Yersinia pestis biovar Antiqua str. B42003004 [asmbl_id: NC_000000].4841690, GC%: 47.68%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 7 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(139398..140357) PHAGE_Lactob_phiAT3: putative transposase B; YpB42003004_1258; phage(gi48697274) 6e-15 Click
2complement(140429..140875) ISAfe5, transposase OrfA; YpB42003004_1259 0.0 Click
3complement(140959..141099) PHAGE_Entero_PsP3: gp21; YpB42003004_1260; phage(gi41057373) 1e-13 Click
4complement(142779..143078) PHAGE_Entero_PsP3: gp16; YpB42003004_1264; phage(gi41057368) 8e-25 Click
5complement(143075..143329) PHAGE_Entero_PsP3: gp15; YpB42003004_1265; phage(gi41057367) 9e-19 Click
6143465..143737 PHAGE_Burkho_phiE202: gp6, pANL56; YpB42003004_1266; phage(gi134288760) 2e-12 Click
7143718..144008 PHAGE_Burkho_phiE202: gp7, pANL12; YpB42003004_1267; phage(gi134288781) 3e-07 Click

Region 2, total : 49 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1381065..381095 attL    ATATTGAATAAGCCGAGTTGGGCTAAATAAC 0.0 Click
2complement(381121..382359) PHAGE_Salmon_1: putative bacteriophage integrase; YpB42003004_1484; phage(gi169257156) 1e-125 Click
3383450..384229 PROPHAGE_Escher_CFT073: transposase/IS protein; YpB42003004_1487; phage(gi26248359) 1e-142 Click
4complement(384957..385655) PHAGE_Pseudo_F116: DNA adenine methyltransferase; YpB42003004_1488; phage(gi56692911) 3e-53 Click
5385682..386128 PHAGE_Cronob_ENT47670: putative ninB protein; YpB42003004_1489; phage(gi431810524) 5e-47 Click
6386202..386807 PHAGE_Salmon_ST160: NinG; YpB42003004_1490; phage(gi318065938) 4e-43 Click
7386976..387197 PHAGE_Escher_TL_2011c: putative late gene regulator Q; YpB42003004_1491; phage(gi418487066) 6e-18 Click
8387194..387319 conserved hypothetical protein; YpB42003004_1492 0.0 Click
9387468..388031 PHAGE_Salmon_SPN3UB: hypothetical protein; YpB42003004_1493; phage(gi423262398) 1e-29 Click
10388455..388664 conserved hypothetical protein; YpB42003004_1494 0.0 Click
11389410..389922 PHAGE_Cronob_phiES15: putative endolysin; YpB42003004_1495; phage(gi401817587) 2e-51 Click
12389907..390365 PHAGE_Entero_cdtI: lysin; YpB42003004_1496; phage(gi148609441) 2e-24 Click
13complement(390462..390584) hypothetical protein; YpB42003004_1497 0.0 Click
14390911..391624 PHAGE_Cronob_ENT47670: phage antirepressor protein; YpB42003004_1498; phage(gi431810509) 6e-50 Click
15complement(391697..391813) hypothetical protein; YpB42003004_1499 0.0 Click
16392081..392716 PHAGE_Pectob_ZF40: putative transposase; YpB42003004_1500; phage(gi422936679) 3e-87 Click
17392747..393196 PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; YpB42003004_1501; phage(gi399528759) 4e-51 Click
18393200..393784 PHAGE_Cronob_phiES15: terminase large subunit; YpB42003004_1502; phage(gi401817592) 5e-65 Click
19393832..395040 PROPHAGE_Escher_CFT073: transposase; YpB42003004_1503; phage(gi26246249) 0.0 Click
20395045..396019 PHAGE_Cronob_phiES15: terminase large subunit; YpB42003004_1504; phage(gi401817592) 5e-144 Click
21397408..398520 PHAGE_Cronob_phiES15: hypothetical protein; YpB42003004_1507; phage(gi401817594) 3e-123 Click
22398642..399415 PHAGE_Xantho_Xp15: putative phage structural protein; YpB42003004_1508; phage(gi66392059) 1e-19 Click
23399429..400634 PHAGE_Acinet_Bphi_B1251: major capsid protein; YpB42003004_1509; phage(gi423262007) 1e-113 Click
24400682..401164 PHAGE_Cronob_phiES15: hypothetical protein; YpB42003004_1510; phage(gi401817598) 2e-23 Click
25401161..401415 PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_1511; phage(gi410491538) 8e-20 Click
26401417..401767 PHAGE_Cronob_phiES15: putative structural protein 2; YpB42003004_1512; phage(gi401817599) 5e-33 Click
27401769..402353 PHAGE_Shigel_EP23: putative tail protein; YpB42003004_1513; phage(gi371496282) 2e-27 Click
28402350..402757 PHAGE_Cronob_phiES15: hypothetical protein; YpB42003004_1514; phage(gi401817601) 1e-16 Click
29402823..403743 PHAGE_Cronob_phiES15: putative major tail protein; YpB42003004_1515; phage(gi401817602) 3e-75 Click
30403756..404067 PHAGE_Cronob_phiES15: hypothetical protein; YpB42003004_1516; phage(gi401817603) 9e-32 Click
31404376..407879 PHAGE_Entero_mEp213: tail length tape measure protein; YpB42003004_1517; phage(gi428782602) 5e-152 Click
32407882..408223 PHAGE_Cronob_phiES15: putative minor tail protein; YpB42003004_1518; phage(gi401817607) 1e-31 Click
33408397..409149 PHAGE_Entero_HK225: minor tail protein; YpB42003004_1519; phage(gi428782393) 3e-101 Click
34409152..409862 PHAGE_Entero_HK140: minor tail protein K; YpB42003004_1520; phage(gi428781957) 8e-109 Click
35410123..410755 conserved hypothetical protein; YpB42003004_1521 0.0 Click
36411389..411556 PHAGE_Escher_TL_2011b: hypothetical protein; YpB42003004_1522; phage(gi418487672) 6e-15 Click
37411630..412637 PHAGE_Haemop_Aaphi23: putative antirepressor protein Ant; YpB42003004_1523; phage(gi31544021) 3e-37 Click
38412850..413287 PHAGE_Cronob_phiES15: hypothetical protein; YpB42003004_1525; phage(gi401817606) 5e-08 Click
39complement(413259..413378) hypothetical protein; YpB42003004_1524 0.0 Click
40413430..413645 putative phage-related lipoprotein; YpB42003004_1526 0.0 Click
41413701..414321 PHAGE_Entero_mEpX2: tail assembly protein; YpB42003004_1527; phage(gi428765633) 9e-66 Click
42414363..414527 P10; YpB42003004_1528 0.0 Click
43415228..416436 PROPHAGE_Escher_CFT073: transposase; YpB42003004_1530; phage(gi26246249) 0.0 Click
44416441..419419 PHAGE_Cronob_phiES15: putative host specificity protein; YpB42003004_1531; phage(gi401817611) 0.0 Click
45419419..420417 PHAGE_Cronob_phiES15: hypothetical protein; YpB42003004_1532; phage(gi401817612) 9e-25 Click
46420434..421351 PHAGE_Salmon_SSU5: putative phage tail fiber protein; YpB42003004_1533; phage(gi410491431) 2e-09 Click
47421362..421781 PHAGE_Bacter_2: tail fiber; YpB42003004_1534; phage(gi212499733) 2e-10 Click
48421778..421933 conserved hypothetical protein; YpB42003004_1535 0.0 Click
49complement(422002..423210) PROPHAGE_Escher_CFT073: transposase; YpB42003004_1536; phage(gi26246249) 0.0 Click
50423401..423431 attR    ATATTGAATAAGCCGAGTTGGGCTAAATAAC 0.0 Click
51complement(424691..425890) PHAGE_Africa_virus: NifS-like protein; YpB42003004_1538; phage(gi9628230) 4e-08 Click

Region 3, total : 15 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14291433..4292038 PHAGE_Acinet_Ac42: hypothetical protein; YpB42003004_0551; phage(gi311992578) 7e-19 Click
2complement(4292228..4293082) glutathione S-transferase; YpB42003004_0552 0.0 Click
34293333..4294679 conserved hypothetical protein; YpB42003004_0553 0.0 Click
4complement(4294786..4295961) PHAGE_Clostr_phiCD38_2: tail tape measure; YpB42003004_0554; phage(gi333798123) 7e-05 Click
54296022..4296135 hypothetical protein; YpB42003004_0555 0.0 Click
64296315..4296824 PHAGE_Hypert_2: IS element Dka2 orfA; YpB42003004_0556; phage(gi300116744) 5e-15 Click
7complement(4297007..4297219) PHAGE_Lactoc_bIL312: Csp; YpB42003004_0557; phage(gi13095918) 4e-17 Click
8complement(4297479..4297691) PHAGE_Lactoc_bIL312: Csp; YpB42003004_0558; phage(gi13095918) 3e-17 Click
9complement(4298224..4298691) PHAGE_Escher_TL_2011b: putative outer membrane lipoprotein; YpB42003004_0559; phage(gi418487638) 2e-08 Click
104298999..4299115 hypothetical protein; YpB42003004_0560 0.0 Click
114299167..4299979 metallo-beta-lactamase family protein; YpB42003004_0561 0.0 Click
124300044..4300934 PHAGE_Synech_S_SM1: 6-phosphogluconate dehydrogenase; YpB42003004_0562; phage(gi326782617) 5e-11 Click
134301109..4301507 carboxymuconolactone decarboxylase family protein; YpB42003004_0563 0.0 Click
144301661..4303025 PHAGE_Burkho_phi1026b: gp59; YpB42003004_0564; phage(gi38707949) 1e-21 Click
154303115..4303777 PHAGE_Strept_phiC31: gp26; YpB42003004_0565; phage(gi40807292) 3e-05 Click

Region 4, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4522343..4525231) PHAGE_Salmon_SSU5: putative phage tail fiber protein; YpB42003004_3737; phage(gi410491431) 3e-118 Click
2complement(4525312..4525890) PHAGE_Entero_phiP27: hypothetical protein P27p57; YpB42003004_3738; phage(gi18249921) 2e-22 Click
3complement(4525947..4530578) PHAGE_Salmon_SSU5: putative phage tail protein; YpB42003004_3739; phage(gi410491430) 0.0 Click
4complement(4530600..4531187) PHAGE_Salmon_SSU5: putative phage tail protein; YpB42003004_3740; phage(gi410491429) 1e-105 Click
5complement(4531175..4531972) PHAGE_Salmon_SSU5: putative phage tail protein; YpB42003004_3741; phage(gi410491428) 3e-156 Click
6complement(4531965..4532663) PHAGE_Salmon_SSU5: putative minor tail protein L; YpB42003004_3742; phage(gi410491427) 4e-137 Click
7complement(4532753..4533088) PHAGE_Salmon_SSU5: putative minor tail protein M; YpB42003004_3743; phage(gi410491426) 3e-60 Click
8complement(4533130..4537707) PHAGE_Salmon_SSU5: putative tail tape measure protein; YpB42003004_3744; phage(gi410491425) 0.0 Click
9complement(4537715..4537948) PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_3745; phage(gi410491424) 7e-39 Click
10complement(4538065..4538382) PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_3746; phage(gi410491423) 2e-52 Click
11complement(4538442..4539188) PHAGE_Salmon_SSU5: putative Ig-like domain-containing protein; YpB42003004_3747; phage(gi410491422) 9e-135 Click
12complement(4539263..4539646) PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_3748; phage(gi410491421) 6e-68 Click
13complement(4539648..4540121) PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_3749; phage(gi410491420) 4e-84 Click
14complement(4540112..4540456) PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_3750; phage(gi410491419) 1e-59 Click
15complement(4540554..4541387) PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_3751; phage(gi410491418) 9e-155 Click
16complement(4541387..4541821) PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_3752; phage(gi410491417) 1e-75 Click
17complement(4541865..4542527) PHAGE_Salmon_SSU5: putative Ig-like domain-containing protein; YpB42003004_3753; phage(gi410491416) 5e-114 Click
18complement(4543849..4543968) hypothetical protein; YpB42003004_0492 0.0 Click
194544379..4545968 PHAGE_Prochl_P_SSM2: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase; YpB42003004_0493; phage(gi61806062) 5e-72 Click

Region 5, total : 22 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14580269..4581354 PHAGE_Salmon_SSU5: putative exonuclease subunit 1; YpB42003004_2650; phage(gi410491483) 0.0 Click
24581617..4583500 PHAGE_Salmon_SSU5: putative exonuclease subunit 2; YpB42003004_2651; phage(gi410491485) 0.0 Click
34583490..4584236 PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_2652; phage(gi410491486) 4e-138 Click
44584976..4585485 PROPHAGE_Salmon_Ty2: transposase; YpB42003004_2654; phage(gi29143766) 6e-84 Click
54585685..4585966 PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_2655; phage(gi410491525) 5e-48 Click
6complement(4586022..4586213) hypothetical protein; YpB42003004_2656 0.0 Click
74586172..4586654 PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_2657; phage(gi410491527) 3e-86 Click
84587172..4587315 PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_2658; phage(gi410491528) 4e-17 Click
9complement(4587605..4588255) PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_2659; phage(gi410491530) 5e-118 Click
10complement(4588579..4588707) PHAGE_Salmon_SSU5: putative repressor of phase 1 flagellin; YpB42003004_2660; phage(gi410491531) 2e-17 Click
11complement(4589111..4589533) PHAGE_Salmon_SSU5: putative lipoprotein; YpB42003004_2661; phage(gi410491532) 4e-65 Click
12complement(4589593..4589871) PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_2662; phage(gi410491533) 1e-44 Click
13complement(4589874..4591433) PHAGE_Salmon_SSU5: putative helicase; YpB42003004_2663; phage(gi410491534) 0.0 Click
144591516..4592196 PHAGE_Salmon_SSU5: putative ParB-like nuclease domain-containing protein; YpB42003004_2664; phage(gi410491535) 6e-124 Click
154592196..4592864 PHAGE_Salmon_SSU5: putative ParB-like nuclease domain-containing protein; YpB42003004_2665; phage(gi410491536) 8e-118 Click
164592861..4593499 PHAGE_Salmon_SSU5: putative ABC transporter ATP-binding protein; YpB42003004_2666; phage(gi410491537) 6e-113 Click
174593492..4593746 PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_2667; phage(gi410491538) 4e-42 Click
184593752..4594642 PHAGE_Salmon_SSU5: putative ABC transporter ATP-binding protein; YpB42003004_2668; phage(gi410491539) 1e-170 Click
194595113..4595754 PHAGE_Salmon_SSU5: putative DNA-binding protein; YpB42003004_2670; phage(gi410491411) 9e-116 Click
204595757..4597013 PHAGE_Salmon_SSU5: putative terminase large subunit; YpB42003004_2671; phage(gi410491412) 0.0 Click
214597047..4598621 PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_2672; phage(gi410491413) 0.0 Click
224598644..4599496 PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_2673; phage(gi410491414) 7e-156 Click

Region 6, total : 37 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14644001..4644015 attL    TAAAAAATATTTTTT 0.0 Click
24644554..4645057 PROPHAGE_Ralsto_GMI1000: ISRSO12-transposase ORFB protein; YpB42003004_0193; phage(gi17546158) 1e-57 Click
34645326..4645337 attL    CAATAATATCTA 0.0 Click
4complement(4645643..4646509) effector protein YopJ; YpB42003004_0195 0.0 Click
5complement(4646510..4646626) conserved hypothetical protein; YpB42003004_0196 0.0 Click
6complement(4646905..4649103) PHAGE_Maruca_MNPV: protein kinase 1; YpB42003004_0197; phage(gi119964537) 2e-05 Click
7complement(4650306..4650512) conserved hypothetical protein; YpB42003004_0200 0.0 Click
8complement(4651718..4652584) plasmid replication protein RepA; YpB42003004_0201 0.0 Click
9complement(4652893..4653018) putative replication regulatory protein; YpB42003004_0202 0.0 Click
10complement(4653950..4654357) PHAGE_Entero_Sf6: putative transposase OrfB; YpB42003004_0203; phage(gi41057343) 7e-22 Click
11complement(4654381..4654698) PROPHAGE_Xantho_33913: ISxac3 transposase; YpB42003004_0204; phage(gi21231087) 4e-07 Click
12complement(4654870..4655328) putative DNA helicase TraI; YpB42003004_0205 0.0 Click
134655478..4655666 PHAGE_Entero_Sf6: gene 56 protein; YpB42003004_0206; phage(gi41057344) 2e-09 Click
14complement(4655731..4655847) YomA; YpB42003004_0207 0.0 Click
15complement(4655992..4656927) PHAGE_Cronob_vB_CsaM_GAP32: adhesin; YpB42003004_0208; phage(gi414087345) 1e-13 Click
16complement(4656873..4657001) hypothetical protein; YpB42003004_0209 0.0 Click
174657901..4658281 PROPHAGE_Xantho_33913: ISxcc1 transposase; YpB42003004_0212; phage(gi21232565) 3e-32 Click
18complement(4658278..4659583) PROPHAGE_Xantho_33913: Tn5041 transposase; YpB42003004_0211; phage(gi21231545) 2e-30 Click
19complement(4659584..4660503) transposase; YpB42003004_4025 0.0 Click
204660667..4661218 PHAGE_Salisa_1: hypothetical protein; YpB42003004_4026; phage(gi388570712) 3e-28 Click
214661237..4661701 hypothetical protein; YpB42003004_4027 0.0 Click
224662269..4662535 PROPHAGE_Ralsto_GMI1000: isrso12-transposase orfa protein; YpB42003004_4028; phage(gi17546157) 7e-35 Click
234662559..4663368 PROPHAGE_Ralsto_GMI1000: ISRSO12-transposase ORFB protein; YpB42003004_4029; phage(gi17546158) 8e-81 Click
24complement(4663516..4663941) YopH-specific chaperone SycH; YpB42003004_4030 0.0 Click
254664160..4664172 attL    TAAAAAAAAACAG 0.0 Click
26complement(4664285..4664716) PROPHAGE_Escher_CFT073: transposase/IS protein; YpB42003004_4031; phage(gi26248359) 3e-24 Click
27complement(4664716..4665888) PROPHAGE_Escher_CFT073: transposase; YpB42003004_4032; phage(gi26248360) 4e-33 Click
284665929..4666057 conserved hypothetical protein; YpB42003004_4033 0.0 Click
294666021..4666635 PROPHAGE_Xantho_33913: IS1477 transposase; YpB42003004_4034; phage(gi77747809) 9e-60 Click
30complement(4666698..4667090) YopE regulator YerA; YpB42003004_4035 0.0 Click
314667479..4667943 outer membrane virulence protein YopE; YpB42003004_4036 0.0 Click
32complement(4668083..4668382) plasmid stabilization system protein, RelE/ParE family; YpB42003004_4037 0.0 Click
33complement(4668375..4668581) putative addiction module antidote protein, CC2985 family; YpB42003004_4038 0.0 Click
344669091..4669103 attR    TAAAAAAAAACAG 0.0 Click
354669162..4669335 PHAGE_Cronob_ENT39118: DNA polymerase; YpB42003004_4040; phage(gi431811050) 2e-07 Click
36complement(4669464..4669577) hypothetical protein; YpB42003004_4041 0.0 Click
37complement(4669745..4670710) PHAGE_Entero_N15: ParB; YpB42003004_4042; phage(gi9630491) 3e-79 Click
38complement(4670707..4671825) PHAGE_Entero_N15: plasmid partition protein SopA; YpB42003004_4043; phage(gi9630492) 1e-156 Click
39complement(4672334..4672471) hypothetical protein; YpB42003004_4044 0.0 Click
40complement(4673461..4673732) PHAGE_Entero_Sf6: gene 56 protein; YpB42003004_4048; phage(gi41057344) 3e-12 Click
41complement(4673968..4674285) PROPHAGE_Xantho_33913: ISxac3 transposase; YpB42003004_0249; phage(gi21231087) 1e-06 Click
424678088..4678099 attR    CAATAATATCTA 0.0 Click
434679257..4679271 attR    TAAAAAATATTTTTT 0.0 Click

Region 7, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14781789..4782220 PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_0215; phage(gi410491466) 2e-75 Click
24782340..4783368 PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_0216; phage(gi410491467) 0.0 Click
34783429..4784373 PHAGE_Salmon_SSU5: DNA polymerase I; YpB42003004_0217; phage(gi410491468) 0.0 Click
44784373..4784639 PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_0218; phage(gi410491469) 2e-43 Click
54784642..4785718 PHAGE_Salmon_SSU5: putative RecA-like recombinase; YpB42003004_0219; phage(gi410491470) 0.0 Click
64785809..4786009 PHAGE_Salmon_SSU5: hypothetical protein; YpB42003004_0220; phage(gi410491471) 1e-29 Click
74786013..4786149 PHAGE_Salmon_SSU5: putative SPFH domain / band 7 protein; YpB42003004_0221; phage(gi410491472) 6e-20 Click
8complement(4786150..4790736) PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; YpB42003004_3243; phage(gi414087138) 3e-54 Click
94790938..4791051 hypothetical protein; YpB42003004_0597 0.0 Click
10complement(4791358..4791552) rop protein; YpB42003004_0598 0.0 Click
11complement(4792589..4793368) PROPHAGE_Escher_CFT073: transposase/IS protein; YpB42003004_0599; phage(gi26248359) 1e-142 Click