Yersinia pestis biovar Antiqua str. B42003004 [asmbl_id: NC_000000].903826, GC%: 47.20%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 7 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(139398..140357) PHAGE_Lactob_phiAT3_NC_005893: putative transposase B; YpB42003004_1258; phage(gi48697274) 8e-15 Click
2complement(140429..140875) ISAfe5, transposase OrfA; YpB42003004_1259 0.0 Click
3complement(140959..141099) PHAGE_Salmon_SP_004_NC_021774: major tail sheath protein; YpB42003004_1260; phage(gi526003633) 2e-13 Click
4complement(142779..143078) PHAGE_Salmon_SP_004_NC_021774: baseplate wedge subunit; YpB42003004_1264; phage(gi526003628) 1e-24 Click
5complement(143075..143329) PHAGE_Salmon_SP_004_NC_021774: phage baseplate assembly protein; YpB42003004_1265; phage(gi526003627) 1e-18 Click
6143465..143737 PHAGE_Burkho_phiE202_NC_009234: gp6, pANL56; YpB42003004_1266; phage(gi134288760) 3e-12 Click
7143718..144008 PHAGE_Burkho_phiE202_NC_009234: gp7, pANL12; YpB42003004_1267; phage(gi134288781) 4e-07 Click

Region 2, total : 49 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1381065..381095 attL    ATATTGAATAAGCCGAGTTGGGCTAAATAAC 0.0 Click
2complement(381121..382359) PHAGE_Salmon_Fels_1_NC_010391: putative bacteriophage integrase; YpB42003004_1484; phage(gi169257156) 2e-125 Click
3383450..384229 PROPHAGE_Escher_CFT073: transposase/IS protein; YpB42003004_1487; phage(gi26248359) 2e-142 Click
4complement(384957..385655) PHAGE_Pseudo_F116_NC_006552: DNA adenine methyltransferase; YpB42003004_1488; phage(gi56692911) 5e-53 Click
5385682..386128 PHAGE_Cronob_ENT47670_NC_019927: putative ninB protein; YpB42003004_1489; phage(gi431810524) 6e-47 Click
6386202..386807 PHAGE_Edward_FW_3_NC_026611: N/A; YpB42003004_1490; phage(gi764162320) 6e-60 Click
7386976..387197 PHAGE_Escher_P13374_NC_018846: antiterminator Q; YpB42003004_1491; phage(gi410491636) 8e-18 Click
8387194..387319 conserved hypothetical protein; YpB42003004_1492 0.0 Click
9387468..388031 PHAGE_Salmon_SPN3UB_NC_019545: hypothetical protein; YpB42003004_1493; phage(gi423262398) 2e-29 Click
10388455..388664 conserved hypothetical protein; YpB42003004_1494 0.0 Click
11389410..389922 PHAGE_Cronob_phiES15_NC_018454: putative endolysin; YpB42003004_1495; phage(gi401817587) 3e-51 Click
12389907..390365 PHAGE_Entero_cdtI_NC_009514: lysin; YpB42003004_1496; phage(gi148609441) 3e-24 Click
13complement(390462..390584) hypothetical protein; YpB42003004_1497 0.0 Click
14390911..391624 PHAGE_Cronob_ENT47670_NC_019927: phage antirepressor protein; YpB42003004_1498; phage(gi431810509) 9e-50 Click
15complement(391697..391813) hypothetical protein; YpB42003004_1499 0.0 Click
16392081..392716 PHAGE_Pectob_ZF40_NC_019522: putative transposase; YpB42003004_1500; phage(gi422936679) 4e-87 Click
17392747..393196 PHAGE_Salmon_vB_SosS_Oslo_NC_018279: hypothetical protein; YpB42003004_1501; phage(gi399528759) 6e-51 Click
18393200..393784 PHAGE_Cronob_phiES15_NC_018454: terminase large subunit; YpB42003004_1502; phage(gi401817592) 7e-65 Click
19393832..395040 PROPHAGE_Escher_CFT073: transposase; YpB42003004_1503; phage(gi26246249) 0.0 Click
20395045..396019 PHAGE_Cronob_phiES15_NC_018454: terminase large subunit; YpB42003004_1504; phage(gi401817592) 8e-144 Click
21397408..398520 PHAGE_Cronob_phiES15_NC_018454: hypothetical protein; YpB42003004_1507; phage(gi401817594) 4e-123 Click
22398642..399415 PHAGE_Xantho_Xp15_NC_007024: putative phage structural protein; YpB42003004_1508; phage(gi66392059) 1e-19 Click
23399429..400634 PHAGE_Acinet_Bphi_B1251_NC_019541: major capsid protein; YpB42003004_1509; phage(gi423262007) 1e-113 Click
24400682..401164 PHAGE_Cronob_phiES15_NC_018454: hypothetical protein; YpB42003004_1510; phage(gi401817598) 3e-23 Click
25401161..401415 PHAGE_Salmon_SSU5_JQ965645: hypothetical protein; YpB42003004_1511; phage(gi390013963) 1e-19 Click
26401417..401767 PHAGE_Cronob_phiES15_NC_018454: putative structural protein 2; YpB42003004_1512; phage(gi401817599) 7e-33 Click
27401769..402353 PHAGE_Entero_EK99P_1_NC_024783: putative tail protein; YpB42003004_1513; phage(gi682122969) 7e-28 Click
28402350..402757 PHAGE_Cronob_phiES15_NC_018454: hypothetical protein; YpB42003004_1514; phage(gi401817601) 2e-16 Click
29402823..403743 PHAGE_Cronob_phiES15_NC_018454: putative major tail protein; YpB42003004_1515; phage(gi401817602) 4e-75 Click
30403756..404067 PHAGE_Cronob_phiES15_NC_018454: hypothetical protein; YpB42003004_1516; phage(gi401817603) 1e-31 Click
31404376..407879 PHAGE_Entero_c_1_NC_019706: tail length tape measure protein; YpB42003004_1517; phage(gi428781748) 7e-152 Click
32407882..408223 PHAGE_Cronob_phiES15_NC_018454: putative minor tail protein; YpB42003004_1518; phage(gi401817607) 2e-31 Click
33408397..409149 PHAGE_Entero_HK225_NC_019717: minor tail protein; YpB42003004_1519; phage(gi428782393) 4e-101 Click
34409152..409862 PHAGE_Entero_HK140_NC_019710: minor tail protein K; YpB42003004_1520; phage(gi428781957) 1e-108 Click
35410123..410755 conserved hypothetical protein; YpB42003004_1521 0.0 Click
36411389..411556 PHAGE_Escher_TL_2011b_NC_019445: hypothetical protein; YpB42003004_1522; phage(gi418487672) 9e-15 Click
37411630..412637 PHAGE_Haemop_Aaphi23_NC_004827: putative antirepressor protein Ant; YpB42003004_1523; phage(gi31544021) 5e-37 Click
38412850..413287 PHAGE_Cronob_phiES15_NC_018454: hypothetical protein; YpB42003004_1525; phage(gi401817606) 7e-08 Click
39complement(413259..413378) hypothetical protein; YpB42003004_1524 0.0 Click
40413430..413645 putative phage-related lipoprotein; YpB42003004_1526 0.0 Click
41413701..414321 PHAGE_Entero_mEpX2_NC_019705: tail assembly protein; YpB42003004_1527; phage(gi428765633) 1e-65 Click
42414363..414527 P10; YpB42003004_1528 0.0 Click
43415228..416436 PROPHAGE_Escher_CFT073: transposase; YpB42003004_1530; phage(gi26246249) 0.0 Click
44416441..419419 PHAGE_Cronob_phiES15_NC_018454: putative host specificity protein; YpB42003004_1531; phage(gi401817611) 0.0 Click
45419419..420417 PHAGE_Cronob_phiES15_NC_018454: hypothetical protein; YpB42003004_1532; phage(gi401817612) 1e-24 Click
46420434..421351 PHAGE_Edward_eiAU_183_NC_023555: putative tail protein; YpB42003004_1533; phage(gi589889269) 5e-14 Click
47421362..421781 PHAGE_Bacter_APSE_2_NC_011551: tail fiber; YpB42003004_1534; phage(gi212499733) 2e-10 Click
48421778..421933 conserved hypothetical protein; YpB42003004_1535 0.0 Click
49complement(422002..423210) PROPHAGE_Escher_CFT073: transposase; YpB42003004_1536; phage(gi26246249) 0.0 Click
50423401..423431 attR    ATATTGAATAAGCCGAGTTGGGCTAAATAAC 0.0 Click
51complement(424691..425890) PHAGE_Faustovirus_NC_024302: cysteine desulfurase; YpB42003004_1538; phage(gi655871957) 7e-41 Click