Burkholderia pseudomallei 91 PMP6xxBPSxx91-1, whole genome shotgun [asmbl_id: NC_000000].6867787, GC%: 67.76%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1138114..138125 attL    CGCGGCGCGGCG 0.0 Click
2complement(138512..139642) PHAGE_Burkho_phi52237: prophage integrase; PP_00149; phage(gi72537678) 0.0 Click
3complement(140510..143302) PHAGE_Burkho_phi52237: hypothetical protein BPSphi5223_0004; PP_00150; phage(gi72537680) 0.0 Click
4complement(143314..143568) PHAGE_Burkho_phi52237: hypothetical protein BPSphi5223_0005; PP_00151; phage(gi72537681) 5e-43 Click
5complement(143565..143924) PHAGE_Burkho_phi52237: hypothetical protein BPSphi5223_0006; PP_00152; phage(gi117676335) 3e-64 Click
6complement(143927..144133) PHAGE_Burkho_phi52237: hypothetical protein BPSphi5223_0050; PP_00153; phage(gi117676330) 3e-36 Click
7complement(144302..144541) PHAGE_Burkho_phi52237: hypothetical protein BPSphi5223_0007; PP_00154; phage(gi117676334) 1e-38 Click
8complement(144545..144739) PHAGE_Burkho_phi52237: hypothetical protein BPSphi5223_0051; PP_00155; phage(gi117676331) 4e-30 Click
9complement(144783..144980) PHAGE_Burkho_phi52237: hypothetical protein BPSphi5223_0009; PP_00156; phage(gi72537686) 6e-31 Click
10complement(144986..145204) PHAGE_Burkho_phi52237: hypothetical protein BPSphi5223_0011; PP_00157; phage(gi72537687) 6e-36 Click
11complement(145220..145765) PHAGE_Burkho_phi52237: hypothetical protein BPSphi5223_0012; PP_00158; phage(gi72537688) 3e-99 Click
12complement(145851..146099) PHAGE_Burkho_phi52237: putative phage transcriptional activator Ogr/Delta; PP_00159; phage(gi72537689) 1e-43 Click
13complement(146087..146251) PHAGE_Burkho_KS5: gp9; PP_00160; phage(gi327198007) 2e-16 Click
14complement(146387..146623) PHAGE_Burkho_phi52237: hypothetical protein BPSphi5223_0015; PP_00161; phage(gi72537691) 1e-37 Click
15146830..147201 PHAGE_Burkho_phi52237: helix-turn-helix domain protein; PP_00162; phage(gi72537692) 2e-47 Click
16147331..147966 PHAGE_Burkho_phi52237: putative phage-encoded membrane protein; PP_00163; phage(gi72537693) 1e-36 Click
17148009..148509 PHAGE_Mannhe_phiMHaA1: hypothetical protein MhaA1p34; PP_00164; phage(gi109289969) 7e-06 Click
18complement(148517..149614) PHAGE_Burkho_phi52237: bacteriophage late control gene D protein; PP_00165; phage(gi72537694) 0.0 Click
19complement(149614..150039) PHAGE_Burkho_phi52237: fels-2 prophage protein; PP_00166; phage(gi72537695) 8e-75 Click
20complement(150057..153017) PHAGE_Burkho_phi52237: bacteriophage membrane protein; PP_00167; phage(gi117676337) 0.0 Click
21complement(153020..153133) PHAGE_Burkho_phiE202: gp27, phage tail protein, P2 GpE family; PP_00168; phage(gi134288776) 1e-15 Click
22complement(153186..153485) PHAGE_Burkho_phi52237: phage tail protein E; PP_00169; phage(gi72537697) 3e-47 Click
23complement(153543..154052) PHAGE_Burkho_phi52237: phage major tail tube protein; PP_00170; phage(gi72537698) 3e-95 Click
24complement(154068..155240) PHAGE_Burkho_phi52237: phage tail sheath protein; PP_00171; phage(gi72537699) 0.0 Click
25155282..155581 PHAGE_Burkho_phi52237: pbsx family phage portal protein; PP_00172; phage(gi72537722) 2e-34 Click
26complement(155625..155981) PHAGE_Burkho_2: gp6, putative addiction module antidote protein; PP_00173; phage(gi134288715) 4e-60 Click
27complement(155984..156298) PHAGE_Burkho_2: gp7, putative addiction module killer protein; PP_00174; phage(gi134288691) 5e-54 Click
28167828..167839 attR    CGCGGCGCGGCG 0.0 Click

Region 2, total : 7 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1810106..810117 attL    GGAAGCCGCCGC 0.0 Click
2complement(810434..811792) PROPHAGE_Xantho_306: phage-related integrase; PP_00844; phage(gi21242262) 6e-23 Click
3complement(811877..811953) tRNA 0.0 Click
4complement(812055..812198) hypothetical protein BPC006_I0798 [Burkholderia pseudomallei BPC006] gi|403517462|ref|YP_006651595.1|; PP_00845 3e-18 Click
5complement(812195..813853) PHAGE_Burkho_phi1026b: gp59; PP_00846; phage(gi38707949) 3e-46 Click
6complement(814076..815242) PHAGE_Ectoca_1: EsV-1-65; PP_00847; phage(gi13242537) 6e-12 Click
7complement(815256..816317) PHAGE_Ectoca_1: EsV-1-65; PP_00848; phage(gi13242537) 8e-06 Click
8816512..817582 PROPHAGE_Escher_MG1655: DNA strand exchange and recombination protein with protease and nuclease activity; PP_00849; phage(gi16130606) 2e-131 Click
9817582..818565 PHAGE_Salmon_1: putative bacteriophage tail fiber protein; Lambda gpN homolog; PP_00850; phage(gi169257204) 6e-05 Click
10825403..825414 attR    GGAAGCCGCCGC 0.0 Click

Region 3, total : 30 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11135182..1137167 PHAGE_Vibrio_vB_VpaM_MAR: terminase large subunit; PP_01193; phage(gi428782726) 3e-42 Click
21137178..1137384 hypothetical protein GBP346_A2718 [Burkholderia pseudomallei MSHR346] gi|237812958|ref|YP_002897409.1|; PP_01194 1e-29 Click
31137381..1138874 PHAGE_Vibrio_vB_VpaM_MAR: portal protein; PP_01195; phage(gi428782728) 2e-80 Click
41138871..1139971 PHAGE_Entero_mEp213: head maturation protease; PP_01196; phage(gi428782594) 6e-38 Click
51139998..1140342 hypothetical protein BP1026B_I1102 [Burkholderia pseudomallei 1026b] gi|386861201|ref|YP_006274150.1|; PP_01197 4e-57 Click
61140377..1141402 PHAGE_Vibrio_vB_VpaM_MAR: hypothetical protein; PP_01198; phage(gi428782731) 6e-35 Click
71141406..1141696 hypothetical protein GBP346_A2713 [Burkholderia pseudomallei MSHR346] gi|237812953|ref|YP_002897404.1|; PP_01199 3e-48 Click
81141698..1142228 PHAGE_Vibrio_vB_VpaM_MAR: hypothetical protein; PP_01200; phage(gi428782733) 4e-20 Click
91142236..1142751 hypothetical protein BP1026B_I1106 [Burkholderia pseudomallei 1026b] gi|386861205|ref|YP_006274154.1|; PP_01201 2e-97 Click
101142754..1143434 PHAGE_Burkho_phi52237: phage baseplate assembly protein; PP_01202; phage(gi72537705) 2e-33 Click
111143499..1143705 hypothetical protein BP1026B_I1108 [Burkholderia pseudomallei 1026b] gi|386861207|ref|YP_006274156.1|; PP_01203 7e-31 Click
121143702..1144046 PHAGE_Vibrio_vB_VpaM_MAR: baseplate assembly protein; PP_01204; phage(gi428782737) 2e-14 Click
131144043..1144936 PHAGE_Salmon_RE_2010: baseplate assembly protein J; PP_01205; phage(gi418489711) 1e-47 Click
141144944..1145504 PHAGE_Burkho_phiE255: gp25, tail fiber; PP_01206; phage(gi134288819) 7e-34 Click
151145492..1146955 PROPHAGE_Salmon_Ty2: variable tail fiber protein; PP_01207; phage(gi29143754) 3e-16 Click
161146971..1147423 PHAGE_Entero_SfV: tail fibre assembly protein; PP_01208; phage(gi19549010) 7e-14 Click
171147489..1148658 PHAGE_Vibrio_vB_VpaM_MAR: tail sheath protein; PP_01209; phage(gi428782746) 6e-81 Click
181148669..1149172 PHAGE_Vibrio_vB_VpaM_MAR: tail tube protein; PP_01210; phage(gi428782747) 1e-31 Click
191149242..1149544 hypothetical protein BP1026B_I1116 [Burkholderia pseudomallei 1026b] gi|386861215|ref|YP_006274164.1|; PP_01211 5e-50 Click
201149498..1149614 hypothetical protein GBP346_A2700 [Burkholderia pseudomallei MSHR346] gi|237812940|ref|YP_002897391.1|; PP_01212 3e-14 Click
211149632..1152046 PHAGE_Haemop_SuMu: bacteriophage tail length determination protein; PP_01213; phage(gi418489066) 3e-22 Click
221152055..1152936 PHAGE_Vibrio_vB_VpaM_MAR: putative tail protein; PP_01214; phage(gi428782751) 2e-14 Click
231152911..1153117 PHAGE_Vibrio_vB_VpaM_MAR: putative tail protein; PP_01215; phage(gi428782752) 3e-07 Click
241153127..1154179 PHAGE_Vibrio_vB_VpaM_MAR: putative tail protein; PP_01216; phage(gi428782753) 3e-43 Click
251154255..1154449 hypothetical protein GBP346_A2694 [Burkholderia pseudomallei MSHR346] gi|237812934|ref|YP_002897385.1|; PP_01217 2e-31 Click
261154442..1154939 PHAGE_Burkho_2: gp25, phage lysozyme; PP_01218; phage(gi134288680) 2e-70 Click
271154939..1155463 PHAGE_Burkho_phiE125: hypothetical protein phiE125p26; PP_01219; phage(gi17975187) 1e-87 Click
281155606..1156394 PHAGE_Burkho_phiE125: DNA adenine methylase; PP_01220; phage(gi17975188) 8e-150 Click
291157320..1157472 hypothetical protein BPC006_I1172 [Burkholderia pseudomallei BPC006] gi|403517834|ref|YP_006651967.1|; PP_01221 3e-20 Click
301158118..1158534 PHAGE_Burkho_phiE125: DNA adenine methylase; PP_01222; phage(gi17975188) 4e-38 Click

Region 4, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11216510..1216521 attL    CGCCCTTGATGC 0.0 Click
2complement(1220613..1220930) PHAGE_Pseudo_PAJU2: hypothetical protein PAJU2_gp08; PP_01295; phage(gi209552427) 8e-06 Click
3complement(1220920..1222209) PHAGE_Pseudo_PAJU2: putative portal protein; PP_01296; phage(gi209552425) 4e-83 Click
4complement(1222209..1222367) hypothetical protein BPSL1141 [Burkholderia pseudomallei K96243] gi|53718776|ref|YP_107762.1|; PP_01297 3e-22 Click
5complement(1222401..1224290) PHAGE_Pseudo_PAJU2: structural protein; PP_01298; phage(gi209552422) 8e-127 Click
6complement(1224347..1225867) PHAGE_Pseudo_PAJU2: putative terminase; PP_01299; phage(gi209552421) 0.0 Click
7complement(1225849..1226289) PHAGE_Pseudo_PAJU2: hypothetical protein PAJU2_gp01; PP_01300; phage(gi209552420) 1e-27 Click
8complement(1226394..1226642) PHAGE_Burkho_phiE125: putative class I holin; PP_01301; phage(gi17975232) 4e-07 Click
9complement(1226684..1226872) hypothetical; PP_01302 0.0 Click
10complement(1227457..1227888) hypothetical protein BPSL1146 [Burkholderia pseudomallei K96243] gi|53718781|ref|YP_107767.1|; PP_01303 4e-76 Click
11complement(1228005..1228232) hypothetical protein BPSL1147 [Burkholderia pseudomallei K96243] gi|53718782|ref|YP_107768.1|; PP_01304 5e-35 Click
12complement(1228229..1228429) hypothetical protein BPSL1148 [Burkholderia pseudomallei K96243] gi|53718783|ref|YP_107769.1|; PP_01305 1e-29 Click
13complement(1228729..1228980) hypothetical protein BPSL1150 [Burkholderia pseudomallei K96243] gi|53718785|ref|YP_107771.1|; PP_01306 6e-38 Click
14complement(1228973..1229155) hypothetical protein BPSL1151 [Burkholderia pseudomallei K96243] gi|53718786|ref|YP_107772.1|; PP_01307 7e-26 Click
15complement(1229152..1229361) hypothetical protein BPSL1152 [Burkholderia pseudomallei K96243] gi|53718787|ref|YP_107773.1|; PP_01308 6e-30 Click
16complement(1229354..1229488) hypothetical protein BPSL1153 [Burkholderia pseudomallei K96243] gi|53718788|ref|YP_107774.1|; PP_01309 4e-17 Click
17complement(1229541..1229726) hypothetical protein BCAL2965a [Burkholderia cenocepacia J2315] gi|206561303|ref|YP_002232068.1|; PP_01310 7e-05 Click
18complement(1230018..1230368) hypothetical protein BPSL1154 [Burkholderia pseudomallei K96243] gi|53718790|ref|YP_107776.1|; PP_01311 1e-60 Click
19complement(1230386..1230616) hypothetical protein BPSL1155 [Burkholderia pseudomallei K96243] gi|53718791|ref|YP_107777.1|; PP_01312 1e-36 Click
201231221..1231232 attR    CGCCCTTGATGC 0.0 Click
21complement(1231484..1232719) PHAGE_Burkho_BcepC6B: putative integrase protein; PP_01313; phage(gi48697215) 4e-82 Click

Region 5, total : 15 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13719611..3719661 attL    TGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAGGGCAGT 0.0 Click
2complement(3721708..3721836) PHAGE_Entero_N15: gp49; PP_03919; phage(gi9630516) 2e-05 Click
3complement(3722082..3722486) PHAGE_Pseudo_vB_PaeS_PMG1: integrase; PP_03920; phage(gi374531680) 2e-28 Click
4complement(3723017..3723682) PHAGE_Ralsto_p12J: ORF9; PP_03921; phage(gi156535144) 5e-32 Click
5complement(3724253..3724846) PHAGE_Ralsto_p12J: ORF8; PP_03922; phage(gi156535143) 2e-11 Click
6complement(3724946..3726304) PHAGE_Entero_2: gene IV product; PP_03923; phage(gi9625382) 1e-16 Click
7complement(3726319..3727167) PHAGE_Ralsto_p12J: ORF7; PP_03924; phage(gi156535142) 1e-24 Click
8complement(3727221..3727448) PHAGE_Ralsto_RSS0: hypothetical protein; PP_03925; phage(gi423262461) 3e-08 Click
9complement(3727499..3729190) PHAGE_Parame_NY2A: hypothetical protein NY2A_B070R; PP_03926; phage(gi157952374) 6e-14 Click
10complement(3729296..3729502) hypothetical protein BPSL3350 [Burkholderia pseudomallei K96243] gi|53720960|ref|YP_109946.1|; PP_03927 2e-30 Click
11complement(3729686..3729892) bacteriophage coat protein [Burkholderia pseudomallei K96243] gi|53720961|ref|YP_109947.1|; PP_03928 4e-29 Click
12complement(3729976..3730278) PHAGE_Ralsto_RSM3: hypothetical protein RSM3_gp01; PP_03929; phage(gi209901314) 1e-14 Click
13complement(3730767..3730886) hypothetical; PP_03930 0.0 Click
14complement(3731158..3731233) tRNA 0.0 Click
153731158..3731208 attR    TGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAGGGCAGT 0.0 Click
163731582..3732427 PHAGE_Salmon_1: putative bacteriophage tail fiber protein; Lambda gpN homolog; PP_03931; phage(gi169257204) 1e-06 Click
17complement(3732411..3732527) hypothetical protein BURPS668_3917 [Burkholderia pseudomallei 668] gi|126439743|ref|YP_001060911.1|; PP_03932 1e-15 Click
18complement(3732740..3734827) PHAGE_Bacill_36: PcrA helicase; PP_03933; phage(gi156564011) 3e-99 Click

Region 6, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
16760161..6761858 PHAGE_Acanth_moumouvirus: WD40 domain-containing protein; PP_07186; phage(gi441431993) 8e-06 Click
26761855..6762565 hypothetical protein BTH_II1283 [Burkholderia thailandensis E264] gi|83716101|ref|YP_439479.1|; PP_07187 2e-130 Click
36762562..6763545 PHAGE_Microc_LMM01: hypothetical protein MaLMM01_gp062; PP_07188; phage(gi117530233) 2e-15 Click
46763663..6763977 riboflavin biosynthesis protein RibD [Burkholderia thailandensis E264] gi|83717489|ref|YP_439477.1|; PP_07189 7e-28 Click
5complement(6764463..6766826) PHAGE_Burkho_phiE202: gp32, bacteriophage protein; PP_07190; phage(gi134288773) 0.0 Click
6complement(6766837..6767391) PHAGE_Burkho_phiE202: gp33, phage tail protein I; PP_07191; phage(gi134288744) 5e-102 Click
7complement(6767384..6768289) PHAGE_Burkho_phiE202: gp34, phage baseplate assembly protein; PP_07192; phage(gi134288785) 2e-158 Click
8complement(6768286..6768639) PHAGE_Burkho_phiE202: gp35, phage baseplate assembly protein; PP_07193; phage(gi134288768) 3e-61 Click
9complement(6768645..6769325) PHAGE_Burkho_phiE202: gp36, gpV; PP_07194; phage(gi134288750) 1e-126 Click
106769466..6770275 PHAGE_Burkho_phiE202: gp37, DNA methylase; PP_07195; phage(gi134288786) 2e-150 Click
11complement(6771098..6771565) PHAGE_Burkho_phiE202: gp39, phage virion morphogenesis protein; PP_07196; phage(gi134288746) 1e-82 Click
12complement(6771562..6771978) PHAGE_Burkho_phiE202: gp40, P2 phage tail completion protein R (GpR); PP_07197; phage(gi134288754) 3e-74 Click
13complement(6771971..6772129) PHAGE_Burkho_phiE202: gp41, LysC; PP_07198; phage(gi134288745) 3e-25 Click
14complement(6772083..6772523) PHAGE_Burkho_phiE202: gp42, protein LysB; PP_07199; phage(gi134288770) 3e-68 Click
15complement(6772520..6773332) PHAGE_Burkho_phiE202: gp43, bacteriophage-acquired protein; PP_07200; phage(gi134288769) 9e-152 Click
16complement(6773329..6773601) PHAGE_Burkho_phiE202: gp44, putative bacteriophage membrane protein; PP_07201; phage(gi134288752) 1e-44 Click
17complement(6773603..6773947) PHAGE_Burkho_phiE202: gp45, putative bacteriophage membrane protein; PP_07202; phage(gi134288749) 4e-56 Click
18complement(6773962..6774168) PHAGE_Burkho_phiE202: gp46, phage Tail Protein X; PP_07203; phage(gi134288782) 3e-33 Click
19complement(6774165..6774416) PHAGE_Burkho_phiE202: gp47, hypothetical protein; PP_07205; phage(gi134288766) 7e-42 Click
20complement(6774416..6774682) PHAGE_Burkho_phiE202: gp48, phage head completion protein (GPL); PP_07204; phage(gi134288751) 4e-41 Click
21complement(6774821..6775084) PHAGE_Burkho_phiE125: DNA adenine methylase; PP_07206; phage(gi17975188) 2e-27 Click