Clostridium botulinum Bf , whole genome [asmbl_id: NC_000000].4217754, GC%: 28.23%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 46 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1153313..155541 PHAGE_Parame_AR158: hypothetical protein AR158_C785L; CBB_0511; phage(gi157953975) 5e-24 Click
2155961..156035 tRNA 0.0 Click
3156003..156035 attL    GAATCAGGGGTTCGACTCCCCTAGGAGCTACCA 0.0 Click
4complement(156134..157306) PHAGE_Clostr_phiC2: putative integrase; CBB_0513; phage(gi134287379) 1e-32 Click
5complement(157322..157768) PHAGE_Thermo_THSA_485A: protein of unknown function DUF955; CBB_0514; phage(gi397912661) 5e-09 Click
6complement(157788..158231) PHAGE_Thermo_THSA_485A: transcriptional regulator, XRE family; CBB_0515; phage(gi397912660) 1e-14 Click
7158453..158665 PHAGE_Thermo_THSA_485A: helix-turn-helix domain protein; CBB_0516; phage(gi397912659) 2e-13 Click
8158668..158925 ABC transporter, ATP-binding protein; CBB_0517 0.0 Click
9159053..159190 conserved domain protein; CBB_0518 0.0 Click
10159252..159515 ferric uptake regulation protein; CBB_0519 0.0 Click
11159565..159924 conserved hypothetical protein; CBB_0520 0.0 Click
12159921..160073 flavodoxin; CBB_0521 0.0 Click
13160076..162013 PHAGE_Lister_B054: gp49; CBB_0522; phage(gi157325333) 3e-110 Click
14162015..162935 PHAGE_Lister_A006: gp42; CBB_0523; phage(gi157325459) 4e-64 Click
15162935..163678 PHAGE_Lister_B054: gp51; CBB_0524; phage(gi157325335) 1e-47 Click
16163662..164282 PHAGE_Strept_Dp_1: hypothetical protein; CBB_0525; phage(gi327198335) 6e-30 Click
17164286..164693 PHAGE_Clostr_phi3626: putative single stranded DNA binding protein; CBB_0526; phage(gi20066002) 3e-30 Click
18165329..166135 PHAGE_Lactob_Lrm1: DNA methylase; CBB_0527; phage(gi195661243) 2e-104 Click
19166202..166465 hypothetical protein; CBB_0528 0.0 Click
20166533..166715 hypothetical protein; CBB_0529 0.0 Click
21166735..166887 hypothetical protein; CBB_0530 0.0 Click
22166927..167079 acetate CoA-transferase subunit beta (Acetyl-CoA:acetoacetate CoA transferase subunit beta); CBB_0531 0.0 Click
23167127..167711 PHAGE_Clostr_phiCP13O: hypothetical protein; CBB_0532; phage(gi422935104) 4e-32 Click
24167744..170335 PHAGE_Helico_1961P: DNA primase; CBB_0533; phage(gi422935771) 2e-08 Click
25170623..171066 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp70; CBB_0534; phage(gi209901307) 8e-15 Click
26171229..171642 carbon monoxide dehydrogenase large subunit; CBB_0535 0.0 Click
27171889..172551 PHAGE_Clostr_phiCD38_2: recombinase/resolvase; CBB_0536; phage(gi333798162) 2e-08 Click
28172601..172786 beta-glucosidase; CBB_0537 0.0 Click
29172801..174597 PHAGE_Bacill_phBC6A51: hypothetical protein BC1891; CBB_0538; phage(gi31415785) 7e-16 Click
30174601..175872 PHAGE_Staphy_SpaA1: phage portal protein, SPP1; CBB_0539; phage(gi399498867) 3e-38 Click
31175872..176591 PHAGE_Clostr_CD119: putative head protein; CBB_0540; phage(gi90592642) 6e-13 Click
32176650..177243 PHAGE_Deep_s_D6E: scaffold protein; CBB_0541; phage(gi423262331) 4e-22 Click
33177261..178151 PHAGE_Staphy_phiETA3: major capsid protein; CBB_0542; phage(gi122891830) 4e-58 Click
34178195..178311 hypothetical protein; CBB_0543 0.0 Click
35178320..178580 prophage LambdaCh01, N-acetylmuramoyl-L-alanine amidase; CBB_0544 0.0 Click
36178582..178992 PHAGE_Clostr_phiCD38_2: hypothetical protein; CBB_0545; phage(gi333798116) 3e-24 Click
37178992..179336 PHAGE_Clostr_phiCD38_2: hypothetical protein; CBB_0546; phage(gi333798117) 9e-18 Click
38179333..179764 PHAGE_Clostr_phiCD38_2: hypothetical protein; CBB_0547; phage(gi333798118) 1e-38 Click
39179768..180136 PHAGE_Bacill_BCP78: hypothetical protein; CBB_0548; phage(gi410492926) 3e-11 Click
40180153..180665 PHAGE_Clostr_phiCD38_2: hypothetical protein; CBB_0549; phage(gi333798119) 5e-22 Click
41180665..181009 PHAGE_Clostr_phiCD38_2: hypothetical protein; CBB_0550; phage(gi333798120) 1e-16 Click
42181009..181602 PHAGE_Clostr_phiCD38_2: hypothetical protein; CBB_0551; phage(gi333798121) 2e-66 Click
43181661..182194 membrane protein; CBB_0552 0.0 Click
44182242..182376 PHAGE_Escher_D108: Com; CBB_0553; phage(gi281199699) 2e-05 Click
45182446..185067 PHAGE_Clostr_phiSM101: phage tail tape measure protein, TP901 family, core region domain protein; CBB_0554; phage(gi110804068) 7e-102 Click
46185067..185744 PHAGE_Clostr_phiCD38_2: tail component protein; CBB_0555; phage(gi333798124) 1e-31 Click
47185744..187411 PHAGE_Bacill_phBC6A52: endopeptidase; CBB_0556; phage(gi31415861) 6e-65 Click
48187427..188791 PHAGE_Clostr_phiCD38_2: tail fiber protein; CBB_0557; phage(gi333798127) 5e-10 Click
49198519..198551 attR    GAATCAGGGGTTCGACTCCCCTAGGAGCTACCA 0.0 Click

Region 2, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1162670..1163365) PHAGE_Plankt_PaV_LD: ABC transporter; CBB_0075; phage(gi371496158) 2e-35 Click
2complement(1163368..1164522) membrane-spanning protein; CBB_0074 0.0 Click
3complement(1164615..1165709) maltose O-acetyltransferase; CBB_0073 0.0 Click
41166198..1166821 PHAGE_Melano_entomopoxvirus: ORF MSV156 hypothetical protein; CBB_1710; phage(gi9631364) 5e-05 Click
51166870..1167031 lipoate--protein ligase; CBB_1711 0.0 Click
61167057..1167389 PHAGE_Lactob_Lj928: putative major head protein; CBB_1712; phage(gi41179318) 4e-09 Click
71167456..1167929 dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex; CBB_1713 0.0 Click
81167997..1168401 PHAGE_Clostr_phiSM101: HNH endonuclease domain protein; CBB_1714; phage(gi110804050) 1e-30 Click
91168549..1169034 PHAGE_Geobac_E2: putative terminase small subunit; CBB_1715; phage(gi148747728) 2e-24 Click
101169035..1170792 PHAGE_Geobac_E2: putative terminase large subunit; CBB_1716; phage(gi148747729) 1e-118 Click
111170828..1170998 conserved hypothetical protein; CBB_1717 0.0 Click
121171042..1172292 PHAGE_Clostr_phiSM101: phage portal protein, HK97 family; CBB_1718; phage(gi110804051) 1e-57 Click
131172285..1173028 PHAGE_Bacill_BtCS33: ATP-dependent endopeptidase clp proteolytic subunit clpP; CBB_1719; phage(gi392972714) 9e-36 Click
141173081..1174313 PHAGE_Clostr_phiSM101: phage major capsid protein, HK97 family; CBB_1720; phage(gi110804052) 1e-101 Click
151174398..1174691 PHAGE_Clostr_phiSM101: putative DNA packaging protein; CBB_1721; phage(gi110804046) 5e-12 Click
161174681..1175049 PHAGE_Clostr_phiSM101: putative phage head-tail adaptor; CBB_1722; phage(gi110804032) 1e-12 Click
171175050..1175412 PHAGE_Clostr_phiSM101: phage protein, HK97 gp10 family; CBB_1723; phage(gi110804042) 2e-22 Click
181175421..1175774 PHAGE_Bacill_BtCS33: putative structure protein; CBB_1724; phage(gi392972718) 4e-10 Click
191175860..1176459 PHAGE_Clostr_phiSM101: phage major tail protein, phi13 family subfamily; CBB_1725; phage(gi110804026) 1e-41 Click
201176521..1176865 PHAGE_Clostr_phiSM101: hypothetical protein; CBB_1726; phage(gi110804055) 5e-14 Click
211176985..1177104 hypothetical protein; CBB_1727 0.0 Click
221177121..1180636 PHAGE_Clostr_phiSM101: phage tail tape measure protein, TP901 family, core region domain protein; CBB_1728; phage(gi110804068) 0.0 Click
231180652..1181521 PHAGE_Clostr_phiCD6356: putative phage tail protein; CBB_1729; phage(gi326536863) 4e-52 Click
241181525..1182682 PHAGE_Clostr_phiCD6356: hypothetical protein; CBB_1730; phage(gi326536864) 4e-46 Click
251182682..1184574 PHAGE_Clostr_phiCD6356: truncated putative phage structural protein; CBB_1731; phage(gi326536865) 5e-62 Click

Region 3, total : 42 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12834718..2834730 attL    ATATAATTTTTTA 0.0 Click
2complement(2841383..2842192) PHAGE_Bacill_1: hypothetical protein BV1_gp03; CBB_2569; phage(gi155042921) 3e-36 Click
32842492..2843283 pyridine nucleotide-disulphide oxidoreductase family protein; CBB_2570 0.0 Click
42843280..2843549 transcriptional regulator; CBB_2571 0.0 Click
52843912..2844148 ATP-dependent DNA helicase; CBB_2572 0.0 Click
62844225..2844503 PHAGE_Lister_A500: gp33; CBB_2573; phage(gi157324992) 2e-14 Click
7complement(2844540..2845058) putative lipoprotein; CBB_2574 0.0 Click
8complement(2845179..2845424) amino acid ABC transporter, periplasmic substrate-binding protein; CBB_2575 0.0 Click
9complement(2845409..2845603) PHAGE_Strept_M102: hypothetical protein M102_gp24; CBB_2576; phage(gi242345595) 1e-06 Click
10complement(2845606..2845761) hypothetical protein; CBB_2577 0.0 Click
11complement(2846061..2846825) PHAGE_Clostr_phi8074_B1: endolysin CS74L; CBB_2578; phage(gi431810380) 5e-51 Click
12complement(2846868..2847077) conserved hypothetical protein; CBB_2579 0.0 Click
13complement(2847081..2847359) PHAGE_Staphy_SpaA1: hypothetical secreted or membrane protein; CBB_2580; phage(gi399498883) 2e-17 Click
14complement(2847430..2847576) PHAGE_Clostr_phi8074_B1: hypothetical protein; CBB_2581; phage(gi431810377) 1e-10 Click
15complement(2847576..2847776) PHAGE_Clostr_phi8074_B1: hypothetical protein; CBB_2582; phage(gi431810376) 2e-06 Click
16complement(2847797..2850439) PHAGE_Clostr_phi8074_B1: hypothetical protein; CBB_2583; phage(gi431810375) 7e-143 Click
17complement(2850439..2851803) PHAGE_Clostr_phiCD38_2: tail fiber protein; CBB_2584; phage(gi333798127) 6e-14 Click
18complement(2851819..2853492) PHAGE_Clostr_PhiS63: gp15; CBB_2585; phage(gi388570644) 1e-51 Click
19complement(2853495..2854196) PHAGE_Clostr_PhiS63: gp14; CBB_2586; phage(gi388570643) 3e-40 Click
20complement(2854189..2858028) PHAGE_Clostr_phiSM101: phage tail tape measure protein, TP901 family, core region domain protein; CBB_2587; phage(gi110804068) 4e-158 Click
21complement(2858086..2858205) hemolysin; CBB_2588 0.0 Click
22complement(2858331..2858708) PHAGE_Clostr_phiSM101: hypothetical protein; CBB_2589; phage(gi110804055) 4e-09 Click
23complement(2858766..2859374) PHAGE_Clostr_phiSM101: phage major tail protein, phi13 family subfamily; CBB_2590; phage(gi110804026) 5e-45 Click
24complement(2859419..2859781) PHAGE_Bacill_phIS3501: phage protein; CBB_2591; phage(gi422934335) 5e-11 Click
25complement(2859789..2860148) PHAGE_Clostr_phiSM101: phage protein, HK97 gp10 family; CBB_2592; phage(gi110804042) 4e-23 Click
26complement(2860153..2860392) conserved hypothetical protein; CBB_2593 0.0 Click
27complement(2860393..2860764) PHAGE_Clostr_PhiS63: gp8; CBB_2594; phage(gi388570637) 1e-06 Click
28complement(2860757..2861041) PHAGE_Clostr_PhiS63: gp7; CBB_2595; phage(gi388570636) 3e-10 Click
29complement(2861087..2862163) PHAGE_Clostr_PhiS63: gp6; CBB_2596; phage(gi388570635) 7e-100 Click
30complement(2862212..2862808) PHAGE_Bacill_phBC6A52: prohead protease; CBB_2597; phage(gi31415851) 4e-40 Click
31complement(2862786..2864033) PHAGE_Clostr_PhiS63: gp4; CBB_2598; phage(gi388570634) 2e-99 Click
32complement(2864266..2865960) PHAGE_Lactob_c5: putative terminase large subunit; CBB_2599; phage(gi418488157) 1e-63 Click
33complement(2865957..2866463) PHAGE_Clostr_phi3626: putative terminase small subunit; CBB_2600; phage(gi20065964) 5e-12 Click
34complement(2866543..2866971) PHAGE_Clostr_PhiS63: gp43; CBB_2601; phage(gi388570669) 9e-15 Click
35complement(2866971..2867453) PHAGE_Entero_phiFL4A: terminase small subunit; CBB_2602; phage(gi281416464) 8e-14 Click
362867710..2867722 attR    ATATAATTTTTTA 0.0 Click
37complement(2867751..2868356) PHAGE_Clostr_phiMMP04: integrase; CBB_2603; phage(gi414090489) 7e-67 Click
38complement(2868357..2868569) conserved hypothetical protein; CBB_2604 0.0 Click
39complement(2868825..2869217) nitroreductase family protein; CBB_2605 0.0 Click
40complement(2869207..2869377) hypothetical protein; CBB_2606 0.0 Click
41complement(2869389..2869514) putative ABC transporter, permease protein; CBB_2607 0.0 Click
42complement(2869526..2869711) hypothetical protein; CBB_2608 0.0 Click
43complement(2869708..2870412) conserved hypothetical protein; CBB_2609 0.0 Click
44complement(2870517..2871566) PHAGE_Clostr_phiMMP02: hypothetical protein; CBB_2610; phage(gi414090433) 2e-43 Click

Region 4, total : 46 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3034292..3034720) PHAGE_Strept_phiSASD1: gp4; CBB_1581; phage(gi298103512) 8e-06 Click
2complement(3034758..3034973) conserved hypothetical protein; CBB_1580 0.0 Click
33035411..3035423 attL    TATTTTTTTATAT 0.0 Click
4complement(3035426..3035563) hypothetical protein; CBB_1579 0.0 Click
5complement(3035600..3035743) hypothetical protein; CBB_1578 0.0 Click
6complement(3035848..3036000) hypothetical protein; CBB_1577 0.0 Click
7complement(3036080..3036337) DNA binding protein, excisionase family; CBB_1576 0.0 Click
8complement(3036341..3036796) PHAGE_Bacill_WBeta: hypothetical protein wp18; CBB_1575; phage(gi85701397) 9e-17 Click
9complement(3036961..3037941) PHAGE_Lactoc_T: hypothetical protein BK5-Tp15; CBB_1574; phage(gi14251140) 4e-05 Click
10complement(3038086..3038331) putative lipoprotein; CBB_1573 0.0 Click
11complement(3038342..3038524) PHAGE_Lactob_phiadh: hypothetical protein phiadhp63; CBB_1572; phage(gi9633063) 9e-08 Click
12complement(3038511..3038666) hypothetical protein; CBB_1571 0.0 Click
13complement(3039744..3040517) PHAGE_Clostr_phi8074_B1: endolysin CS74L; CBB_1570; phage(gi431810380) 6e-31 Click
14complement(3040559..3040753) conserved hypothetical protein; CBB_1569 0.0 Click
15complement(3040767..3041021) PHAGE_Clostr_phiSM101: hypothetical protein; CBB_1568; phage(gi110804030) 3e-15 Click
16complement(3041095..3041229) conserved hypothetical protein; CBB_1567 0.0 Click
17complement(3041351..3041746) hypothetical protein; CBB_1566 0.0 Click
18complement(3042068..3042262) hypothetical protein; CBB_1565 0.0 Click
19complement(3042547..3042702) hypothetical protein; CBB_1564 0.0 Click
20complement(3042787..3042969) PHAGE_Clostr_phiMMP04: hypothetical protein; CBB_1563; phage(gi414090466) 7e-16 Click
21complement(3042971..3043297) PHAGE_Clostr_phiC2: hypothetical protein phiC2p33; CBB_1562; phage(gi134287366) 4e-09 Click
22complement(3043309..3044766) PHAGE_Clostr_phiCD6356: truncated putative phage structural protein; CBB_1561; phage(gi326536865) 8e-60 Click
23complement(3044774..3045931) PHAGE_Clostr_phiCD6356: hypothetical protein; CBB_1560; phage(gi326536864) 5e-45 Click
24complement(3046127..3046996) PHAGE_Clostr_phiCD6356: putative phage tail protein; CBB_1559; phage(gi326536863) 3e-50 Click
25complement(3047012..3050569) PHAGE_Clostr_phiSM101: phage tail tape measure protein, TP901 family, core region domain protein; CBB_1558; phage(gi110804068) 0.0 Click
26complement(3050623..3050796) conserved hypothetical protein; CBB_1557 0.0 Click
27complement(3050856..3051242) PHAGE_Clostr_phiSM101: hypothetical protein; CBB_1556; phage(gi110804055) 2e-14 Click
28complement(3051309..3051914) PHAGE_Clostr_phiSM101: phage major tail protein, phi13 family subfamily; CBB_1555; phage(gi110804026) 6e-42 Click
29complement(3051958..3052320) PHAGE_Bacill_phIS3501: phage protein; CBB_1554; phage(gi422934335) 4e-10 Click
30complement(3052327..3052689) PHAGE_Clostr_phiSM101: phage protein, HK97 gp10 family; CBB_1553; phage(gi110804042) 3e-19 Click
31complement(3052689..3053060) PHAGE_Clostr_phiSM101: putative phage head-tail adaptor; CBB_1552; phage(gi110804032) 2e-12 Click
32complement(3053053..3053337) PHAGE_Clostr_PhiS63: gp7; CBB_1551; phage(gi388570636) 5e-11 Click
33complement(3053383..3054459) PHAGE_Clostr_phi3626: major capsid protein; CBB_1550; phage(gi20065969) 4e-37 Click
34complement(3054508..3055113) PHAGE_Bacill_phBC6A52: prohead protease; CBB_1549; phage(gi31415851) 8e-40 Click
35complement(3055082..3056329) PHAGE_Geobac_E2: putative portal protein; CBB_1548; phage(gi148747730) 2e-47 Click
36complement(3056562..3058253) PHAGE_Lactob_c5: putative terminase large subunit; CBB_1547; phage(gi418488157) 1e-61 Click
37complement(3058250..3058717) PHAGE_Clostr_phiSM101: phage terminase, small subunit, P27 family; CBB_1546; phage(gi110804034) 3e-06 Click
38complement(3058838..3059266) PHAGE_Clostr_phiSM101: HNH endonuclease domain protein; CBB_1545; phage(gi110804050) 3e-18 Click
39complement(3059266..3059748) PHAGE_Entero_phiFL4A: terminase small subunit; CBB_1544; phage(gi281416464) 3e-14 Click
403059795..3059807 attR    TATTTTTTTATAT 0.0 Click
41complement(3060046..3060651) PHAGE_Clostr_phiMMP04: integrase; CBB_1543; phage(gi414090489) 3e-66 Click
42complement(3060652..3060864) phage endopeptidase; CBB_1542 0.0 Click
43complement(3061124..3061510) hypothetical protein; CBB_1541 0.0 Click
44complement(3061500..3061670) hypothetical protein; CBB_1540 0.0 Click
45complement(3061682..3061831) hypothetical protein; CBB_1539 0.0 Click
46complement(3061818..3062003) hypothetical protein; CBB_1538 0.0 Click
47complement(3062000..3062713) conserved hypothetical protein; CBB_1537 0.0 Click
48complement(3062808..3063857) PHAGE_Clostr_phiMMP02: hypothetical protein; CBB_1536; phage(gi414090433) 1e-42 Click

Region 5, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13999980..4000040 attL    TGATATTTTAATACTTATAGAATATCTACTTTAATGTAATACAATGTCCAGTATATACTTT 0.0 Click
2complement(4000379..4001701) PHAGE_Staphy_S24_1: structure protein putative minor tail protein; CBB_A0034; phage(gi371671333) 8e-06 Click
34001962..4002096 hypothetical protein; CBB_A0035 0.0 Click
4complement(4002110..4002223) hypothetical protein; CBB_A0036 0.0 Click
54002197..4002772 sigma-70 region 2 domain protein; CBB_A0037 0.0 Click
6complement(4002786..4003769) PHAGE_Achole_L2: integrase; CBB_A0038; phage(gi9626516) 4e-15 Click
7complement(4003815..4004048) PHAGE_Thermu_77: hypothetical protein; CBB_A0039; phage(gi257136465) 1e-06 Click
84004180..4004404 conserved hypothetical protein; CBB_A0040 0.0 Click
94004505..4004669 conserved domain protein; CBB_A0041 0.0 Click
104004683..4005201 PHAGE_Clostr_phi24R: N-acetylmuramoyl-L-alanine amidase; CBB_A0042; phage(gi422936723) 1e-37 Click
11complement(4005253..4005924) PHAGE_Clostr_phiSM101: hypothetical protein; CBB_A0043; phage(gi110804024) 1e-05 Click
124006027..4006143 conserved hypothetical protein; CBB_A0044 0.0 Click
134007147..4008511 PHAGE_Bacill_IEBH: potential replication protein; CBB_A0045; phage(gi197261587) 3e-25 Click
144008645..4008779 hypothetical protein; CBB_A0046 0.0 Click
154008807..4009898 PHAGE_Ostreo_1: hypothetical protein H665_p055; CBB_A0047; phage(gi260665925) 2e-33 Click
164013740..4013800 attR    TGATATTTTAATACTTATAGAATATCTACTTTAATGTAATACAATGTCCAGTATATACTTT 0.0 Click