Vibrio cholerae B33 , whole genome shotgun [asmbl_id: NC_000000].4026835, GC%: 47.48%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 43 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1193046..193069 attL    GAAAAGGGGCTTTTCTTTTTTCTG 0.0 Click
2complement(193279..194316) PHAGE_Vibrio_K139: Int; A5E_2523; phage(gi17975106) 0.0 Click
3complement(194316..194729) PHAGE_Vibrio_K139: Glo; A5E_2522; phage(gi17975107) 5e-73 Click
4complement(194729..195634) PHAGE_Vibrio_K139: hypothetical protein K139p03; A5E_2521; phage(gi17975108) 1e-173 Click
5196453..196665 PHAGE_Vibrio_K139: Cox; A5E_2520; phage(gi17975110) 3e-34 Click
6196776..197315 PHAGE_Vibrio_K139: CII; A5E_2519; phage(gi17975111) 1e-95 Click
7197328..197762 PHAGE_Vibrio_K139: hypothetical protein K139p07; A5E_2518; phage(gi17975112) 2e-78 Click
8197844..198377 PHAGE_Vibrio_K139: hypothetical protein K139p08; A5E_2517; phage(gi17975113) 1e-92 Click
9198374..198784 PHAGE_Vibrio_K139: hypothetical protein K139p09; A5E_2516; phage(gi17975114) 4e-34 Click
10199034..199261 PHAGE_Vibrio_K139: hypothetical protein K139p11; A5E_2515; phage(gi17975116) 1e-38 Click
11199258..199875 PHAGE_Vibrio_K139: putative DNA methyltransferase; A5E_2514; phage(gi17975117) 9e-119 Click
12199979..200563 PHAGE_Vibrio_K139: hypothetical protein K139p13; A5E_2513; phage(gi17975118) 1e-97 Click
13200572..203145 PHAGE_Vibrio_K139: rep; A5E_2512; phage(gi17975119) 0.0 Click
14203155..203691 PHAGE_Vibrio_K139: hypothetical protein K139p15; A5E_2511; phage(gi17975120) 7e-102 Click
15complement(203765..204103) PHAGE_Vibrio_K139: hypothetical protein K139p16; A5E_2510; phage(gi17975121) 1e-56 Click
16204341..204586 PHAGE_Vibrio_K139: hypothetical protein K139p17; A5E_2509; phage(gi17975122) 2e-39 Click
17complement(204587..204715) PHAGE_Vibrio_K139: zinc-finger protein; A5E_2508; phage(gi17975123) 7e-18 Click
18complement(204909..205124) PHAGE_Vibrio_K139: hypothetical protein K139p19; A5E_2507; phage(gi17975124) 5e-36 Click
19complement(205108..206169) PHAGE_Vibrio_K139: putative capsid portal protein; A5E_2506; phage(gi17975125) 0.0 Click
20complement(206151..207968) PHAGE_Vibrio_K139: putative terminase, ATPase subunit; A5E_2505; phage(gi17975126) 0.0 Click
21208142..209041 PHAGE_Vibrio_K139: putative capsid scaffolding protein; A5E_2504; phage(gi17975127) 2e-176 Click
22209078..210088 PHAGE_Vibrio_K139: putative major capsid protein; A5E_2503; phage(gi17975128) 3e-173 Click
23210104..210820 PHAGE_Vibrio_K139: putative terminase, endonuclease subunit; A5E_2502; phage(gi17975129) 2e-135 Click
24210927..211388 PHAGE_Vibrio_K139: putative head completion protein; A5E_2501; phage(gi17975130) 1e-81 Click
25211385..211873 PHAGE_Vibrio_K139: hypothetical protein K139p26; A5E_2500; phage(gi17975131) 3e-91 Click
26211860..212519 PHAGE_Vibrio_K139: putative tail completion protein; A5E_2499; phage(gi17975132) 4e-75 Click
27212521..213630 PHAGE_Vibrio_K139: putative tail sheath protein; A5E_2498; phage(gi17975134) 0.0 Click
28213630..214088 PHAGE_Vibrio_K139: putative tail tube protein; A5E_2497; phage(gi17975135) 1e-83 Click
29214103..214312 PHAGE_Vibrio_K139: C4-type zinc-finger; A5E_2496; phage(gi17975136) 2e-36 Click
30214309..214536 PHAGE_Vibrio_K139: hypothetical protein K139p32; A5E_2495; phage(gi17975137) 2e-39 Click
31214523..215110 PHAGE_Vibrio_K139: putative endolysin; A5E_2494; phage(gi17975138) 2e-112 Click
32215085..215426 PHAGE_Vibrio_K139: hypothetical protein K139p34; A5E_2493; phage(gi17975139) 7e-58 Click
33215476..215637 PHAGE_Vibrio_K139: hypothetical protein K139p35; A5E_2492; phage(gi17975140) 6e-21 Click
34215634..215915 PHAGE_Vibrio_K139: hypothetical protein K139p35; A5E_2491; phage(gi17975140) 7e-48 Click
35215966..216100 PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_37; A5E_2490; phage(gi148727165) 3e-06 Click
36216112..217929 PHAGE_Vibrio_K139: putative tail length determinator; A5E_2489; phage(gi17975141) 0.0 Click
37217919..218251 PHAGE_Vibrio_K139: hypothetical protein K139p37; A5E_2488; phage(gi17975142) 2e-57 Click
38218248..219447 PHAGE_Vibrio_K139: hypothetical protein K139p38; A5E_2487; phage(gi17975143) 0.0 Click
39219444..220103 PHAGE_Vibrio_K139: hypothetical protein K139p39; A5E_2486; phage(gi17975144) 4e-128 Click
40220100..221962 PHAGE_Vibrio_K139: putative tail fiber protein; A5E_2485; phage(gi17975145) 0.0 Click
41221962..222486 PHAGE_Vibrio_K139: putative tail fiber assembly protein; A5E_2484; phage(gi17975146) 7e-99 Click
42222489..223382 PHAGE_Vibrio_K139: hypothetical protein K139p42; A5E_2483; phage(gi17975147) 8e-166 Click
43223370..223843 PHAGE_Vibrio_K139: hypothetical protein K139p43; A5E_2482; phage(gi17975148) 5e-83 Click
44223840..225471 PHAGE_Vibrio_K139: hypothetical protein K139p44; A5E_2481; phage(gi17975149) 0.0 Click
45226156..226179 attR    GAAAAGGGGCTTTTCTTTTTTCTG 0.0 Click

Region 2, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(455439..455645) PHAGE_Entero_P4: transcriptional regulator; A5E_2085; phage(gi9627517) 3e-09 Click
2455759..456235 DNA repair protein RadC, putative; A5E_2086 0.0 Click
3456232..456369 hypothetical protein; A5E_2087 0.0 Click
4complement(456465..457160) hypothetical protein; A5E_2088 0.0 Click
5complement(457157..458029) PHAGE_Entero_Sf6: putative transposase OrfB; A5E_A0512; phage(gi41057343) 3e-115 Click
6complement(458026..458370) PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; A5E_A0511; phage(gi24373865) 7e-08 Click
7complement(458377..459417) PHAGE_Escher_D108: tail assembly protein; A5E_2091; phage(gi281199687) 2e-27 Click
8complement(459552..459911) PHAGE_Entero_Mu: hypothetical protein Mup41; A5E_2092; phage(gi9633532) 2e-09 Click
9complement(459960..460337) hypothetical protein; A5E_2093 0.0 Click
10complement(460392..460970) hypothetical protein; A5E_2094 0.0 Click
11complement(460989..461309) transcriptional regulator, putative; A5E_2095 0.0 Click
12complement(461296..461670) PHAGE_Entero_Mu: Mor; A5E_2096; phage(gi9633507) 3e-07 Click
13complement(462250..462483) conserved hypothetical protein; A5E_2097 0.0 Click
14complement(462480..462941) hypothetical protein; A5E_2098 0.0 Click
15complement(462944..464095) PHAGE_Pseudo_B3: putative transposase B subunit; A5E_2099; phage(gi56692579) 1e-45 Click
16complement(464025..465782) PHAGE_Pseudo_B3: putative transposase A subunit; A5E_2100; phage(gi56692580) 2e-93 Click

Region 3, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11799842..1799854 attL    TTGCCCATCACTA 0.0 Click
2complement(1808420..1809319) PHAGE_Pseudo_73: hypothetical protein ORF037; A5E_0758; phage(gi148912865) 8e-09 Click
3complement(1809688..1811001) PHAGE_Lactob_Lj771: minor tail protein gp26-like protein; A5E_0757; phage(gi163932195) 9e-07 Click
41811310..1812032 PHAGE_Parame_NY2A: hypothetical protein NY2A_B016L; A5E_0756; phage(gi157952320) 3e-08 Click
51812120..1813391 PHAGE_Cafete_BV_PW1: putative superfamily II helicase/eIF-4AIII; A5E_0755; phage(gi310831360) 7e-44 Click
6complement(1813513..1815102) PHAGE_Lausan: putative translation elongation factor 1-alpha; A5E_0754; phage(gi327409596) 4e-05 Click
7complement(1815359..1816006) PHAGE_Entero_IME10: repressor protein; A5E_0753; phage(gi422934295) 8e-36 Click
81816124..1816375 PHAGE_Aggreg_S1249: phage protein; A5E_0752; phage(gi273809591) 8e-09 Click
91816431..1817300 conserved hypothetical protein; A5E_0751 0.0 Click
101817287..1817949 PHAGE_Vibrio_VvAW1: hypothetical protein; A5E_0750; phage(gi460042923) 5e-40 Click
111817936..1818484 transglycosylase SLT domain, putative; A5E_0749 0.0 Click
121818481..1818780 conserved hypothetical protein; A5E_0748 0.0 Click
131818777..1819310 transcriptional activator; A5E_0747 0.0 Click
141819368..1819799 conserved hypothetical protein; A5E_0746 0.0 Click
15complement(1819832..1823401) sex pilus assembly; A5E_0745 0.0 Click
16complement(1823405..1824793) sex pilus assembly; A5E_0744 0.0 Click
17complement(1824796..1825728) conserved hypothetical protein; A5E_0743 0.0 Click
181825642..1825654 attR    TTGCCCATCACTA 0.0 Click
19complement(1825997..1826956) PHAGE_Strept_MM1: integrase; A5E_0742; phage(gi15088744) 1e-08 Click

Region 4, total : 7 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13569257..3569901 PHAGE_Vibrio_CTX: RstA; A5E_1763; phage(gi332672300) 2e-122 Click
23569879..3570262 PHAGE_Vibrio_CTX: RstB; A5E_1762; phage(gi332672301) 4e-70 Click
33570398..3570646 PHAGE_Vibrio_CTX: Cep; A5E_1761; phage(gi332672302) 8e-38 Click
43570657..3571940 PHAGE_Vibrio_CTX: hypothetical protein; A5E_1760; phage(gi332672303) 0.0 Click
53571937..3572230 PHAGE_Vibrio_CTX: Ace; A5E_1759; phage(gi332672304) 3e-51 Click
63572227..3573426 PHAGE_Vibrio_CTX: Zot; A5E_1758; phage(gi332672305) 0.0 Click
73573525..3574301 PHAGE_Vibrio_CTX: CtxA; A5E_1757; phage(gi332672306) 3e-154 Click