Salmonella enterica subsp. enterica serovar Saintpaul str. SARA23 [asmbl_id: NC_000000].4726474, GC%: 52.26%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 29 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(53471..54199) PHAGE_Entero_P1: PmgQ; SeSPA_A0053; phage(gi46401711) 9e-34 Click
2complement(54778..55254) serine acetyltransferase; SeSPA_A0054 0.0 Click
3complement(55575..56030) PHAGE_Haemop_SuMu: enoyl-CoA hydratase/carnithine racemase-like protein; SeSPA_A0055; phage(gi418489075) 6e-24 Click
4complement(56027..56590) PHAGE_Haemop_Aaphi23: putative tail fiber assembly protein; SeSPA_A0056; phage(gi31544054) 3e-07 Click
5complement(56648..58306) PROPHAGE_Salmon_Ty2: variable tail fiber protein; SeSPA_A0057; phage(gi29143754) 2e-40 Click
6complement(58309..58941) PHAGE_Burkho_BcepMu: gp51; SeSPA_A0058; phage(gi48696961) 7e-26 Click
7complement(58934..60049) PHAGE_Burkho_BcepMu: gp50; SeSPA_A0059; phage(gi48696960) 2e-104 Click
8complement(60040..60399) PHAGE_Burkho_BcepMu: gp49; SeSPA_A0060; phage(gi48696959) 1e-35 Click
960460..60582 hypothetical protein; SeSPA_A0061 0.0 Click
10complement(60563..62101) PHAGE_Salmon_epsilon34: GtrC; putative membrane protein; SeSPA_A0062; phage(gi221328637) 2e-60 Click
11complement(62110..63039) PHAGE_Entero_SfV: bactoprenol glucosyltransferase; SeSPA_A0063; phage(gi19549012) 6e-153 Click
12complement(63036..63398) PHAGE_Entero_SfV: putative flippase; SeSPA_A0064; phage(gi19549013) 7e-48 Click
13complement(63592..63717) hypothetical protein; SeSPA_A0065 0.0 Click
14complement(63726..64448) PHAGE_Burkho_BcepMu: gp48; SeSPA_A0066; phage(gi48696958) 2e-39 Click
15complement(64458..65501) PHAGE_Burkho_BcepMu: gp47; SeSPA_A0067; phage(gi48696957) 9e-81 Click
16complement(65489..65698) PHAGE_Burkho_BcepMu: gp46; SeSPA_A0068; phage(gi48696956) 9e-19 Click
17complement(65698..66651) PHAGE_Burkho_BcepMu: gp45; SeSPA_A0069; phage(gi48696955) 1e-45 Click
18complement(66651..69005) PHAGE_Burkho_BcepMu: gp44; SeSPA_A0070; phage(gi48696954) 1e-68 Click
19complement(69102..69230) conserved hypothetical protein; SeSPA_A0071 0.0 Click
20complement(69190..69507) PHAGE_Burkho_BcepMu: gp41; SeSPA_A0072; phage(gi48696951) 4e-10 Click
21complement(69559..70083) PHAGE_Burkho_BcepMu: gp40; SeSPA_A0073; phage(gi48696950) 1e-68 Click
22complement(70083..71510) PHAGE_Burkho_BcepMu: gp39; SeSPA_A0074; phage(gi48696949) 0.0 Click
23complement(71500..71697) PHAGE_Burkho_BcepMu: gp38; SeSPA_A0075; phage(gi48696948) 2e-08 Click
24complement(71694..72149) PHAGE_Burkho_BcepMu: gp37; SeSPA_A0076; phage(gi48696947) 2e-13 Click
25complement(72309..72623) PHAGE_Burkho_BcepMu: gp25; SeSPA_A0077; phage(gi48696935) 3e-23 Click
26complement(72636..73241) PHAGE_Burkho_BcepMu: gp22; SeSPA_A0078; phage(gi48696932) 7e-57 Click
27complement(73244..73531) PHAGE_Burkho_BcepMu: gp21; SeSPA_A0079; phage(gi48696931) 7e-21 Click
2873758..73889 hypothetical protein; SeSPA_A0080 0.0 Click
2974107..74454 PHAGE_Burkho_BcepMu: gp01; SeSPA_A0081; phage(gi48696911) 7e-24 Click

Region 2, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11459860..1459873 attL    TTTCCGCCAGCTCA 0.0 Click
21471793..1473451 PHAGE_Entero_P2: Old; SeSPA_A1458; phage(gi9630369) 8e-06 Click
3complement(1473448..1474398) conserved hypothetical protein; SeSPA_A1459 0.0 Click
41474544..1475662 PHAGE_Cronob_ENT47670: putative tail protein; SeSPA_A1460; phage(gi431810494) 4e-05 Click
51475659..1477605 PHAGE_Plankt_PaV_LD: ABC transporter; SeSPA_A1461; phage(gi371496158) 5e-41 Click
61477637..1477780 hypothetical protein; SeSPA_A1462 0.0 Click
7complement(1477735..1477956) PHAGE_Lactoc_bIL312: Csp; SeSPA_A1463; phage(gi13095918) 5e-14 Click
81478280..1478600 PHAGE_Cronob_vB_CsaM_GAP32: ATP-dependent Clp protease; SeSPA_A1464; phage(gi414087232) 3e-05 Click
91478631..1480907 PROPHAGE_Escher_EDL933: ATP-dependent Clp protease ATP-binding subunit; SeSPA_A1465; phage(gi15800640) 0.0 Click
10complement(1481308..1481991) PROPHAGE_Escher_CFT073: transposase insF; SeSPA_A1466; phage(gi26249410) 1e-31 Click
111489303..1489316 attR    TTTCCGCCAGCTCA 0.0 Click

Region 3, total : 53 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1732452..1732781) PHAGE_Aeromo_CC2: hypothetical protein; SeSPA_A1713; phage(gi423261545) 9e-08 Click
2complement(1732778..1733515) ribosomal large subunit pseudouridine synthase E; SeSPA_A1714 0.0 Click
31733615..1734865 isocitrate dehydrogenase, NADP-dependent; SeSPA_A1715 0.0 Click
41734931..1734944 attL    TCTTCCCCAAAACT 0.0 Click
5complement(1734979..1736199) PHAGE_Entero_mEp235: integrase; SeSPA_A1716; phage(gi428781836) 4e-62 Click
6complement(1736397..1736900) PHAGE_Entero_P22: EaA; SeSPA_A1717; phage(gi9635497) 5e-38 Click
7complement(1736897..1737229) PHAGE_Salmon_ST64B: hypothetical protein sb32; SeSPA_A1718; phage(gi23505476) 4e-20 Click
8complement(1737222..1737542) PHAGE_Entero_mEp213: hypothetical protein; SeSPA_A1719; phage(gi428782634) 1e-21 Click
9complement(1737578..1738408) PHAGE_Entero_epsilon15: RecT; SeSPA_A1720; phage(gi30387413) 8e-82 Click
10complement(1738401..1740839) PHAGE_Gifsy_1: bacteriophage exodeoxyribonuclease VIII-like protein; SeSPA_A1721; phage(gi169257262) 0.0 Click
11complement(1741501..1741617) PHAGE_Gifsy_1: hypothetical protein STM2630.1n.Gifsy1; SeSPA_A1722; phage(gi169257259) 2e-15 Click
12complement(1741989..1743098) PHAGE_Salmon_ST160: regulatory protein; SeSPA_A1723; phage(gi318065923) 6e-120 Click
131744154..1744303 PHAGE_Gifsy_1: probable regulatory protein; transcriptional activator; lambda CII analog; SeSPA_A1725; phage(gi169257256) 2e-21 Click
141744294..1744410 hypothetical protein; SeSPA_A1726 0.0 Click
151744388..1745371 PHAGE_Gifsy_1: bacteriophage replication protein O; SeSPA_A1727; phage(gi169257255) 0.0 Click
161745374..1746123 PHAGE_Gifsy_1: bacteriophage DNA replication protein; DnaC homolog; SeSPA_A1728; phage(gi169257254) 2e-137 Click
171746164..1746481 PHAGE_Gifsy_1: hypothetical protein STM2624.Gifsy1; SeSPA_A1729; phage(gi169257253) 6e-49 Click
181746478..1746798 PHAGE_Salmon_SPN3UB: hypothetical protein; SeSPA_A1730; phage(gi423262430) 6e-28 Click
191746798..1747043 PHAGE_Entero_ES18: gp40; SeSPA_A1731; phage(gi62362253) 5e-35 Click
201747354..1748571 PHAGE_Salmon_SSU5: hypothetical protein; SeSPA_A1732; phage(gi390013942) 2e-130 Click
211749288..1749521 PHAGE_Gifsy_1: bacteriophage putative DNA damage-inducible protein; DinI homolog; SeSPA_A1733; phage(gi169257250) 2e-38 Click
221749770..1749886 PHAGE_Entero_mEp237: hypothetical protein; SeSPA_A1734; phage(gi435439314) 2e-15 Click
231749921..1750523 PHAGE_Gifsy_1: conserved hypothetical bacteriophage protein; SeSPA_A1735; phage(gi169257248) 3e-110 Click
241750523..1750729 PHAGE_Gifsy_1: hypothetical protein STM2620.1n.Gifsy1; SeSPA_A1736; phage(gi169257247) 9e-35 Click
251750732..1751343 PHAGE_Gifsy_1: NinG; SeSPA_A1737; phage(gi169257246) 3e-116 Click
261751476..1752273 PHAGE_Gifsy_2: prophage antitermination protein; late gene regulator; Lamba gpQ homolog; SeSPA_A1738; phage(gi169257290) 1e-153 Click
27complement(1753743..1754216) PHAGE_Gifsy_1: virulence protein GogA; SeSPA_A1739; phage(gi169257241) 1e-89 Click
281754699..1755034 PHAGE_Gifsy_1: bacteriophage lysis protein; holin; SeSPA_A1740; phage(gi169257240) 4e-58 Click
291755021..1755470 PHAGE_Gifsy_1: bacteriophage lysin protein; endolysin; SeSPA_A1741; phage(gi169257239) 1e-79 Click
301755467..1755934 PHAGE_Gifsy_1: bacteriophage lysis protein; Rz; SeSPA_A1742; phage(gi169257238) 2e-71 Click
31complement(1756171..1756494) PHAGE_Gifsy_1: hypothetical protein STM2610.Gifsy1; SeSPA_A1743; phage(gi169257237) 2e-56 Click
321756858..1757403 PHAGE_Gifsy_1: DNA packaging protein; small terminase subunit; Lambda Nu1 homolog; SeSPA_A1745; phage(gi169257236) 2e-87 Click
331757375..1759306 PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; SeSPA_A1746; phage(gi169257235) 0.0 Click
341759290..1759493 PHAGE_Gifsy_1: bacteriophage head-to-tail joining protein; adapter between portal and gpFII; Lambda gpW homolog; SeSPA_A1747; phage(gi169257234) 2e-30 Click
351759451..1761070 PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; SeSPA_A1748; phage(gi169257233) 0.0 Click
361761060..1762556 PHAGE_Gifsy_1: bacteriophage prohead protease; Lambda gpC homolog; SeSPA_A1749; phage(gi169257232) 0.0 Click
371762569..1762916 PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; SeSPA_A1750; phage(gi169257231) 2e-61 Click
381762971..1763999 PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; SeSPA_A1751; phage(gi169257230) 0.0 Click
391764057..1764416 PHAGE_Gifsy_1: bacteriophage accessory DNA packaging protein; Lambda FI homolog; SeSPA_A1752; phage(gi169257229) 4e-62 Click
401764427..1764804 PHAGE_Gifsy_1: bacteriophage minor capsid protein; forms tail attachment site on head; Lambda FII homolog; SeSPA_A1753; phage(gi169257228) 1e-64 Click
41complement(1764989..1765192) hypothetical protein; SeSPA_A1754 0.0 Click
421765196..1765369 PHAGE_Gifsy_1: bacteriophage head-tail assembly protein; Lambda gpZ homolog; SeSPA_A1755; phage(gi169257227) 3e-26 Click
431765612..1765767 PHAGE_Gifsy_1: bacteriophage tail shaft stabilization protein; Lambda gpU homolog; SeSPA_A1756; phage(gi169257225) 4e-24 Click
441765778..1766521 PHAGE_Gifsy_1: bacteriophage major tail subunit; Lambda gpV homolog; SeSPA_A1757; phage(gi169257224) 3e-137 Click
451766572..1766967 PHAGE_Gifsy_1: bacteriophage tail assembly chaperone; Lambda gpG homolog; SeSPA_A1758; phage(gi169257223) 2e-70 Click
461767030..1767302 PHAGE_Gifsy_1: part of bacteriophage tail assembly chaperone gpG by translational frameshifting; Lambda gpT homolog; SeSPA_A1759; phage(gi169257222) 1e-47 Click
471767274..1770315 PHAGE_Gifsy_1: bacteriophage tail tape measure protein; minor tail protein; Lambda gpH homolog; SeSPA_A1760; phage(gi169257221) 0.0 Click
481770318..1770647 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpM homolog; SeSPA_A1761; phage(gi169257220) 7e-61 Click
491770657..1771355 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpL homolog; SeSPA_A1762; phage(gi169257219) 9e-134 Click
501772138..1772644 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpI homolog; SeSPA_A1764; phage(gi169257217) 3e-91 Click
511772707..1776069 PHAGE_Gifsy_1: bacteriophage host specificity protein; tail fiber; Lambda gpJ homolog; SeSPA_A1765; phage(gi169257216) 0.0 Click
521776108..1776350 PHAGE_Gifsy_1: hypothetical protein STM2589.1n.Gifsy1; SeSPA_A1766; phage(gi169257215) 5e-39 Click
531776404..1778845 PHAGE_Gifsy_1: bacteriophage side tail fiber protein; Lambda gpSft (gpN) homolog; SeSPA_A1767; phage(gi169257214) 0.0 Click
541778845..1779429 PHAGE_Gifsy_1: bacteriophage side tail fiber assembly factor & structural component; Lambda gpTfa homolog; SeSPA_A1768; phage(gi169257212) 1e-99 Click
551785229..1785242 attR    TCTTCCCCAAAACT 0.0 Click

Region 4, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12412905..2412916 attL    TCACACAAAACA 0.0 Click
22417772..2418140 PHAGE_Entero_mEp235: integrase; SeSPA_A2447; phage(gi428781836) 5e-20 Click
32418265..2418287 attL    AAAAAGAGACCGAATACGATTCC 0.0 Click
42418913..2419041 hypothetical protein; SeSPA_A2448 0.0 Click
52419434..2420348 protein PagO; SeSPA_A2449 0.0 Click
62420481..2420639 conserved hypothetical protein; SeSPA_A2450 0.0 Click
72420649..2421263 putative inner membrane protein; SeSPA_A2451 0.0 Click
82421751..2421897 conserved hypothetical protein; SeSPA_A2452 0.0 Click
9complement(2422411..2422536) arsenical pump membrane protein; SeSPA_A2453 0.0 Click
10complement(2423403..2424284) PHAGE_Gifsy_2: bacteriophage side tail fiber assembly protein; Lambda gpTfa analog; SeSPA_A2454; phage(gi169257321) 6e-70 Click
11complement(2424439..2424702) PHAGE_Gifsy_2: bacteriophage DNA packaging protein; terminase, small subunit; SeSPA_A2455; phage(gi169257298) 5e-17 Click
122424757..2424945 hypothetical protein; SeSPA_A2456 0.0 Click
132425010..2425177 conserved domain protein; SeSPA_A2457 0.0 Click
14complement(2425434..2425967) PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; SeSPA_A2458; phage(gi16765210) 5e-95 Click
152426282..2426935 PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; SeSPA_A2459; phage(gi169257272) 2e-16 Click
162426995..2427849 PHAGE_Entero_mEp235: integrase; SeSPA_A2460; phage(gi428781836) 1e-63 Click
172427980..2428002 attR    AAAAAGAGACCGAATACGATTCC 0.0 Click
18complement(2428223..2428576) PHAGE_Entero_PsP3: gp28; SeSPA_A2463; phage(gi41057381) 4e-08 Click
19complement(2428593..2429468) copper resistance protein D; SeSPA_A2464 0.0 Click
20complement(2429469..2429843) copper resistance protein CopC; SeSPA_A2465 0.0 Click
212429981..2430211 PHAGE_Pectob_ZF40: putative DNA polymerase; SeSPA_A2466; phage(gi422936677) 6e-17 Click
222430319..2430975 hydrolase, carbon-nitrogen family; SeSPA_A2467 0.0 Click
232430999..2431697 PHAGE_Cronob_vB_CsaM_GAP32: putative DNA polymerase III epsilon subunit; SeSPA_A2468; phage(gi414087193) 2e-15 Click
242444951..2444962 attR    TCACACAAAACA 0.0 Click

Region 5, total : 13 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13261413..3261424 attL    ATTTGATTAAAA 0.0 Click
23276187..3277062 PROPHAGE_Salmon_LT2: integrase; SeSPA_A3306; phage(gi16766072) 4e-168 Click
33277228..3279102 putative inner membrane protein; SeSPA_A3307 0.0 Click
4complement(3279362..3280684) putative inner membrane protein; SeSPA_A3308 0.0 Click
5complement(3280882..3281040) hypothetical protein; SeSPA_A3309 0.0 Click
63281282..3281293 attL    TAAAGAAATCAA 0.0 Click
7complement(3282814..3283080) PROPHAGE_Salmon_LT2: transposase; SeSPA_A3312; phage(gi16766077) 2e-44 Click
8complement(3284168..3286150) putative DNA/RNA helicase; SeSPA_A3313 0.0 Click
93286429..3286728 PROPHAGE_Escher_MG1655: IS3 transposase A; SeSPA_A3314; phage(gi226524700) 2e-41 Click
103286725..3287591 PROPHAGE_Escher_MG1655: IS3 transposase B; SeSPA_A3315; phage(gi16128284) 3e-145 Click
11complement(3288371..3288841) PHAGE_Salmon_SSU5: putative repressor of phase 1 flagellin; SeSPA_A3316; phage(gi390013956) 6e-13 Click
12complement(3288978..3290498) PHAGE_Escher_phiKT: tail fiber protein; SeSPA_A3317; phage(gi422936632) 1e-07 Click
133290590..3291162 PHAGE_Escher_D108: G region invertase; SeSPA_A3318; phage(gi281199698) 4e-67 Click
143292125..3293240 IroB; SeSPA_A3319 0.0 Click
153293321..3296974 PHAGE_Bacill_SPBc2: ABC transporter; SeSPA_A3320; phage(gi9630145) 2e-25 Click
163306949..3306960 attR    TAAAGAAATCAA 0.0 Click
173308034..3308045 attR    ATTTGATTAAAA 0.0 Click