Escherichia coli O111:H- DNA, genomic island GEI2.43. [asmbl_id: NC_000000].57074, GC%: 51.95%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 51 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(12354..13466) PHAGE_Parame_bursaria_Chlorella_virus_1_NC_000852: hypothetical protein; -; phage(gi9631622) 2e-13 Click
213468..13487 attL    TTTTCATCAACAAGGATTTT 0.0 Click
3complement(13671..14675) PHAGE_Salmon_SP_004_NC_021774: integrase; -; phage(gi526003641) 1e-96 Click
4complement(14772..15146) PHAGE_Salmon_SP_004_NC_021774: hypothetical protein; -; phage(gi526003642) 3e-16 Click
515206..15493 PHAGE_Salmon_SP_004_NC_021774: Cox; -; phage(gi526003643) 7e-19 Click
615500..15706 predicted protein; - 0.0 Click
715959..16300 predicted protein; - 0.0 Click
816311..16598 predicted protein; - 0.0 Click
916610..16852 predicted protein; - 0.0 Click
1017049..17252 predicted protein; - 0.0 Click
1117249..17494 predicted protein; - 0.0 Click
1217491..17790 PHAGE_Entero_c_1_NC_019706: hypothetical protein; -; phage(gi428781768) 2e-07 Click
1317802..18419 PHAGE_Entero_mEp460_NC_019716: regulatory protein Rha; -; phage(gi428782357) 1e-09 Click
1418416..18781 predicted protein; - 0.0 Click
1518788..21610 PHAGE_Salmon_SP_004_NC_021774: putative replication protein; -; phage(gi526003650) 7e-77 Click
1621687..22646 predicted partitioning protein; - 0.0 Click
1722651..22962 predicted partitioning protein; - 0.0 Click
1823327..23596 predicted protein; - 0.0 Click
19complement(24083..25129) PHAGE_Erwini_ENT90_NC_019932: phage portal protein; -; phage(gi431810941) 4e-91 Click
20complement(25129..26880) PHAGE_Burkho_KS5_NC_015265: gp42; -; phage(gi327198040) 5e-139 Click
2127035..27871 PHAGE_Salmon_RE_2010_NC_019488: capsid scaffolding protein; -; phage(gi418489698) 7e-46 Click
2227895..28947 PHAGE_Erwini_ENT90_NC_019932: major capsid protein; -; phage(gi431810940) 6e-75 Click
2328993..29793 PHAGE_Ralsto_phiRSA1_NC_009382: terminase; -; phage(gi145708083) 2e-35 Click
2429896..30390 PHAGE_Burkho_phiE12_2_NC_009236: gp50, phage head completion protein (GPL); -; phage(gi134288689) 1e-25 Click
2530390..30590 PHAGE_Salmon_SP_004_NC_021774: phage tail protein; -; phage(gi526003620) 1e-11 Click
2630593..30916 PHAGE_Aeromo_phiO18P_NC_009542: putative holin; -; phage(gi148727161) 2e-09 Click
2730913..31305 PHAGE_Entero_phiP27_NC_003356: putative endolysin; -; phage(gi18249894) 2e-52 Click
2831302..31709 predicted protein; - 0.0 Click
2931540..31860 PHAGE_Acyrth_pisum_secondary_endosymbiont_1_NC_000935: hypothetical protein APSE-1_16; -; phage(gi9633563) 9e-09 Click
3031847..32314 PHAGE_Entero_fiAA91_ss_NC_022750: tail completion protein; -; phage(gi557307596) 7e-20 Click
3132307..32942 PHAGE_Pseudo_phiCTX_NC_003278: predicted tail completion; -; phage(gi17313233) 2e-19 Click
3232954..33520 PHAGE_Salmon_SP_004_NC_021774: phage baseplate assembly protein; -; phage(gi526003627) 7e-45 Click
3333517..33867 PHAGE_Salmon_SP_004_NC_021774: baseplate wedge subunit; -; phage(gi526003628) 1e-21 Click
3433871..34767 PHAGE_Salmon_SP_004_NC_021774: baseplate assembly protein; -; phage(gi526003629) 2e-86 Click
3534760..35368 PHAGE_Salmon_RE_2010_NC_019488: tail protein I; -; phage(gi418489712) 3e-63 Click
3635365..37455 PHAGE_Entero_Mu_NC_000929: tail fiber fragment; -; phage(gi19584574) 0.0 Click
3737458..37991 PHAGE_Escher_D108_NC_013594: tail fiber assembly protein; -; phage(gi281199696) 1e-98 Click
38complement(38020..38547) PHAGE_Escher_D108_NC_013594: probable tail fiber assembly protein; -; phage(gi281199695) 7e-81 Click
39complement(38549..39016) PHAGE_Salmon_SP_004_NC_021774: phage tail fiber protein; -; phage(gi526003631) 9e-15 Click
40complement(38991..39896) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; -; phage(gi16130763) 4e-178 Click
41complement(39854..40219) PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; -; phage(gi17546153) 6e-45 Click
42complement(40308..40727) PHAGE_Entero_phiP27_NC_003356: putative tail fiber protein; -; phage(gi18249918) 3e-39 Click
4340853..41443 PHAGE_Escher_D108_NC_013594: G region invertase; -; phage(gi281199698) 6e-85 Click
44complement(41472..41966) PHAGE_Salmon_SP_004_NC_021774: hypothetical protein; -; phage(gi526003637) 1e-32 Click
45complement(41973..44786) PHAGE_Salmon_SP_004_NC_021774: phage tail tape measure protein; -; phage(gi526003636) 2e-110 Click
46complement(44937..45311) PHAGE_Burkho_ST79_NC_021343: phage tail protein E; -; phage(gi509141648) 2e-08 Click
47complement(45367..45879) PHAGE_Salmon_SP_004_NC_021774: major tail tube protein; -; phage(gi526003634) 8e-31 Click
48complement(45879..47063) PHAGE_Salmon_SP_004_NC_021774: major tail sheath protein; -; phage(gi526003633) 6e-98 Click
4947220..48329 PHAGE_Entero_Fels_2_NC_010463: P2 gpD-like tail protein; -; phage(gi169936019) 6e-99 Click
50complement(48450..49472) predicted protein; - 0.0 Click
5149664..49924 PHAGE_Salmon_SP_004_NC_021774: Ogr; -; phage(gi526003639) 1e-06 Click
5250115..50255 PHAGE_Escher_P13374_NC_018846: prophage host toxic membrane protein; -; phage(gi410491667) 6e-16 Click
5351894..51913 attR    TTTTCATCAACAAGGATTTT 0.0 Click