Yersinia pestis biovar Antiqua str. E1979001 , [asmbl_id: NC_000000].4847813, GC%: 47.69%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 50 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11425515..1425545 attL    ATATTGAATAAGCCGAGTTGGGCTAAATAAC 0.0 Click
2complement(1425571..1426809) PHAGE_Salmon_1: putative bacteriophage integrase; YpE1979001_0463; phage(gi169257156) 1e-125 Click
31426879..1427901 PROPHAGE_Escher_CFT073: transposase; YpE1979001_0464; phage(gi26248360) 0.0 Click
41427901..1428680 PROPHAGE_Escher_CFT073: transposase/IS protein; YpE1979001_0465; phage(gi26248359) 1e-142 Click
5complement(1429408..1430106) PHAGE_Pseudo_F116: DNA adenine methyltransferase; YpE1979001_0466; phage(gi56692911) 3e-53 Click
61430133..1430579 PHAGE_Cronob_ENT47670: putative ninB protein; YpE1979001_0467; phage(gi431810524) 5e-47 Click
71430653..1431258 PHAGE_Salmon_ST160: NinG; YpE1979001_0468; phage(gi318065938) 4e-43 Click
81431427..1431648 PHAGE_Escher_TL_2011c: putative late gene regulator Q; YpE1979001_0469; phage(gi418487066) 6e-18 Click
91431645..1431770 conserved hypothetical protein; YpE1979001_0470 0.0 Click
101431919..1432482 PHAGE_Salmon_SPN3UB: hypothetical protein; YpE1979001_0471; phage(gi423262398) 1e-29 Click
111432906..1433115 conserved hypothetical protein; YpE1979001_0472 0.0 Click
121433861..1434373 PHAGE_Cronob_phiES15: putative endolysin; YpE1979001_0473; phage(gi401817587) 2e-51 Click
131434358..1434816 PHAGE_Entero_cdtI: lysin; YpE1979001_0474; phage(gi148609441) 2e-24 Click
14complement(1434913..1435044) hypothetical protein; YpE1979001_0475 0.0 Click
151435362..1436075 PHAGE_Cronob_ENT47670: phage antirepressor protein; YpE1979001_0476; phage(gi431810509) 6e-50 Click
16complement(1436148..1436264) hypothetical protein; YpE1979001_0477 0.0 Click
171436532..1437167 PHAGE_Pectob_ZF40: putative transposase; YpE1979001_0478; phage(gi422936679) 3e-87 Click
181437198..1437647 PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; YpE1979001_0479; phage(gi399528759) 4e-51 Click
191437651..1438235 PHAGE_Cronob_phiES15: terminase large subunit; YpE1979001_0480; phage(gi401817592) 5e-65 Click
201438283..1439491 PROPHAGE_Escher_CFT073: transposase; YpE1979001_0481; phage(gi26246249) 0.0 Click
211439496..1440470 PHAGE_Cronob_phiES15: terminase large subunit; YpE1979001_0482; phage(gi401817592) 5e-144 Click
221441859..1442971 PHAGE_Cronob_phiES15: hypothetical protein; YpE1979001_0485; phage(gi401817594) 3e-123 Click
231443093..1443866 PHAGE_Xantho_Xp15: putative phage structural protein; YpE1979001_0486; phage(gi66392059) 1e-19 Click
241443880..1445085 PHAGE_Acinet_Bphi_B1251: major capsid protein; YpE1979001_0487; phage(gi423262007) 1e-113 Click
251445133..1445615 PHAGE_Cronob_phiES15: hypothetical protein; YpE1979001_0488; phage(gi401817598) 2e-23 Click
261445612..1445866 PHAGE_Salmon_SSU5: hypothetical protein; YpE1979001_0489; phage(gi410491538) 8e-20 Click
271445868..1446218 PHAGE_Cronob_phiES15: putative structural protein 2; YpE1979001_0490; phage(gi401817599) 5e-33 Click
281446220..1446804 PHAGE_Shigel_EP23: putative tail protein; YpE1979001_0491; phage(gi371496282) 2e-27 Click
291446801..1447208 PHAGE_Cronob_phiES15: hypothetical protein; YpE1979001_0492; phage(gi401817601) 1e-16 Click
301447274..1448194 PHAGE_Cronob_phiES15: putative major tail protein; YpE1979001_0493; phage(gi401817602) 3e-75 Click
311448207..1448518 PHAGE_Cronob_phiES15: hypothetical protein; YpE1979001_0494; phage(gi401817603) 9e-32 Click
321448827..1452330 PHAGE_Entero_mEp213: tail length tape measure protein; YpE1979001_0495; phage(gi428782602) 5e-152 Click
331452333..1452674 PHAGE_Cronob_phiES15: putative minor tail protein; YpE1979001_0496; phage(gi401817607) 1e-31 Click
341452928..1453437 PROPHAGE_Salmon_Ty2: transposase; YpE1979001_0497; phage(gi29143766) 6e-84 Click
351453558..1454310 PHAGE_Entero_HK225: minor tail protein; YpE1979001_0498; phage(gi428782393) 3e-101 Click
361454313..1455023 PHAGE_Entero_HK140: minor tail protein K; YpE1979001_0499; phage(gi428781957) 8e-109 Click
371455524..1455916 conserved hypothetical protein; YpE1979001_0500 0.0 Click
381456550..1456717 PHAGE_Escher_TL_2011b: hypothetical protein; YpE1979001_0501; phage(gi418487672) 6e-15 Click
391456791..1457798 PHAGE_Haemop_Aaphi23: putative antirepressor protein Ant; YpE1979001_0502; phage(gi31544021) 3e-37 Click
401458290..1458448 putative phage-related membrane protein; YpE1979001_0504 0.0 Click
41complement(1458420..1458539) hypothetical protein; YpE1979001_0503 0.0 Click
421458591..1458806 putative phage-related lipoprotein; YpE1979001_0505 0.0 Click
431458862..1459482 PHAGE_Entero_mEpX2: tail assembly protein; YpE1979001_0506; phage(gi428765633) 9e-66 Click
441459524..1459688 P10; YpE1979001_0507 0.0 Click
451460054..1463257 PHAGE_Cronob_phiES15: putative host specificity protein; YpE1979001_0508; phage(gi401817611) 0.0 Click
461463257..1464255 PHAGE_Cronob_phiES15: hypothetical protein; YpE1979001_0509; phage(gi401817612) 7e-25 Click
471464272..1465189 PHAGE_Salmon_SSU5: putative phage tail fiber protein; YpE1979001_0510; phage(gi410491431) 2e-09 Click
481465200..1465619 PHAGE_Bacter_2: tail fiber; YpE1979001_0511; phage(gi212499733) 2e-10 Click
491465616..1465771 conserved hypothetical protein; YpE1979001_0512 0.0 Click
50complement(1465840..1467048) PROPHAGE_Escher_CFT073: transposase; YpE1979001_0513; phage(gi26246249) 0.0 Click
511467239..1467269 attR    ATATTGAATAAGCCGAGTTGGGCTAAATAAC 0.0 Click
52complement(1468529..1469728) PHAGE_Africa_virus: NifS-like protein; YpE1979001_0515; phage(gi9628230) 4e-08 Click

Region 2, total : 7 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3308351..3309310) PHAGE_Lactob_phiAT3: putative transposase B; YpE1979001_4408; phage(gi48697274) 6e-15 Click
2complement(3309382..3309828) ISAfe5, transposase OrfA; YpE1979001_4409 0.0 Click
3complement(3309912..3310052) PHAGE_Entero_PsP3: gp21; YpE1979001_4410; phage(gi41057373) 1e-13 Click
4complement(3311732..3312031) PHAGE_Entero_PsP3: gp16; YpE1979001_4414; phage(gi41057368) 8e-25 Click
5complement(3312028..3312282) PHAGE_Entero_PsP3: gp15; YpE1979001_4415; phage(gi41057367) 9e-19 Click
63312418..3312690 PHAGE_Burkho_phiE202: gp6, pANL56; YpE1979001_4416; phage(gi134288760) 2e-12 Click
73312671..3312961 PHAGE_Burkho_phiE202: gp7, pANL12; YpE1979001_4417; phage(gi134288781) 3e-07 Click

Region 3, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14287800..4288096 PHAGE_Bacill_36: DNA-binding HU protein; YpE1979001_2715; phage(gi156564019) 9e-16 Click
24288231..4288740 PHAGE_Hypert_2: IS element Dka2 orfA; YpE1979001_2716; phage(gi300116744) 5e-15 Click
34289140..4289598 conserved hypothetical protein; YpE1979001_2717 0.0 Click
44289810..4290832 vitamin B12 import system permease protein BtuC; YpE1979001_2718 0.0 Click
54290902..4291456 PHAGE_Canary_virus: CNPV087 putative glutathione peroxidase; YpE1979001_2719; phage(gi40556025) 4e-18 Click
64291481..4292239 PHAGE_Plankt_PaV_LD: ABC transporter; YpE1979001_2720; phage(gi371496158) 1e-07 Click
74292589..4293743 PHAGE_Ostreo_1: hypothetical protein H665_p041; YpE1979001_2721; phage(gi260665911) 1e-19 Click
84293730..4294713 PHAGE_Salmon_ST160: GtrB; YpE1979001_2722; phage(gi318065903) 3e-40 Click
94294710..4296713 PHAGE_Campyl_CP21: putative NAD-dependent epimerase/dehydratase; YpE1979001_2723; phage(gi422935198) 3e-11 Click

Region 4, total : 28 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14585919..4587004 PHAGE_Salmon_SSU5: putative exonuclease subunit 1; YpE1979001_2038; phage(gi410491483) 0.0 Click
24587267..4589150 PHAGE_Salmon_SSU5: putative exonuclease subunit 2; YpE1979001_2039; phage(gi410491485) 0.0 Click
34589140..4589886 PHAGE_Salmon_SSU5: hypothetical protein; YpE1979001_2040; phage(gi410491486) 4e-138 Click
44590626..4591135 PROPHAGE_Salmon_Ty2: transposase; YpE1979001_2042; phage(gi29143766) 6e-84 Click
54591335..4591616 PHAGE_Salmon_SSU5: hypothetical protein; YpE1979001_2043; phage(gi410491525) 5e-48 Click
6complement(4591672..4591863) hypothetical protein; YpE1979001_2044 0.0 Click
74591822..4592304 PHAGE_Salmon_SSU5: hypothetical protein; YpE1979001_2045; phage(gi410491527) 3e-86 Click
84592822..4592965 PHAGE_Salmon_SSU5: hypothetical protein; YpE1979001_2046; phage(gi410491528) 4e-17 Click
9complement(4593255..4593905) PHAGE_Salmon_SSU5: hypothetical protein; YpE1979001_2047; phage(gi410491530) 5e-118 Click
104593962..4594099 hypothetical protein; YpE1979001_2048 0.0 Click
11complement(4594227..4594355) PHAGE_Salmon_SSU5: putative repressor of phase 1 flagellin; YpE1979001_2049; phage(gi410491531) 2e-17 Click
12complement(4594759..4595181) PHAGE_Salmon_SSU5: putative lipoprotein; YpE1979001_2050; phage(gi410491532) 4e-65 Click
13complement(4595241..4595519) PHAGE_Salmon_SSU5: hypothetical protein; YpE1979001_2051; phage(gi410491533) 1e-44 Click
14complement(4595522..4597081) PHAGE_Salmon_SSU5: putative helicase; YpE1979001_2052; phage(gi410491534) 0.0 Click
154597164..4597844 PHAGE_Salmon_SSU5: putative ParB-like nuclease domain-containing protein; YpE1979001_2053; phage(gi410491535) 6e-124 Click
164597844..4598512 PHAGE_Salmon_SSU5: putative ParB-like nuclease domain-containing protein; YpE1979001_2054; phage(gi410491536) 8e-118 Click
174598509..4599147 PHAGE_Salmon_SSU5: putative ABC transporter ATP-binding protein; YpE1979001_2055; phage(gi410491537) 6e-113 Click
184599140..4599394 PHAGE_Salmon_SSU5: hypothetical protein; YpE1979001_2056; phage(gi410491538) 4e-42 Click
194599400..4600290 PHAGE_Salmon_SSU5: putative ABC transporter ATP-binding protein; YpE1979001_2057; phage(gi410491539) 1e-170 Click
204600300..4600566 PHAGE_Salmon_SSU5: hypothetical protein; YpE1979001_2058; phage(gi410491540) 9e-45 Click
214600762..4601403 PHAGE_Salmon_SSU5: putative DNA-binding protein; YpE1979001_2059; phage(gi410491411) 9e-116 Click
224601454..4602662 PHAGE_Salmon_SSU5: putative terminase large subunit; YpE1979001_2060; phage(gi410491412) 0.0 Click
234602696..4604270 PHAGE_Salmon_SSU5: hypothetical protein; YpE1979001_2061; phage(gi410491413) 0.0 Click
244604293..4605126 PHAGE_Salmon_SSU5: hypothetical protein; YpE1979001_2062; phage(gi410491414) 3e-149 Click
254605153..4606028 PHAGE_Salmon_SSU5: putative major capsid protein; YpE1979001_2063; phage(gi410491415) 4e-164 Click
264606956..4607255 PHAGE_Salmon_SSU5: hypothetical protein; YpE1979001_2065; phage(gi410491417) 5e-50 Click
27complement(4607892..4608095) hypothetical protein; YpE1979001_2067 0.0 Click
284608181..4608525 PHAGE_Salmon_SSU5: hypothetical protein; YpE1979001_2068; phage(gi410491419) 1e-59 Click

Region 5, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14687811..4688667 PROPHAGE_Escher_CFT073: transposase; YpE1979001_2380; phage(gi26248360) 1e-166 Click
24689068..4689814 PHAGE_Salmon_SSU5: putative Ig-like domain-containing protein; YpE1979001_2071; phage(gi410491422) 9e-135 Click
34689874..4690191 PHAGE_Salmon_SSU5: hypothetical protein; YpE1979001_2072; phage(gi410491423) 2e-52 Click
44690308..4690541 PHAGE_Salmon_SSU5: hypothetical protein; YpE1979001_2073; phage(gi410491424) 7e-39 Click
54690549..4695126 PHAGE_Salmon_SSU5: putative tail tape measure protein; YpE1979001_2074; phage(gi410491425) 0.0 Click
64695168..4695503 PHAGE_Salmon_SSU5: putative minor tail protein M; YpE1979001_2075; phage(gi410491426) 3e-60 Click
74695593..4696291 PHAGE_Salmon_SSU5: putative minor tail protein L; YpE1979001_2076; phage(gi410491427) 4e-137 Click
84696284..4697081 PHAGE_Salmon_SSU5: putative phage tail protein; YpE1979001_2077; phage(gi410491428) 3e-156 Click
94697069..4697656 PHAGE_Salmon_SSU5: putative phage tail protein; YpE1979001_2078; phage(gi410491429) 1e-105 Click
104697678..4702309 PHAGE_Salmon_SSU5: putative phage tail protein; YpE1979001_2079; phage(gi410491430) 0.0 Click
114702366..4702944 PHAGE_Entero_phiP27: hypothetical protein P27p57; YpE1979001_2080; phage(gi18249921) 2e-22 Click
124703025..4705913 PHAGE_Salmon_SSU5: putative phage tail fiber protein; YpE1979001_2081; phage(gi410491431) 3e-118 Click