Haemophilus influenzae PittII whole genome shotgun [asmbl_id: NC_000000].1954291, GC%: 38.01%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 38 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1838834..838845 attL    AAATATTGCCAT 0.0 Click
2838982..839080 PHAGE_Mannhe_phiMHaA1: integrase; CGSHiII_02220; phage(gi109289985) 9e-06 Click
3complement(839152..839355) hypothetical protein; CGSHiII_02225 0.0 Click
4complement(839397..839516) hypothetical protein; CGSHiII_02230 0.0 Click
5839651..839821 hypothetical protein; CGSHiII_02235 0.0 Click
6complement(839660..839911) PHAGE_Escher_TL_2011c: putative antirepressor; CGSHiII_02240; phage(gi418487055) 3e-19 Click
7complement(840249..841520) PHAGE_Amsact_: hypothetical protein AMV156; CGSHiII_02245; phage(gi9964470) 6e-06 Click
8842121..842324 hypothetical protein; CGSHiII_02250 0.0 Click
9complement(842302..842460) PHAGE_Aggreg_S1249: hypothetical protein; CGSHiII_02255; phage(gi273809595) 4e-05 Click
10complement(842788..843009) hypothetical protein; CGSHiII_02260 0.0 Click
11843024..843194 hypothetical protein; CGSHiII_02265 0.0 Click
12complement(843509..843724) hypothetical protein; CGSHiII_02270 0.0 Click
13complement(843778..843939) hypothetical protein; CGSHiII_02275 0.0 Click
14complement(843936..844271) hypothetical protein; CGSHiII_02280 0.0 Click
15complement(844274..845353) hypothetical protein; CGSHiII_02285 0.0 Click
16complement(845405..846103) PHAGE_Haemop_Aaphi23: putative CI protein; CGSHiII_02290; phage(gi31544010) 8e-114 Click
17846214..846402 PHAGE_Aggreg_S1249: phage protein; CGSHiII_02295; phage(gi273809591) 6e-05 Click
18846451..846891 PHAGE_Entero_mEp390: hypothetical protein; CGSHiII_02300; phage(gi428782704) 4e-14 Click
19846938..847606 PHAGE_Aggreg_S1249: uncharacterized phage-encoded protein; CGSHiII_02305; phage(gi273809589) 2e-59 Click
20847603..848301 PHAGE_Aggreg_S1249: replication protein; CGSHiII_02310; phage(gi273809588) 2e-64 Click
21848298..848918 PHAGE_Stx2_c_I: P protein; CGSHiII_02315; phage(gi20065922) 2e-16 Click
22848915..849139 hypothetical protein; CGSHiII_02320 0.0 Click
23849176..849595 PHAGE_Aggreg_S1249: putative recombination protein NinB; CGSHiII_02325; phage(gi273809585) 3e-58 Click
24849592..849684 hypothetical protein; CGSHiII_02330 0.0 Click
25849684..850250 PHAGE_Aggreg_S1249: NinG recombination protein; CGSHiII_02335; phage(gi273809581) 5e-37 Click
26850234..850899 PHAGE_Thalas_BA3: hypothetical protein BA3_0046; CGSHiII_02340; phage(gi160700640) 4e-36 Click
27850930..851301 hypothetical protein; CGSHiII_02345 0.0 Click
28complement(851351..852316) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF33; CGSHiII_02350; phage(gi157166018) 2e-94 Click
29852675..853316 PHAGE_Aggreg_S1249: possible bacteriophage antirepressor; CGSHiII_02355; phage(gi273809598) 4e-35 Click
30853397..853534 hypothetical protein; CGSHiII_02360 0.0 Click
31853658..854014 PHAGE_Aeromo_phiO18P: putative holin; CGSHiII_02365; phage(gi148727161) 1e-05 Click
32853992..854564 PHAGE_Aggreg_S1249: putative Lys protein; CGSHiII_02370; phage(gi273809575) 5e-57 Click
33854814..855095 PHAGE_Aggreg_S1249: putative lytic protein Rz1; CGSHiII_02375; phage(gi273809573) 3e-28 Click
34855134..855619 PHAGE_Acinet_AP22: putative phage terminase small subunit; CGSHiII_02380; phage(gi388570782) 6e-22 Click
35855839..856978 PHAGE_Psychr_pOW20_A: phage terminase large subunit; CGSHiII_02385; phage(gi472339822) 1e-87 Click
36856980..858311 PHAGE_Aggreg_S1249: phage-related protein HI1409; CGSHiII_02390; phage(gi273809569) 0.0 Click
37858340..859047 PHAGE_Aggreg_S1249: putative minor head protein; CGSHiII_02395; phage(gi273809568) 3e-90 Click
38859083..859520 PHAGE_Rhodov_RS1: hypothetical protein; CGSHiII_02400; phage(gi472342909) 6e-06 Click
39859661..859837 PHAGE_Aggreg_S1249: hypothetical protein; CGSHiII_02405; phage(gi273809565) 4e-24 Click
40874070..874081 attR    AAATATTGCCAT 0.0 Click

Region 2, total : 39 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11354004..1354016 attL    CATAAAAGAAAAT 0.0 Click
2complement(1364405..1364482) PHAGE_Haemop_HP2: tail fibers; CGSHiII_09598; phage(gi17981847) 3e-06 Click
3complement(1364479..1366704) PHAGE_Haemop_HP2: tail fibers; CGSHiII_09603; phage(gi17981847) 0.0 Click
4complement(1366728..1367255) PHAGE_Haemop_HP2: orf30; CGSHiII_09608; phage(gi17981846) 9e-100 Click
5complement(1367265..1368434) PHAGE_Haemop_HP2: orf29; CGSHiII_09613; phage(gi17981845) 0.0 Click
6complement(1368427..1368762) PHAGE_Haemop_HP2: orf28; CGSHiII_09618; phage(gi17981844) 9e-56 Click
7complement(1368766..1370895) PHAGE_Haemop_HP2: orf27; CGSHiII_09623; phage(gi17981843) 0.0 Click
8complement(1370905..1371075) PHAGE_Pasteu_F108: hypothetical protein F108p32; CGSHiII_09628; phage(gi109302928) 6e-20 Click
9complement(1371084..1371392) PHAGE_Haemop_HP2: orf26; CGSHiII_09633; phage(gi17981842) 7e-51 Click
10complement(1371587..1371934) PHAGE_Haemop_HP2: orf25; CGSHiII_09638; phage(gi17981841) 4e-61 Click
11complement(1371919..1372479) PHAGE_Haemop_HP2: lys; CGSHiII_09643; phage(gi17981840) 1e-101 Click
12complement(1372472..1372708) PHAGE_Haemop_HP2: hol; CGSHiII_09648; phage(gi17981839) 2e-38 Click
13complement(1372795..1373247) PHAGE_Haemop_HP2: tail tube; CGSHiII_09653; phage(gi17981838) 9e-78 Click
14complement(1373251..1374381) PHAGE_Haemop_HP2: tail sheath; CGSHiII_09658; phage(gi17981837) 0.0 Click
15complement(1374416..1374574) hypothetical protein; CGSHiII_09663 0.0 Click
16complement(1374653..1375348) PHAGE_Haemop_HP2: orf22; CGSHiII_09668; phage(gi17981836) 2e-131 Click
17complement(1375338..1375823) PHAGE_Haemop_HP2: orf21; CGSHiII_09673; phage(gi17981835) 1e-91 Click
18complement(1375811..1376263) PHAGE_Haemop_HP2: packaging protein; CGSHiII_09678; phage(gi17981834) 4e-81 Click
19complement(1376256..1377101) PHAGE_Haemop_HP2: packaging protein; CGSHiII_09683; phage(gi17981833) 3e-158 Click
20complement(1377115..1378125) PHAGE_Haemop_HP2: capsid; CGSHiII_09688; phage(gi17981832) 0.0 Click
21complement(1378128..1379021) PHAGE_Haemop_HP2: scaffold; CGSHiII_09693; phage(gi17981831) 8e-171 Click
221379160..1381049 PHAGE_Haemop_HP2: terminase; CGSHiII_09698; phage(gi17981830) 0.0 Click
231381039..1382076 PHAGE_Haemop_HP2: orf15; CGSHiII_09703; phage(gi17981829) 0.0 Click
241382192..1382293 hypothetical protein; CGSHiII_09708 0.0 Click
25complement(1382442..1382843) PHAGE_Haemop_HP2: hypothetical protein HP2p14; CGSHiII_09713; phage(gi17981828) 1e-72 Click
26complement(1382872..1383048) PHAGE_Haemop_HP2: hypothetical protein HP2p13; CGSHiII_09718; phage(gi19289355) 3e-29 Click
27complement(1383144..1383662) PHAGE_Haemop_HP2: dam; CGSHiII_09723; phage(gi17981827) 5e-102 Click
28complement(1383672..1383983) PHAGE_Haemop_HP2: hypothetical protein HP2p11; CGSHiII_09728; phage(gi17981826) 1e-53 Click
29complement(1383995..1386322) PHAGE_Haemop_HP2: rep; CGSHiII_09733; phage(gi17981825) 0.0 Click
30complement(1386325..1386585) PHAGE_Haemop_HP2: hypothetical protein HP2p09; CGSHiII_09738; phage(gi17981824) 1e-46 Click
31complement(1386636..1386917) PHAGE_Haemop_HP2: hypothetical protein HP2p08; CGSHiII_09743; phage(gi17981823) 1e-47 Click
32complement(1386929..1387114) PHAGE_Haemop_HP2: hypothetical protein HP2p07; CGSHiII_09748; phage(gi17981822) 5e-33 Click
33complement(1387114..1387482) PHAGE_Haemop_HP2: hypothetical protein HP2p06; CGSHiII_09753; phage(gi17981821) 2e-69 Click
34complement(1388140..1388352) PHAGE_Haemop_HP2: orf2(S)cox; CGSHiII_09758; phage(gi17981819) 5e-33 Click
351388471..1389046 PHAGE_Haemop_HP2: cI repressor; CGSHiII_09763; phage(gi17981818) 4e-109 Click
361389046..1389228 hypothetical protein; CGSHiII_09768 0.0 Click
371389238..1390002 PHAGE_Haemop_HP2: hypothetical protein HP2p02; CGSHiII_09773; phage(gi17981817) 5e-144 Click
381389717..1389729 attR    CATAAAAGAAAAT 0.0 Click
391390002..1391015 PHAGE_Haemop_HP2: integrase; CGSHiII_09778; phage(gi17981816) 0.0 Click
401391306..1392142 PHAGE_Yersin_PY54: partitioning protein SpyA; CGSHiII_09783; phage(gi33770537) 8e-08 Click
411392144..1393499 PHAGE_Entero_P1: Ban; CGSHiII_09788; phage(gi46401697) 7e-98 Click

Region 3, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11746760..1746771 attL    ATTTTCCAAAGC 0.0 Click
2complement(1746857..1748104) PROPHAGE_Escher_MG1655: CP4-57 prophage; integrase; CGSHiII_00397; phage(gi16130540) 2e-85 Click
3complement(1748346..1748422) tRNA 0.0 Click
41748651..1750087 pyruvate kinase; CGSHiII_00402 0.0 Click
51750229..1751635 PHAGE_Entero_P1: Ban; CGSHiII_00407; phage(gi46401697) 9e-173 Click
61751645..1752727 alanine racemase; CGSHiII_00412 0.0 Click
71752824..1754473 glucose-6-phosphate isomerase; CGSHiII_00417 0.0 Click
81754547..1754711 insertion element IS1016 transposase; CGSHiII_00422 0.0 Click
91754714..1755040 PROPHAGE_Neisse_MC58: IS1016C2 transposase; CGSHiII_00427; phage(gi15677262) 2e-09 Click
101755120..1756091 PHAGE_Staphy_phiN315: probable ss-1,3-N-acetylglucosaminyltransferase; CGSHiII_00432; phage(gi30043988) 1e-06 Click
11complement(1756278..1756742) PHAGE_Lactoc_lato: putative tail lysin; CGSHiII_00437; phage(gi30089904) 6e-05 Click
12complement(1756768..1757019) glucose-6-phosphate isomerase; CGSHiII_00442 0.0 Click
13complement(1757056..1757637) hypothetical protein; CGSHiII_00447 0.0 Click
141757717..1759462 PHAGE_Acanth_mimivirus: arginyl-tRNA synthetase; CGSHiII_00452; phage(gi311978065) 5e-80 Click
15complement(1759743..1760234) acetolactate synthase 3 regulatory subunit; CGSHiII_00457 0.0 Click
16complement(1760234..1761343) PHAGE_Ostreo_2: putative acetolactate synthase large subunit; CGSHiII_00462; phage(gi314055125) 5e-29 Click
17complement(1761294..1761956) PHAGE_Ostreo_2: putative acetolactate synthase large subunit; CGSHiII_00467; phage(gi314055125) 6e-20 Click
181763028..1763039 attR    ATTTTCCAAAGC 0.0 Click

Region 4, total : 47 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11803339..1803384 attL    CTCCAAAACCGGGTGTTGGGAGTTCGAGCCTCTCCGCCCCTGCCAT 0.0 Click
2complement(1803401..1804315) PHAGE_Burkho_phiE202: gp10, site-specific recombinase, phage integrase family; CGSHiII_06923; phage(gi134288747) 1e-44 Click
3complement(1804366..1804698) hypothetical protein; CGSHiII_06928 0.0 Click
4complement(1804695..1805216) PHAGE_Haemop_HP1: putative DNA binding protein; CGSHiII_06933; phage(gi9628616) 2e-69 Click
5complement(1805230..1805439) PHAGE_Haemop_HP1: hypothetical protein HP1p15; CGSHiII_06938; phage(gi9628615) 4e-30 Click
6complement(1805450..1805641) hypothetical protein; CGSHiII_06943 0.0 Click
7complement(1805660..1807843) PHAGE_Mannhe_phiMHaA1: replication protein A; CGSHiII_06948; phage(gi109289978) 2e-81 Click
8complement(1807856..1808164) hypothetical protein; CGSHiII_06953 0.0 Click
9complement(1808180..1808293) hypothetical protein; CGSHiII_06958 0.0 Click
10complement(1808290..1808532) hypothetical protein; CGSHiII_06963 0.0 Click
11complement(1808536..1808916) PHAGE_Haemop_HP1: hypothetical protein HP1p09; CGSHiII_06968; phage(gi9628609) 2e-15 Click
12complement(1808934..1809194) hypothetical protein; CGSHiII_06973 0.0 Click
13complement(1809286..1809576) hypothetical protein; CGSHiII_06978 0.0 Click
14complement(1809942..1810181) PHAGE_Salmon_ST160: Cro; CGSHiII_06983; phage(gi318065926) 2e-10 Click
151810317..1811024 PHAGE_Mannhe_phiMHaA1: CI repressor; CGSHiII_06988; phage(gi109289970) 1e-32 Click
161811036..1811542 PHAGE_Mannhe_phiMHaA1: hypothetical protein MhaA1p34; CGSHiII_06993; phage(gi109289969) 9e-38 Click
171811539..1811778 PHAGE_Mannhe_phiMHaA1: hypothetical protein MhaA1p32; CGSHiII_06998; phage(gi109289967) 1e-11 Click
18complement(1811804..1812997) PHAGE_Mannhe_phiMHaA1: tail protein D; CGSHiII_07003; phage(gi109289965) 4e-109 Click
19complement(1812997..1813434) PHAGE_Mannhe_phiMHaA1: tail protein U; CGSHiII_07008; phage(gi109289964) 1e-42 Click
20complement(1813602..1813748) PHAGE_Burkho_KS5: gp17; CGSHiII_07013; phage(gi327198015) 4e-10 Click
21complement(1813748..1814047) PHAGE_Mannhe_phiMHaA1: tail protein E; CGSHiII_07018; phage(gi109289962) 2e-12 Click
22complement(1814131..1814637) PHAGE_Mannhe_phiMHaA1: tail tube protein FII; CGSHiII_07023; phage(gi109289961) 5e-54 Click
23complement(1814641..1815825) PROPHAGE_Salmon_Ty2: major tail sheath protein; CGSHiII_07028; phage(gi29143758) 5e-103 Click
24complement(1815970..1816449) PHAGE_Haemop_SuMu: enoyl-CoA hydratase/carnithine racemase-like protein; CGSHiII_07033; phage(gi418489075) 3e-46 Click
25complement(1816442..1816993) PHAGE_Haemop_HP2: tail collar; CGSHiII_07038; phage(gi17981848) 9e-47 Click
26complement(1817004..1819481) PHAGE_Mannhe_phiMHaA1: variable tail fiber protein H; CGSHiII_07043; phage(gi109289958) 3e-41 Click
27complement(1819490..1820029) PHAGE_Mannhe_phiMHaA1: tail formation protein I; CGSHiII_07048; phage(gi109289957) 2e-51 Click
28complement(1820016..1820930) PHAGE_Mannhe_phiMHaA1: baseplate assembly protein J; CGSHiII_07053; phage(gi109289956) 1e-97 Click
29complement(1820927..1821265) PHAGE_Mannhe_phiMHaA1: baseplate assembly protein W; CGSHiII_07058; phage(gi109289955) 5e-21 Click
30complement(1821267..1821866) PHAGE_Mannhe_phiMHaA1: baseplate assembly protein V; CGSHiII_07063; phage(gi109289954) 5e-63 Click
31complement(1821970..1822398) hypothetical protein; CGSHiII_07068 0.0 Click
32complement(1822407..1822961) hypothetical protein; CGSHiII_07073 0.0 Click
33complement(1823063..1825798) PHAGE_Vibrio_vB_VpaM_MAR: tail length tape-measure protein; CGSHiII_07078; phage(gi428782750) 1e-122 Click
341825867..1826139 hypothetical protein; CGSHiII_07083 0.0 Click
35complement(1826117..1826575) PHAGE_Mannhe_phiMHaA1: tail synthesis protein S; CGSHiII_07088; phage(gi109289949) 2e-27 Click
36complement(1826575..1827045) PROPHAGE_Salmon_Ty2: putative phage tail protein; CGSHiII_07093; phage(gi29143748) 2e-31 Click
37complement(1827042..1827257) PHAGE_Mannhe_phiMHaA1: hypothetical protein MhaA1p11; CGSHiII_07098; phage(gi109289947) 1e-13 Click
38complement(1827432..1827782) PHAGE_Haemop_HP1: hypothetical protein HP1p32; CGSHiII_07103; phage(gi9628631) 7e-05 Click
39complement(1827767..1828285) PHAGE_Mannhe_phiMHaA1: endolysin; CGSHiII_07108; phage(gi109289945) 2e-38 Click
40complement(1828278..1828499) PHAGE_Mannhe_phiMHaA1: possible holin; CGSHiII_07113; phage(gi109289944) 7e-05 Click
41complement(1828501..1828710) PHAGE_Mannhe_phiMHaA1: tail synthesis protein X; CGSHiII_07118; phage(gi109289943) 1e-11 Click
42complement(1828710..1829216) PHAGE_Mannhe_phiMHaA1: head completion protein L; CGSHiII_07123; phage(gi109289942) 5e-36 Click
43complement(1829510..1829656) predicted terminase, endonuclease subunit; CGSHiII_07128 0.0 Click
44complement(1829673..1830161) PHAGE_Mannhe_phiMHaA1: terminase small subunit; CGSHiII_07133; phage(gi109289941) 2e-33 Click
45complement(1830173..1831222) PHAGE_Mannhe_phiMHaA1: major capsid protein N; CGSHiII_07138; phage(gi109289940) 3e-91 Click
46complement(1831243..1832067) PHAGE_Mannhe_phiMHaA1: capsid scaffolding protein O; CGSHiII_07143; phage(gi109289939) 5e-74 Click
471832232..1834007 PHAGE_Mannhe_phiMHaA1: terminase ATPase subunit; CGSHiII_07148; phage(gi109289938) 0.0 Click
481834017..1835027 PHAGE_Mannhe_phiMHaA1: capsid portal protein Q; CGSHiII_07153; phage(gi109289937) 3e-118 Click
491835527..1835572 attR    CTCCAAAACCGGGTGTTGGGAGTTCGAGCCTCTCCGCCCCTGCCAT 0.0 Click

Region 5, total : 30 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11871913..1872494 PHAGE_Entero_mEp213: DNA N-6-adenine-methyltransferase (Dam); CGSHiII_00132; phage(gi428782650) 3e-20 Click
21872484..1872900 PHAGE_Aggreg_S1249: putative recombination protein NinB; CGSHiII_00137; phage(gi273809585) 8e-50 Click
31872901..1872993 hypothetical protein; CGSHiII_00142 0.0 Click
41872993..1873538 PHAGE_Entero_mEp213: NinG protein; CGSHiII_00147; phage(gi428782653) 1e-42 Click
51873539..1874057 PHAGE_Escher_HK639: Q antitermination protein; CGSHiII_00152; phage(gi356870666) 3e-20 Click
61874297..1874653 PHAGE_Aeromo_phiO18P: putative holin; CGSHiII_00157; phage(gi148727161) 1e-05 Click
71874631..1875224 PHAGE_Haemop_Aaphi23: putative Lys protein; CGSHiII_00162; phage(gi31544025) 1e-56 Click
81875235..1875540 PHAGE_Aggreg_S1249: putative lytic protein Rz; CGSHiII_00167; phage(gi273809574) 1e-24 Click
91875452..1875733 PHAGE_Haemop_Aaphi23: putative lytic protein Rz1; CGSHiII_00172; phage(gi44829137) 2e-34 Click
101876004..1876477 PHAGE_Entero_mEp213: terminase small subunit; CGSHiII_00177; phage(gi428782590) 5e-42 Click
111876480..1878603 PHAGE_Entero_mEp213: terminase large subunit; CGSHiII_00182; phage(gi428782591) 0.0 Click
121878600..1878818 hypothetical protein; CGSHiII_00187 0.0 Click
131878822..1880345 PHAGE_Gifsy_2: bacteriophage portal protein; CGSHiII_00192; phage(gi169257301) 2e-165 Click
141880281..1882323 PHAGE_Entero_mEp213: head maturation protease; CGSHiII_00197; phage(gi428782594) 0.0 Click
151882402..1882725 PHAGE_Entero_mEp213: hypothetical protein; CGSHiII_00202; phage(gi428782595) 1e-14 Click
161882706..1883011 hypothetical protein; CGSHiII_00207 0.0 Click
171883011..1883556 PHAGE_Entero_mEp237: minor tail protein Z; CGSHiII_00212; phage(gi435439275) 2e-36 Click
181883553..1883957 PHAGE_Entero_mEp213: tail protein U; CGSHiII_00217; phage(gi428782598) 3e-15 Click
191883950..1884450 PHAGE_Entero_mEp213: minor tail protein V; CGSHiII_00222; phage(gi428782599) 1e-40 Click
201884456..1884839 hypothetical protein; CGSHiII_00227 0.0 Click
211884914..1885207 hypothetical protein; CGSHiII_00232 0.0 Click
221885149..1887527 PHAGE_Synech_S_CBS3: tail tape measure protein; CGSHiII_00237; phage(gi331028021) 2e-26 Click
231887528..1887872 PHAGE_Gifsy_1: bacteriophage tail tip assembly protein; Lambda gpM homolog; CGSHiII_00242; phage(gi169257220) 2e-20 Click
241887934..1888467 PHAGE_Clostr_phiCD38_2: hypothetical protein; CGSHiII_00247; phage(gi333798122) 3e-07 Click
251888944..1889063 hypothetical protein; CGSHiII_00252 0.0 Click
261889204..1889854 PHAGE_Salmon_SSU5: putative minor tail protein L; CGSHiII_00257; phage(gi410491427) 1e-39 Click
271889856..1890563 PHAGE_Burkho_phiE125: putative tail component protein; CGSHiII_00262; phage(gi17975180) 5e-50 Click
281890544..1891221 PHAGE_Escher_HK639: tail assembly protein; CGSHiII_00267; phage(gi356870622) 2e-36 Click
291891225..1894875 PHAGE_Burkho_phiE125: putative tail tip fiber protein; CGSHiII_00272; phage(gi17975182) 7e-141 Click
301894886..1895965 PHAGE_Haemop_HP2: tail fibers; CGSHiII_00277; phage(gi17981847) 1e-128 Click

Region 6, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11916523..1916536 attL    TAAATTTGCCTTAT 0.0 Click
2complement(1921633..1922856) PHAGE_Burkho_phi1026b: gp59; CGSHiII_09548; phage(gi38707949) 4e-16 Click
3complement(1923104..1924054) PHAGE_Lactoc_P087: putative cysteine synthase; CGSHiII_09553; phage(gi229605000) 2e-69 Click
4complement(1924153..1924971) putative sulfate transport protein CysZ; CGSHiII_09558 0.0 Click
5complement(1925037..1925696) PHAGE_Megavi_chiliensis: putative Sel1-like repeat-containing protein; CGSHiII_00664; phage(gi363540607) 1e-19 Click
6complement(1925708..1925884) hypothetical protein; CGSHiII_00669 0.0 Click
7complement(1925884..1926330) PHAGE_Megavi_chiliensis: putative Sel1-like repeat-containing protein; CGSHiII_00674; phage(gi363539854) 6e-10 Click
8complement(1926532..1927068) hypothetical protein; CGSHiII_00679 0.0 Click
91927206..1927219 attL    TAATCGTTGATTTT 0.0 Click
10complement(1927330..1928037) PHAGE_Haemop_SuMu: MuF; CGSHiII_00684; phage(gi418489084) 8e-66 Click
11complement(1928049..1928420) PHAGE_Haemop_SuMu: portal protein gp29; CGSHiII_00689; phage(gi418489080) 4e-50 Click
121928465..1928623 PHAGE_Haemop_HP1: putative DNA binding protein; CGSHiII_00694; phage(gi9628616) 1e-19 Click
13complement(1928683..1929330) PHAGE_Mannhe_phiMHaA1: integrase; CGSHiII_00699; phage(gi109289985) 2e-67 Click
141929355..1929368 attR    TAATCGTTGATTTT 0.0 Click
15complement(1929367..1929684) PHAGE_Mannhe_phiMHaA1: integrase; CGSHiII_00704; phage(gi109289985) 2e-29 Click
16complement(1930278..1930532) PHAGE_Haemop_SuMu: enoyl-CoA hydratase/carnithine racemase-like protein; CGSHiII_00709; phage(gi418489075) 2e-27 Click
17complement(1930643..1930735) hypothetical protein; CGSHiII_00714 0.0 Click
18complement(1930732..1930902) PHAGE_Haemop_HP2: tail collar; CGSHiII_00719; phage(gi17981848) 3e-24 Click
191931233..1931593 PROPHAGE_Escher_Sakai: putative ATP-dependent protease; CGSHiII_09563; phage(gi15833954) 2e-24 Click
20complement(1931626..1932297) deoxyribose-phosphate aldolase; CGSHiII_09568 0.0 Click
211932408..1932911 deoxyribose-phosphate aldolase; CGSHiII_09573 0.0 Click
221932964..1933890 PHAGE_Synech_S_SM2: putative nucleotide-sugar epimerase; CGSHiII_09578; phage(gi326781947) 5e-37 Click
231936984..1936997 attR    TAAATTTGCCTTAT 0.0 Click