement(1668280..1669083) conserved hypothetical protein; CBC_A0796 0.0 Click
36complement(1669088..1669498) hypothetical protein; CBC_A0797 0.0 Click
37complement(1669486..1669902) PHAGE_Staphy_StB20: hypothetical protein; CBC_A0798; phage(gi431809750) 5e-29 Click
38complement(1669899..1670060) hypothetical protein; CBC_A0799 0.0 Click
39complement(1670277..1670453) PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp58; CBC_A0800; phage(gi90592694) 3e-12 Click
40complement(1670473..1670703) hypothetical protein; CBC_A0801 0.0 Click
41complement(1670741..1670905) hypothetical protein; CBC_A0802 0.0 Click
42complement(1670902..1671075) hypothetical protein; CBC_A0803 0.0 Click
43complement(1671120..1671734) PHAGE_Geobac_GBSV1: Similar to Bacillus virus 1 protein YP_001425588; CBC_A0804; phage(gi158267610) 3e-33 Click
44complement(1671787..1672605) PHAGE_Lister_B054: gp52; CBC_A0805; phage(gi157325336) 2e-33 Click
45complement(1672740..1672931) conserved hypothetical protein; CBC_A0806 0.0 Click
46complement(1672934..1673656) PHAGE_Lister_B054: gp51; CBC_A0807; phage(gi157325335) 1e-59 Click
47complement(1673656..1674405) PHAGE_Lister_B054: gp50; CBC_A0808; phage(gi157325334) 4e-65 Click
48complement(1674412..1676715) PHAGE_Lister_B054: gp49; CBC_A0809; phage(gi157325333) 4e-111 Click
49complement(1676761..1677015) PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp18; CBC_A0810; phage(gi56694886) 6e-06 Click
50complement(1677042..1677200) hypothetical protein; CBC_A0811 0.0 Click
51complement(1677218..1677373) conserved hypothetical protein; CBC_A0812 0.0 Click
52complement(1677389..1678105) PHAGE_Entero_phiFL3A: anti-repressor protein; CBC_A0813; phage(gi281416221) 5e-29 Click
53complement(1678189..1678302) hypothetical protein; CBC_A0814 0.0 Click
54complement(1678368..1678589) DNA-binding protein; CBC_A0815 0.0 Click
551678804..1679172 PHAGE_Clostr_PhiS63: gp26; CBC_A0816; phage(gi388570671) 1e-09 Click
561679185..1680720 PHAGE_Strept_phiNJ2: putative recombinase; CBC_A0817; phage(gi414090258) 2e-37 Click
571680768..1681238 flavoredoxin; CBC_A0818 0.0 Click
58complement(1681335..1681547) conserved domain protein; CBC_A0819 0.0 Click
59complement(1681586..1684033) PHAGE_Parame_AR158: hypothetical protein AR158_C785L; CBC_A0820; phage(gi157953975) 2e-41 Click

Region 4, total : 58 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11819137..1819149 attL    ATATAAAATAATA 0.0 Click
21819163..1819807 PHAGE_Clostr_st: hypothetical protein CST087; CBC_A1632; phage(gi80159773) 2e-28 Click
31819886..1820011 hypothetical protein; CBC_A1633 0.0 Click
41820217..1820465 hypothetical protein; CBC_A1634 0.0 Click
51820642..1821007 hypothetical protein; CBC_A1635 0.0 Click
61821070..1821336 PHAGE_Clostr_phi8074_B1: hypothetical protein; CBC_A1636; phage(gi431810419) 4e-09 Click
71821393..1822058 PHAGE_Clostr_st: hypothetical protein CST093; CBC_A1637; phage(gi80159779) 6e-110 Click
81822180..1822614 conserved hypothetical protein; CBC_A1638 0.0 Click
91822627..1823067 hypothetical protein; CBC_A1639 0.0 Click
101823084..1823251 hypothetical protein; CBC_A1640 0.0 Click
111823270..1823854 PHAGE_Entero_Bp7: thymidine kinase; CBC_A1641; phage(gi422934035) 2e-40 Click
121823954..1824274 hypothetical protein; CBC_A1642 0.0 Click
131824295..1824573 conserved hypothetical protein; CBC_A1643 0.0 Click
141824783..1824968 PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp21; CBC_A1644; phage(gi56694889) 3e-06 Click
151825006..1825263 PHAGE_Clostr_st: hypothetical protein CST096; CBC_A1645; phage(gi80159782) 3e-27 Click
161825590..1825838 hypothetical protein; CBC_A1646 0.0 Click
171825838..1826020 hypothetical protein; CBC_A1647 0.0 Click
181826587..1830840 PHAGE_Clostr_st: putative DNA gyrase B subunit; CBC_A1648; phage(gi80159785) 0.0 Click
191831750..1832148 PHAGE_Entero_EcP1: hypothetical protein; CBC_A1650; phage(gi418489351) 3e-07 Click
20complement(1832217..1832399) conserved hypothetical protein; CBC_A1651 0.0 Click
21complement(1832432..1832800) PHAGE_Clostr_st: hypothetical protein CST103; CBC_A1652; phage(gi80159789) 2e-57 Click
22complement(1832907..1833896) PHAGE_Lactoc_949: putative site specific recombinase; CBC_A1653; phage(gi327197974) 4e-29 Click
23complement(1833967..1834173) conserved hypothetical protein; CBC_A1654 0.0 Click
241834250..1834261 attL    TACTATGATATA 0.0 Click
251834324..1835148 PHAGE_Clostr_phiMMP02: integrase; CBC_A1655; phage(gi414090406) 8e-13 Click
261836117..1836128 attL    TAATATCATTAA 0.0 Click
27complement(1836207..1836908) PHAGE_Clostr_st: hypothetical protein CST109; CBC_A1658; phage(gi80159795) 3e-05 Click
28complement(1836914..1837732) PHAGE_Clostr_st: hypothetical protein CST109; CBC_A1659; phage(gi80159795) 4e-20 Click
29complement(1837742..1838608) PHAGE_Clostr_st: hypothetical protein CST110; CBC_A1660; phage(gi80159796) 2e-43 Click
30complement(1838697..1840517) PHAGE_Clostr_phiMMP02: hypothetical protein; CBC_A1661; phage(gi414090394) 3e-07 Click
31complement(1840557..1840841) hypothetical protein; CBC_A1662 0.0 Click
32complement(1840860..1841294) hypothetical protein; CBC_A1663 0.0 Click
33complement(1841359..1841535) PHAGE_Clostr_st: hypothetical protein CST112; CBC_A1664; phage(gi80159798) 3e-16 Click
34complement(1841549..1843027) PHAGE_Clostr_st: hypothetical protein CST114; CBC_A1665; phage(gi80159800) 0.0 Click
35complement(1843038..1844189) PHAGE_Clostr_st: hypothetical protein CST115; CBC_A1666; phage(gi80159801) 0.0 Click
36complement(1844204..1844821) PHAGE_Clostr_st: hypothetical protein CST116; CBC_A1667; phage(gi80159802) 4e-113 Click
37complement(1844866..1845465) PHAGE_Clostr_st: hypothetical protein CST117; CBC_A1668; phage(gi80159803) 4e-111 Click
38complement(1845492..1846847) PHAGE_Clostr_st: conserved hypothetical phage-related protein; CBC_A1669; phage(gi80159804) 0.0 Click
39complement(1846884..1847057) PHAGE_Clostr_st: hypothetical protein CST119; CBC_A1670; phage(gi80159805) 8e-25 Click
40complement(1847513..1848211) hypothetical protein; CBC_A1672 0.0 Click
41complement(1848233..1848499) hypothetical protein; CBC_A1673 0.0 Click
42complement(1849092..1850270) PHAGE_Clostr_st: putative IS transposase (OrfB); CBC_A1674; phage(gi80159818) 0.0 Click
43complement(1850254..1850799) PHAGE_Clostr_st: putative IS transposase (OrfA); CBC_A1675; phage(gi80159819) 2e-93 Click
44complement(1851449..1851742) PHAGE_Clostr_st: hypothetical protein CST123; CBC_A1676; phage(gi80159809) 1e-46 Click
45complement(1851739..1852260) PHAGE_Clostr_st: conserved hypothetical phage-related protein; CBC_A1677; phage(gi80159810) 3e-96 Click
46complement(1852526..1853266) hypothetical protein; CBC_A1678 0.0 Click
47complement(1853316..1853618) PHAGE_Clostr_st: hypothetical protein CST138; CBC_A1679; phage(gi80159824) 8e-41 Click
481853819..1854028 PHAGE_Clostr_st: putative transcriptional regulator; CBC_A1680; phage(gi80159825) 4e-34 Click
49complement(1854360..1854965) conserved hypothetical protein; CBC_A1681 0.0 Click
50complement(1854991..1855179) hypothetical protein; CBC_A1682 0.0 Click
51complement(1855549..1855821) hypothetical protein; CBC_A1683 0.0 Click
52complement(1855825..1856469) PHAGE_Melano_entomopoxvirus: ORF MSV156 hypothetical protein; CBC_A1684; phage(gi9631364) 1e-05 Click
53complement(1856691..1857164) hypothetical protein; CBC_A1685 0.0 Click
54complement(1857273..1857671) PHAGE_Clostr_st: hypothetical protein CST144; CBC_A1686; phage(gi80159830) 8e-71 Click
55complement(1857690..1857848) PHAGE_Clostr_st: hypothetical protein CST145; CBC_A1687; phage(gi80159831) 4e-23 Click
56complement(1858153..1859070) PHAGE_Clostr_phi3626: Gp26 protein; CBC_A1688; phage(gi20065989) 1e-15 Click
57complement(1859249..1860250) PHAGE_Clostr_st: hypothetical protein CST125; CBC_A1689; phage(gi80159811) 1e-49 Click
581860457..1861419 PHAGE_Clostr_st: hypothetical protein CST126; CBC_A1691; phage(gi80159812) 7e-163 Click
59complement(1861416..1865252) PHAGE_Clostr_st: hypothetical phage-related protein; CBC_A1690; phage(gi80159814) 0.0 Click
60complement(1865265..1866059) PHAGE_Clostr_st: conserved hypothetical phage-related protein; CBC_A1692; phage(gi80159815) 2e-151 Click
61complement(1866165..1866584) PHAGE_Entero_P1: Doc; CBC_A1693; phage(gi46401725) 4e-07 Click
621867016..1867027 attR    TAATATCATTAA 0.0 Click
631868463..1868474 attR    TACTATGATATA 0.0 Click
641868902..1868914 attR    ATATAAAATAATA 0.0 Click

Region 5, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1886348..1887082) PHAGE_Clostr_st: mono-ADP-ribosyltransferase C3 precursor; CBC_A1716; phage(gi80159834) 1e-91 Click
2complement(1887646..1888101) PHAGE_Clostr_st: hypothetical protein CST149; CBC_A1717; phage(gi80159835) 9e-35 Click
3complement(1888279..1888839) PHAGE_Clostr_st: hypothetical protein CST150; CBC_A1718; phage(gi80159836) 2e-34 Click
4complement(1888862..1889374) conserved hypothetical protein; CBC_A1719 0.0 Click
5complement(1889848..1890234) PHAGE_Clostr_st: hypothetical protein CST154; CBC_A1720; phage(gi80159840) 6e-63 Click
6complement(1890281..1891195) PHAGE_Clostr_st: putative N-acetylmuramoyl-L-alanine amidase; CBC_A1721; phage(gi80159841) 3e-165 Click
7complement(1891259..1891498) hypothetical protein; CBC_A1722 0.0 Click
8complement(1891516..1892307) PHAGE_Clostr_st: hypothetical protein CST157; CBC_A1723; phage(gi80159843) 2e-18 Click
9complement(1892323..1893063) PHAGE_Lactoc_949: hypothetical protein; CBC_A1724; phage(gi327197980) 9e-15 Click
10complement(1893066..1893593) PHAGE_Clostr_st: hypothetical protein CST159; CBC_A1725; phage(gi80159845) 4e-93 Click
11complement(1893609..1894484) PHAGE_Clostr_st: phage virion protein; CBC_A1726; phage(gi80159846) 4e-44 Click
12complement(1894535..1895740) PHAGE_Clostr_st: hypothetical protein CST161; CBC_A1727; phage(gi80159847) 0.0 Click
13complement(1895755..1896171) PHAGE_Clostr_st: conserved hypothetical phage-related protein; CBC_A1728; phage(gi80159848) 2e-72 Click
14complement(1896190..1896717) PHAGE_Clostr_st: conserved hypothetical phage-related protein; CBC_A1729; phage(gi80159849) 3e-84 Click
15complement(1896800..1897852) PHAGE_Clostr_st: phage virion protein; CBC_A1730; phage(gi80159850) 0.0 Click
16complement(1897909..1898454) PHAGE_Clostr_st: phage virion protein; CBC_A1731; phage(gi80159851) 5e-88 Click
17complement(1898500..1900071) PHAGE_Clostr_st: phage virion protein; CBC_A1732; phage(gi80159852) 0.0 Click
18complement(1900109..1900255) hypothetical protein; CBC_A1733 0.0 Click
19complement(1900283..1901860) PHAGE_Clostr_st: conserved phage-related protein; CBC_A1734; phage(gi80159853) 0.0 Click

Region 6, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12246860..2248386 PHAGE_Amsact_: hypothetical protein AMV156; CBC_A1856; phage(gi9964470) 1e-10 Click
22248587..2249312 PHAGE_Megavi_lba: hypothetical protein; CBC_A1857; phage(gi448825600) 5e-05 Click
32249603..2250121 PHAGE_Cronob_vB_CsaP_GAP52: RNA polymerase ECF sigma factor; CBC_A1858; phage(gi414087504) 3e-06 Click
42250105..2251031 conserved hypothetical protein; CBC_A1859 0.0 Click
5complement(2251304..2252338) PROPHAGE_Mesorh_MAFF303099: transposase; CBC_A1860; phage(gi13475314) 2e-15 Click
62252466..2253407 PHAGE_Bacill_36: virion structural protein; CBC_A1861; phage(gi156564141) 3e-07 Click
72253420..2253704 hypothetical protein; CBC_A1862 0.0 Click
82253762..2254022 PHAGE_Clostr_phiMMP02: hypothetical protein; CBC_A1863; phage(gi414090397) 7e-11 Click
92254027..2254800 PHAGE_Deep_s_D6E: lysin; CBC_A1864; phage(gi423262347) 7e-24 Click
102254807..2255067 conserved hypothetical protein; CBC_A1865 0.0 Click
11complement(2255514..2255690) PROPHAGE_Ralsto_GMI1000: isrso11-transposase orfb protein; CBC_A1866; phage(gi17546155) 8e-07 Click

Region 7, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12581915..2581926 attL    TACTAAATATTT 0.0 Click
2complement(2588600..2589868) PHAGE_Clostr_phiSM101: phage major capsid protein, HK97 family; CBC_A0975; phage(gi110804052) 9e-23 Click
3complement(2589868..2589996) conserved domain protein; CBC_A0976 0.0 Click
4complement(2590182..2590328) KWG repeat protein; CBC_A0977 0.0 Click
5complement(2590333..2590449) hypothetical protein; CBC_A0978 0.0 Click
6complement(2590456..2590698) conserved hypothetical protein; CBC_A0979 0.0 Click
7complement(2591078..2593273) PHAGE_Helico_KHP30: putative primase; CBC_A0980; phage(gi431810549) 1e-08 Click
8complement(2593289..2593501) hypothetical protein; CBC_A0981 0.0 Click
9complement(2593519..2593740) DNA binding domain, excisionase family protein; CBC_A0982 0.0 Click
10complement(2593763..2594062) hypothetical protein; CBC_A0983 0.0 Click
11complement(2594157..2594351) PHAGE_Thermo_THSA_485A: transcriptional regulator, XRE family; CBC_A0984; phage(gi397912657) 4e-06 Click
122594482..2594949 PHAGE_Clostr_PhiS63: gp36; CBC_A0985; phage(gi388570662) 7e-12 Click
132594720..2594731 attR    TACTAAATATTT 0.0 Click
142595058..2596251 PHAGE_Clostr_phiC2: putative integrase; CBC_A0986; phage(gi134287379) 2e-31 Click